18 Aralık 2017,Pazartesi
Anasayfa » Tag Archives: yaygın

Tag Archives: yaygın

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

Bilim yayıncılığına yaygın 'yayımlamak için ödeme planları …

                                                                                                          Kredi: Charles Rondeau / public domain      Çoğu à ‡ arşamba günü bildirilen "yayınlanmak üzere ödemeler" şemalarını araştırmaya karar verdikleri araştırmacılar, düzinelerce bilimsel dergi sahte bir özgeçmiş üzerine yazı işleri müdürlerine kurgusal bir bilim adamı atadılar.                                                                                 Uğruluk operasyonunda canı sıkılan bir dergide, hayali başvuru sahibine, araştırmalarını yayınlamak isteyen bilim adamlarından toplanan …

Devamını Oku »

Metanobaktiğin ve Bakır ile Bactanın Bağlantısı … Özet Methanobactins (mbs), düşük molekül ağırlıklı (<1,200 Da) bakır- Birçok metan oksitleyici bakteri (metanotrof) tarafından üretilen bağlayıcı peptidler veya chalkophores. Bu moleküller belirli demir bağlama sideroforlarına benzerlikler gösterir, ancak bakır sınırlamasına yanıt olarak eksprese edilir ve salgılanır. Yapısal olarak, mbs, bakır koordinasyon bölgesini oluşturan ilişkili tiyoamit gruplarına sahip bir çift heterosiklik halkayla karakterize edilir. Halkalardan biri her zaman bir oksazolondur ve ikinci halka bir oksazolon, bir imidazolon veya bir pirazindion parçasıdır. Mb molekülü, (i) halka oluşumu, (ii) bir lider peptid dizisinin bölünmesi ve (iii) bazı durumlarda bir sülfat grubunun eklenmesi de dahil olmak üzere bir dizi posttranslasyonel modifikasyona uğramış bir peptid öncüsünden kaynaklanmaktadır. İşlevsel olarak, mbs bakır alım sisteminin hücre dışı bileşenini temsil eder. Bakır alımındaki bu rolü ile tutarlı olarak, mbs bakır iyonları için yüksek afiniteye sahiptir. Bağlandıktan sonra, mbs hızla Cu 2+ 'i Cu 1+ e indirir. Bağlayıcı bağlamaya ek olarak, mbs çoğu geçiş metalini ve geçiş metaline yakın bağlar ve ana metanotrof yanı sıra diğer bakterileri toksik metallerden korur. Mbslere, başta redoks ve metal bağlayıcı özelliklerine dayanan diğer birçok fizyolojik fonksiyonlar atanmıştır. Bu derlemede, bu yeni metal bağlayıcı peptit tipinin mevcut durumunu inceliyoruz. Potansiyel uygulamalarını, mbslerin çoklu metallerin biyoyararlanımını nasıl değiştirebildiğini ve mbs'lerin metanotrofların fizyolojisinde nasıl oynayabileceğini de keşfediyoruz. GİRİŞ Methanobactins (mbs) ilk önce aerobik metan oksitleyici bakterilerde (metanotroflar) tanımlandı. Bu göze çarpan bakteri grubu, karbon ve enerjinin tek kaynağı olarak metan kullanarak büyüyebilir. Oksijen ve metanın bulunduğu ortamlarda bulunurlar ve biyosferde üretilen metanların çoğunun tüketilmesinde önemli bir rol oynarlar ve böylece küresel ısınmaya olan etkilerini azaltıyorlar (1, -4). Metanogenezis (5) yoluyla üretilen, ucuz, kolay bulunabilen ve yenilenebilir karbon kaynağı ile üretildikleri takdirde, metanotrofların toplu ve ince kimyasalların üretimi için ve çevre kirleticilerin biyolojik olarak temizlenmesinde önemli bir potansiyeli vardır (2, 6 , -8). Metan üzerinde yetişen bir bakterinin ilk raporu, 1906'da Hollanda'da Delft'te bulunan Beijerinck'in laboratuvarında çalışan Söhngen tarafından yapıldı; bu gaz, 1906'da Bacillus metanicus'un izolasyonunu Su bitkileri ve gölet suyu (9). 50 yıl sonra bu mikropun yeniden izole edildiği ve adı değiştirildi Pseudomonas metanica (10, 11). İkinci metanotrof, Metilokokus kapsülatus (Texas türü), 1966'da izole edildi (12). Methanotrof biyolojisindeki bir dönüm noktası, Whittenbury ve meslektaşları tarafından çeşitli karasal ve tatlı su ortamlarından izole edildiğinde ve metan üzerinde büyüyen 100 yeni aerobik metanotrofu anlatan 1970'de geldi (13). Daha sonra bu metanotrofların metan üzerinde yetişebilme yeteneği, karbon asimilasyonunun yolakları, istirahat evreleri (kistler ve sporlar) oluşumu, morfoloji, kompleks intrasitoplazmik zarın bulunduğuna dayanarak tip II'ye karşı tip II sınıflandırması geliştirdiler. Düzenlemeler ve DNA'ların mol yüzdeleri G + C içeriği. Daha sonra, Bowman ve meslektaşları çeşitli ortamlardan benzer sayıda metanotrof izole etti ve bunları Whittenbury ve meslektaşlarının programına ve 16S rRNA filogenezine (14, 15) göre sınıflandırdılar. O sırada hiçbir DNA sıralamasının yapılmamış olmasına rağmen, Whittenbury ve arkadaşlarının genel sınıflandırma şeması bugün metanotrofların gruplandırılmasında sağlam ve kullanışlı bir yöntem olmaya devam etmektedir. Buna göre şu anda 15 jenerat metanotrof bulunmaktadır Gammaproteobakteri sınıfının Methylococcaceae ve 3'ünde Methylothermaceae ailesi bulunmaktadır. Metilobakter Metilokaldum Metilokokus Metilogea Metiloglobulus Metilomagnum ] Metilomarinat Metilpomfurus Metilfosfamid Metilfosfat, Metilpomkarboksilik Asit Metanol, Metilokarboksilik Asit Metilpomkarboksilik Asit Metilpomkarboksilik Asit Metanol (19459016, Metilosarkin (19459016) ve Metilovüum ailesi metanotroflarıdır ve Metilohalobius Metilomarinovum , Ve Metiltermermus Metiltothermaceae familyasındaki metanotroflardır (16, -21, 227). Methylocystaceae familyasında ve Metilocella familyasında Alphaproteobacteria cins Methylosinus ve Methylocystis , Metiloferula ve Metilokapsa 'nın ailesi Beijerinkiaceae'de . Son 15 yılda, çoğul bileşiklerini büyüme için kullanabilen Metilokolella Metilokapsa ve Metilokistis cinslerinde fakültatif metanotroflara ilişkin raporlar artmaktadır Metan (22, -26). Günümüzde ayrıca, Crenothrix ve Clonothrix gibi diğer cinslerden filamentli metanotroflar ve yüksek sıcaklıklarda büyüyen ve düşük sıcaklıklarda yetişen cins Methylacidiphilum'un nonproteobakteriyel (verrucomicrobial) metanotrofları PH da yakınlarda keşfedilmiştir (27). Son olarak NC10 filumunun bir üyesi olan "Candidatus Metilomirabilis oksifizasyonu" zorunlu anaerob olmasına rağmen metan oksidasyonu için dioksijen ürettiğini gösterdi (28,29). Birlikte ele alındığında, bu veriler gezegenimizin birçok ekosisteminde metanotrofik bakterilerin yaygın doğasını açık bir şekilde göstermektedir. Metanotrofların fizyolojisi ve biyokimyası Metanotroflar metan'ı bir enerji kaynağı olarak kullanabilir ve ayrıca (6, 30, 31) için karbon sağlamaktır. Metanın metanole ilk oksidasyonu metan monooksigenaz enzim (MMO) tarafından katalize edilir. Aynı moleküler metan oksidasyon problemine (32, -37) evrimsel olarak bağımsız çözümler üreten MMO, membrana bağlı veya partikülat MMO (pMMO) ve sitoplazmik veya çözünür MMO (sMMO) olmak üzere iki yapısal ve biyokimyasal açıdan farklı formlar vardır . SMMO, aynı zamanda sınıf I ribonükleotid R2 alt-birimi için homolog olan çözünebilir di-demir monooksigenazlar (SDIMOs) (38) olarak bilinen geniş bir bakteri hidrokarbon oksijenaz grubuna ait olan üç komponentli bir bin nuclear demir aktif merkez monooksigenazdır Redüktaz. Methylococcus capsulatus (Bath) (39, -43) ve Methylosinus trichosporium OB3b (44, -47) 'den elde edilen iki çok benzer sMMO sistemi ayrıntılı olarak incelenmiştir. SMMO altı genli bir operon, mmoXYBZDC tarafından kodlanır ve üç bileşene sahiptir: (i) bir α-hidroksilazokinaz ile bir 250-kDa hidroksilaz (19459022) α alt birimlerinin (MmoX) substrat oksijenasyonunun meydana geldiği yerde çift çekirdekli demir aktif merkezini içerdiği yapı, (ii) flavin adenin dinükleotidli 39-kDa NAD (P) H bağımlı redüktaz (MmoC) FAD) ve Fe (19459022) 2 2 protez grupları ve (iii) protein B olarak bilinen bir 16-kDa bileşenini (MmoB) veya protez grupları içermeyen kuplaj / geçitlendirme proteini veya Metal iyonları (39, 48). Protein B için (39, 53, 54) hidroksilaz bileşeni (49, -52), nükleer manyetik rezonans (NMR) -tabutulan yapılar için X-ışını kristal yapıları vardır ve bu bileşiğin flavin alanı için bir NMR türetilmiş yapı vardır Redüktaz (55). Üç bileşen tarafından oluşturulan kompleks, küçük açı X-ışını saçılım analizi ve biyofiziksel olarak elektron paramanyetik rezonans spektroskopi, ultra-santrifüjleme ve kalorimetrik analiz ile yapısal olarak incelenmiştir (56, 57). SMMO'nun katalitik döngüsü kapsamlı bir şekilde incelenmiş ve çift-çekirdekli demir merkezindeki oksijen ve hidrokarbon aktivasyon mekanizmasının anlaşılmasına yönelik mükemmel ilerlemeler yapılmıştır (45) (45, 58, -62). Bununla birlikte, pMMO, bakır ve muhtemelen demir içeren membrana bağlı enzimdir (6, 37, 47, 63, 64). Tip I metanotroflardaki veziküler disklerin şeklini alan sıradışı intrasitoplazmik membranlar ve tip II organizmalarda eşleştirilmiş periferik tabakalar ile ilişkilidir (65, -75). İntrasitoplazmik membranlar pMMO'da zenginleştirilir ve sukroz yoğunluk gradyanlarında sedimantasyon hızı temelinde sitoplazmik membrandan fiziksel olarak ayrılabilir (76). PMMO'nun yapısı ve mekanizması hakkında bir anlayış, enzim çözünürken aktivite kaybından dolayı sMMO için olana göre daha yavaş ortaya çıkmıştır. PMMO, genler pmoCAB tarafından kodlanan yaklaşık 49, 27 ve 22 kDa'lık üç polipeptitten oluşur (77). Metanotroflarda genellikle bu pmo genlerinin birden fazla kopyası vardır (78, 79). Son yıllardaki araştırmalar, doğal pMMO'nun, hidroksilamin oksidoredüktaz ve amonyak monooksigenaz redoks çiftleri (82, -85) için bulunana benzer şekilde, pMMO'ya elektronlar (80, 81) sağlayabilecek metanol dehidrojenazı (MeDH) ile kompleks oluşturduğunu göstermiştir ). Bazı metanotroflar, mesela M. Kapsülatus (Banyo) ve M. Trichosporium OB3b, her iki MMO formunu üretebilir. En bilinen metanotroflar yalnızca pMMO'ya sahiptir, örneğin Metilomonas metanika Metilomikrobiyum album BG8, Metilokistis parvus OBBP ve verrukomikrobik ve NC10 metanotroflar. Beijerinckiaceae ailesindeki, örneğin Metilasella silvestris ve Metiloferula stellata içindeki sadece birkaç metanotrofun sMMO'ya sahip olduğu, ancak pMMO'ya sahip olmadığı (21, 86) MMO tarafından üretilen metanol, bir kalsiyum veya nadir toprak bağımlı pirroloquinoline quinone (PQQ) içeren MeDH (87, -91) ile formaldehite oksitlenir. Formaldehit, metanotrofik metabolizmanın metabolizmasının önemli bir koludur ve bir karbon (C 1 ara ürününün enerji elde etmek için CO 2'ye oksitlenebildiği veya asimile edildiği noktayı temsil eder Biyokütleye dönüştürdü. Formaldehid toksik olduğundan, metanotroflar bu metabolik ara maddenin birikimine karşı kendilerini korumalıdırlar. Formaldehit metabolizması için çoklu yollar metanotroflarda bulunur (2, 26, 92, -96). Örneğin, formaldehitin oksidatif dissimilasyonu, boya bağlı membrana bağlı (93) yoluyla ya da NAD + yoluyla tetrahidrometanopterine (H 4) [97,98] konjügasyonuyla ortaya çıkabilir ] Bağımlı (95, 96, 99) formaldehit dehidrogenazlar. Formül, formaldehidin formaldehit dehidrogenazlar tarafından oksidasyonundan kaynaklanır ve daha sonra metan, biyosentetik reaksiyonlar ve enerjinin oksidasyonu için NADH üreten bir NAD + [bağımlıformatdihidrojenazilekarbondioksit'eoksitlenirHücreiçinesil(100-102)Metanotroflaraynızamandaalfaproteobakteriyelvegammaproteobakteriyelmetanotroflardaaktifolanformaldehitinbiyokütleyeserinveribulozmonofosfat(RuMP)döngülerinefiksasyonuiçinikiyolasahiptirMetanotroflardakikarbonfiksasyonyolaklarıkapsamlıolarakgözdengeçirildi(bkzÖrneğinreferans6) Metanotroflardaki "Bakır Anahtar" Metan karakterizasyonu için erken teşebbüsler MMO'nun hücresel konumu hakkında farklı raporlar vasıtasıyla oksidasyon karmaşıktı. MMO'lar, suşuna ve bazı suşlar için raporlama laboratuvarına bağlı olarak çözünebilir veya membran ile ilişkili olarak tanımlanmıştır. Çeşitli gruplar başlangıçta partikül veya zar fraksiyonunda aktivite bildirdiler (103, 104), buna karşılık diğer gruplar çözünür fraksiyonda aktivite saptamıştı (105, 106). Sonraki çalışmalar hücresel konumun ekim koşullarına göre değiştiğini gösterdi. Oksijen kısıtlamasının çözünür fraksiyonda metan oksidasyonunu indüklediği bildirildi M. Trikosporium OB3b (36, 107). Bununla birlikte, oksijenin düzenleyici faktör olmadığı ve membrana bağlı ve çözünen aktiviteler arasındaki geçişin biyokütle konsantrasyonuyla ilişkili olduğu gösterildi (108). Bu "geçiş" in keşfedilmesinde tanımlayıcı an, Dalton ve meslektaşlarının M büyümeye çalıştıkları zamandı. Parvus OBBP, kemostat kültüründe yüksek hücre yoğunluklarına. M. Parvus OBBP, nispeten düşük hücre yoğunluklarında metan, hava ve nitrat mineral tuzları (NMS) çözeltisiyle birlikte verildiğinde büyümeyi durdurdu. Bununla birlikte, ek eser element çözümü eklendiğinde, kültürler derhal büyümeye başladı. İz element solüsyonundaki "gizli içerik", bakır iyonlarına indirgenmiştir (108). Daha sonra, M. Parvus OBBP, yalnızca bakır iyonlarına yüksek gereksinim getiren pMMO içeriyordu ve M ile o sırada gözlenen aynı yüksek hücre yoğunluklarına ulaşmasına izin verecek bir sMMO içermiyordu. Kapsülatus Banyo ve M. Trichosporium OB3b, bakır sınırlaması altında. Aynı suşlarla karşı karşıya kalındığında, suşlar sMMO'nun ifadesine geçti ve büyümeyi sürdürdü (35, 109). İlginç bir şekilde, bakırın daha önce sMMO içermeyen metanotrof olan Methanomonas margaritae 'nın büyümesini arttırdığı gösterildi, ancak bu orijinal gözlemler hiçbir zaman daha fazla araştırılmadı (110) Dalton ve arkadaşları Gözlemlerini detaylı bir şekilde incelediler ve bu "bakır geçiş" in varlığını kurdular, yani, iki farklı MMO formunun, hem sMMO hem de sMMO'ya sahip olan metanotrof kültürlerinin bakır-to-biyokütle oranına yanıt olarak metanotroflardaki ifadesinin düzenlenmesi PMMO. Metanotrofların metal bağımlı büyümesi üzerine daha önceki gözlemlerin birçoğunu açıklamalarını sağladı. Örneğin, M. Kapsülatus Banyo, sMMO'nun ekspresyonu yalnızca ortamdaki bakır iyonları tükendiğinde yüksek hücre yoğunluklarında gözlemlenirken, fazla bakır iyonlarının ilavesi bu metanotrofun aktif pMMO'yu ifade etmesine izin vermiştir. Daha sonra, Murrell ve meslektaşları moleküler seviyede, düşük konsantrasyonlarda bakır iyonlarıyla büyümenin altında sMMO ifadesi, sMMO gen kümesinin yukarı akışında σ 54 promotöründe başlatıldığını gösterdi ( mmoXYBZDC ). Tersine, yüksek bakır büyüme koşulları altında, sMMO ekspresyonu bastırılmış ve pMMO kodlayan genlerin yüksek seviyelerde ekspresyonu ( pmoCAB ) her ikisine de izin vermiştir. Trichosporium OB3b ve M. Kapsülatus Banyo, pMMO (34, 111, -113) kullanılarak büyüyecektir. Daha ileri araştırmalar bakırın metanotrofik fizyolojiyi ve gen ifadesini daha geniş ölçüde etkilediğini ortaya koymuştur. Örneğin, metanotroflardaki intrasitoplazmik zar içeriğinin büyüme ortamında bakır arttıkça arttığı bulundu (66, 109, 114). Bununla birlikte, bu tamamen beklenmedik değildi: pMMO'nun intrasitoplazmik zarlarda lokalize olduğu göz önüne alındığında, pMMO'nun daha fazla ekspresyonu ve aktivitesi bu zarların mantıksal olarak daha fazlasını gerektirir. Bununla birlikte, daha şaşırtıcı bir şekilde, pMMO'nun ve mxa operon tarafından kodlanan PQQ'ya bağlı MeDH'nin, intrasitoplazmik membranlara sabitlenmiş bir süper kompleks oluşturduğunu ve elektronun, PQQ-bağlantılı MeDH'den pMMO'ya In vivo metan oksidasyonunu tetikleyebilir (80,81). Son bulguyu destekleyerek yakın zamanda, pmo genlerinin ekspresyonu arttıkça arttığını değil, mxa operonundaki genlerin çoğunun da arttığını bulduk ) Proteomik yöntemle, metanın karbondioksit ile oksitlenmesindeki ilave basamaklar, lipid, hücre duvarı ve membran sentezinde rol oynayan proteinler gibi bakır kullanımının artmasıyla aşırı eksprese edildiği de gösterilmiştir ( 66, 115). Tersine, metanotrofların karbonu metandan poli-3-hidroksibutirat'a yöneltme yeteneği, bakırın bulunabilirliğini azaltarak artar (66, 116), bu da metanotrofların enerji metabolizmasının bakır tarafından kontrol edildiğini düşündürmektedir. Böyle bir sonuca Dalton ve arkadaşları daha önce ulaşmıştı ki metanotroflardaki metanotroflardaki biyolojik kütle verimi ve karbon dönüşüm etkinliği, bakır arttıkça, yani metanotroflar sMMO ifade ederek pMMO'yu ifade etmeye geçtiğinde (117) arttığını gösteriyordu. Dış zarın dış yüzeyindeki "yüzeysel" veya proteinler, bazı metanotroflarda bakır bulunması ile de kontrol edilir. Bakır alımına dahil olduğuna inanılan çok sayıda çoklu sitokrom ve proteinin ifadesi de bakırın bulunabilirliği arttıkça değişir ve çoğu durumda azalır (118, -123). Metanotrofların bakırı nasıl tuttuğu üzerine ilave bilgiler, yeni bir bakır depolama proteini ailesinin Csps'in keşfedilmesiyle sağlandı . Trikosporyum OB3b (124). Bu metanotrof, üç Csp'ye sahiptir: Csp1 ve Csp2, ikiz arginin translokaz hedefleme sinyal peptidlerini öngörmüşlerdir ve bu nedenle katlanmanın ardından sitosolik Csp3'den sonra ihraç edildiği düşünülmektedir. Csp1, paketin çekirdeğini gösteren Cys kalıntıları vasıtasıyla 52 Cu 1+ iyonuna kadar bağlanabilen dört heliks demetinin bir tetramerini oluşturur. SMMO'ya geçiş, vahşi türe göre, Δ csp1 csp2 mutantında hızlandırılmış olup, bu proteinlerin pMMO için bakır depolamada rol oynadığını ve bakır sınırlandığında bir dahili bakır kaynağı temin ettiğini düşündürmektedir. Bu koşullar altında, tüm Cu 1+ 'i Cspl'den kolayca kaldırabilen ve dolayısıyla Csp1 bağlı bakırın kullanılmasına yardımcı olan bir rol oynayabilecek mb üretilmektedir. ] Bir bakıra özgü alım sistemi öneren kanıtlar Bakır özgül alım sistemi ve hücre dışı bir bakır bağlama ligandının üretilmesi için ilk kanıt, yapıcı sMMO mutantlarının (sMMO ) fenotipik karakterizasyonu sırasında ortaya çıktı. C ) M. Trikosporyum [1958016] OB3b (125, 126). Phelps ve ark. (126), beş sMMO C mutantını M kültürleyerek izole etti. Trikosporium diklorometan mevcudiyetinde OB3b, metan monooksigenaz ile formetil klorüre dönüşümü için kometabolik dönüşümü takiben bir mutajen olarak işlev görür. SMMO C fenotipine ek olarak, sMMO mutantları bakır alımında kusurluydı (125, 127, 128). Kültür ortamında çözünür olmayan bakır karşısında sert bir artış da gözlendi ve Fe'ye benzer bir ekstraselüler Cu 2+ kompleks yapıcı ajan (lar) üretimine ilişkin spekülasyonlar teşvik edildi Fe 3+ Komplike siderophores (127). Sonraki çalışmalar düşük molekül kütleli bir bakır bağlama ligandının varlığını ortaya çıkarmıştır, ancak bu bileşiğin kimliğini belirlememişti (125, 127). Methanobactin'in İlk Tanımlanması ve İzolasyonu (Bir Bakır Bağlayıcı Bileşik veya "Chalkophore") Biraz paradoksal olarak, "bakır bağlayıcı ligand" veya "bakır bağlayıcı bileşik" önce M'den izole edildi. Kapsülat pMMO'nun arıtılması sırasında ve dolayısıyla yüksek bakır konsantrasyonlarında (73) banyo. Bu bakır bağlayıcı bileşiğin pMMO'dan ayrılması, düşük molekül ağırlıklı bir sarı-flüoresan bakır ihtiva eden molekülü ortaya çıkarmıştır. Bu molekülün renk ve flüoresan özellikleri, düşük bakır ortamda kültürlenen hücrelerde görülen suda çözünebilen pigmentinkine benzerdi (73). Bu suda çözünür pigmentin karakterizasyonu, pMMO ile birleşmiş bakır bağlayıcı bileşik ile özdeş olduğu ortaya çıktı (73, 128). Methanotroflarla suda çözünen pigmentlerin üretimi, birçok tip suşun ilk izolasyonu sırasında 40 yıl önce kaydedildi ancak düşük demirli ortamda kültürlenen hücrelerle ilişkilendirildi (13). Bakır bağlayıcı bileşik, molekülün Gram pozitif bakterilere karşı antimikrobiyal etkinliğine dayanılarak sonuçta metanobaktin (mb) olarak adlandırıldı (129, 130). Tanımlandıktan sonra, bu bakır bağlama bileşiği, bir dizi farklı metanotrofda izole edildi veya tanımlandı; bunlara aşağıdakileri içeren metil bromür albumin BG8 (131), Metiloksisit soyu SB2 (132), Metiloksisit (133), (197) Methylocystis hirsuta Methylocystis M türü (133) CSC1 (133) ve (suş SV97). Mb'lerin kristal yapıları M. Trichosporium [1358.016] OB3b (134,135), M. Hirsuta CSC1 (133) ve Metiloksisit suşu M (133) saptanmıştır. Ayrıca, Methylocystis suşu SB2 (132) ve Mbr'lerin kimyasal yapıları. Rosea (133) çıkarıldı. Bu yorum farazi mbs sıralı genomları ile Methanotroph anlaşılabilir sağladı bu mbs üzerinde durulacak. Methanobactins olarak Chalkophores İşlevsel olarak, mbs siderofor benzer. Sideroforlarda olduğu gibi, düşük bakır koşullarında (125, 126, 128, 136, -138) bakteriler tarafından üretilen düşük moleküler kütleli (<1,200-Da) bileşiklerdir. Yunancadan demir taşıyan ya da demir taşıyan siderophores'in adlandırılmasından sonra, mbsler chalkophores (bakır taşıyan ya da bakır taşıyan) (134, 139). Mbs şu anda bu grubun bilinen tek temsilcisi. Bir bakır alım sisteminin hücre dışı bileşeni rolü ile tutarlı olarak, mbs bakır iyonları için bilinen en yüksek bağlanma afinitelerine sahiptir (2, 131, 135, 138, 140, 141) (19459000) mb'lerin metal bağlayıcı afiniteleri ( K ). [PubMed] TABLO 1 "başlık =" Tablo 1 "/> Trikosporium Metil sistein M türü Methylocystis hirsuta methylcystis CSC1, Metilkistis Methylocystis rosea ve Methylocystis streyn SB2 bir Her ne kadar chalkophores ve siderofor Bir dizi özellik paylaştığında, bu iki metal bağlayıcı bileşik grubu çeşitli şekillerde ayrılabilir. Fitoziderofor domoik asit (142) haricinde, sideroforlar demir sınırlaması altında eksprese edilirken, chalkophores bakır sınırlaması altında eksprese edilir. Birçok siderofor bakır bağlar ve chalkophores demir bağlayabilir (142, -148); Bununla birlikte, farklı metal bağlama sabitleri iki grubu karakterize eder ve bu farka göre ayırt etmek için kolorimetrik analizler geliştirilmiştir (138, 149, 150). Yapısal olarak chalkophores, tipik heterosiklik halkalar ve ilişkili tiyoamit grupları (ve) ile siderophores'den farklıdır. Farklı halka sistemleri, molekülün metal bağlama özelliklerini (131, 133, -136, 138, 148, 151) tanımlamak ve karakterize etmek için kullanılabilen karakteristik UV-görünür emiş, dairesel dikroizm (CD) ve floresan spektral özelliklere sahiptir , -153). Uyarılma enerjisi transferi, ışık toplama komplekslerinin (155, -157) kromoforları için gözlemlendiği gibi mb'deki (136, 154) iki halka arasında meydana gelir ve bu da mbs'nin floresan özelliklerine neden olur. Örneğin, mbs emisyon yoğunluğu halkalardan birinin seçici hidrolizi ile artmakta ve metal eklenmesinin ardından emisyon yoğunluğu sıklıkla artmaktadır (132, 136, -138, 141, 148, 154). Yine, bu özellik hem mbs tanımlamada hem de karakterizasyonu için kullanılabilir Tam uzunlukta mb-OB3b'nin (135 (133) (C), mb- (133) (D) ve mb-SB2 (132) (A), mb- (E). yıldızlarla hepsini olmasa da bazı örneklerde görülmektedir ile Amino asitler işaretlenmiş. ve Çekirdek özellikleri Mbs. AA, amino asit (ler). R grupları Arg, Ile, Met veya Pro olabilir Ancak, açıklanan özelliklerin tamamı mbs'leri tanımlamak için yeterli değildir. Örneğin, Clostridium cellulolyticum mbs'lere (158, -160) benzer bir molekül kütlesi olan bir bakır bağlayıcı sekonder metabolit olan klosthioamid üretir ve benzer mbs'ler, closthioamid tiyoamid gruplarına sahiptir, Cu 2 + ila Cu 1+ 2+ 1+ 1+ 1+ ). Closthioamine ayrıca mb üretimini taramak için kullanılan sıvı veya plaka bir analiz olan bakır-krom azural S (Cu-CAS) tahliliyle pozitif çıkacaktır (138, 149, 161). Bununla birlikte, klosthioamid spektroskopik olarak mbs'den ayırt edilebilir; Örneğin, klostihoamid, altı tiyoamit kısmı ile ayrılmış iki karakteristik fenolik grubundan kaynaklanan, 270 nm'de maksimum tek bir UV-görünür emme mukavemeti gösterir. Dahası, klostihoamit bir dinükleer Cu 1+ kompleksi oluşturabilmektedir. Ayrıca, mbs'lerin aksine, klostihoamid sentezi bakır tarafından düzenlenmez ve mbs'nin aksine, molekülün bir poliketit sintazı ile üretildiğine inanılır (aşağıya bakınız). Benzer şekilde, düşük bakır koşullarında , Paraküs denitrifikalılar aynı zamanda, bakır alımında rol alan düşük molekül ağırlıklı bir 716.18-Da porfirin, kopoporfirin III üretirler (162). Ne yazık ki, ilk yayında bakır bağlanma özellikleri bildirilmemiştir ve herhangi bir takip çalışmalarının farkında değiliz. Coproporphyrin III, tipik bir heme UV-görünür emilim spektrumuna sahiptir ve heme grubu tarafından koordine edilen metale bağlı olarak farklı γ, α ve β maksimumlarını gösterir ve bu mülke dayanan mbs'den ayırt edilmesini sağlar. METAL BAĞLAYICI ÖZELLİKLERİ Bağlama ve İlköğretim Metal indirgenmesi, Bakır mb bağlayan hem Cu 2+ ve Cu 1+ ve mb ile bağlanma pH'ya (135, 172) ve Cu 2+ / Cu'ya 1 + ila mb'ye 136, 141, 172) (). Aşağıda tartışıldığı gibi, mb Cu 1+ ve Cu 2+ 'in çözünür ve çözünmez formlarını kompleks yapabilir. Mb-OB3b ve mb-SB2'ye (136, 141) Cu 2+ ilavesi üzerine termodinamik, spektral ve kinetik çalışmalar yürütülmüştür. Bu çalışmalar (136, 141, 172) mb'nin hızla Cu 2+ 'i Cu 1+ ' e indirgemesi ile karmaşıktır. Cu 2+ 'in apo-mbs'ye eklendiği deneyler için yüksek bağlanma sabitinden sorumlu bakırın oksidasyon durumu bilinmediğinden, bu oksidasyon durumlarının bir karışımının, "Cu 2+ / Cu 1+ " Bu noktadan itibaren. Cu düşük oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b başlangıçta Cu 2+ / Cu 1+ [bağlar oligomer / tetramer olarak (136, 141). Kararlı halden önceki kinetik veriler, metalin ilk bağlanmasının yalnızca halkaların birinde ve buna bağlı tiyoamid üzerinde olduğunu göstermektedir. Mb-OB3b'de başlangıç ​​Cu 2+ / Cu 1+ koordinasyonu oksazolon A'ya ve ardından kısa (8 ila 10 ms) gecikme periyoduna ve daha sonra Oksazolon B (141). Cu yüksek oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b 2+ / Cu 1+ [19459008Cukoordinatları]Bir dimer olarak dimer olarak eklenir ve bunu takiben, mb-OB3b için 0.5 Cu'nin üzerinde 2+ / Cu 1+ ila-mb- OB3b. Mb-SB2, bakır-mb oranına bağlı olarak benzer bir tetramer-dimer-monomer bağlanma dizisini izlemektedir. Mb-SB2 için, Cu 2+ / Cu 1+ 'in ilk bağlanması imidazolon halkasına ve bunu takiben oksazolon halkasına (154) koordine edilir.

Mbs () için metal bağlanma afinite sabitlerini belirlemek için çeşitli yöntemler kullanılmıştır. Cu için afiniteler 1+ banyookuproin disülfonat gibi kromoforik ligand ile iyi kurulmuş bir yaklaşımı (173, -175) kullanarak rekabet çalışmaları ile belirlenebilir. Cu-mb'nin indirgeme potansiyeli ölçümü, daha sonra Cu 2+ afinitesinin hesaplanmasını sağlar. Bu yaklaşımı (133, 135) kullanarak analiz edilen tüm mbsler için Cu 1+ afinitesi ~ 10 M …

Devamını Oku »