25 Haziran 2017,Pazar
Anasayfa » Tag Archives: ve

Tag Archives: ve

Görme ve görme engelli …

Sürüm 1. Wellcome Open Res. 2016; 1: 8. 1 Liverpool Hope Üniversitesi, Liverpool, İngiltere ] SR, araştırmayı tasarladı, CM ve SR araştırmayı tasarladı, CM araştırmayı yaptı, CM ve SR verileri analiz etti, taslakları üretti ve el yazmasının nihai halini ve nihai içeriği kabul etti. ] Rekabet iddia eden menfaatler: Kabul Edildi 2016 26 Ekim. Telif hakkı: © 2016 McDonald C …

Devamını Oku »

Google Pixel 2 özellikleri ve fiyatı

Google'ın Google Pixel bir süredir serinin ikinci modeli Google Pixel 2 ile gündemde. Peki, Google'ın yeni amiral gemisi Google Pixel 2 özellikleri ne olacak? Bugün piyasaya çıkan bir rapor ışığında, bugüne kadar elde elde edilen tüm bilgileri sizler için topladık. Google Pixel 2 çıkış tarihi Her ne Pixel serisi henüz yeni değil Nexus serisinden bildiğimiz kadarıyla Google yeni cihazlar Eylül …

Devamını Oku »

Bereyle Kullanılan Saç Modelleri | Saçlarım ve Ben

Birçoğumuz özenle yaptığımız saç modeli bozulmasın diye bere takmayız. Hâlbuki kışın soğuğunu ve zorlanma hissettirdiği bugünlerde bere takmak şartı gibi görünüyor. Bere taktığı zaman saçlarının basıldığını ve formunu kaybettiğini düşünenler bere ile yapılan saç modellerine bir göz atmalı. Berenin artık sadece soğuktan korunmak için bir şubeyi kullandırdın unutmayın. Çok farklı renklerde, değişik aksesuarlarla süslenmiş, değişik tarzlardaki bereler ile siz de …

Devamını Oku »

Yeni Trend Bebek Kakülleri | Saçlarım ve Ben

Pek çoğumuz saçlarımızı kestirmek, radikal değişiklikler yapmak konusunda çekimser davranıyoruz. Kısa saçlı rahatlıkla alınmış olanlarsa bütün saçlarını uzatmayı düşünmüyor. Sık sık saç renkleri trendi bir yenisi giriyor. Hayatımıza. Saç modellerindeyse durum bu kadar cüretkar olmuyor. Bob ve lob kesim modelleri buitemiz tutuyoruz tabii. Lob ve bob saç kesim modelleri, son model modelleri arasındaydı. Şimdiyse trendi " bebek patlamaları " adı …

Devamını Oku »

Metin Favori Saç Modelleri | Saçlarım ve Ben

Yaz geldiğinde havuz, deniz ve güneş üçlüsü saçımızın kurumasına ve yıpranmasına neden olur. Buna da saç şekillendiricileri ve jöle, sprey gibi şekillendirici ürünler eklenir. Tüm bunlara rağmen, istediğimiz şekli yakalayamayız ya da o kadar emek harcayıp yaptığımız model çok çabuk bozulur. Birçoğumuz her zaman bakımlı ve açık saçlı dolaşmayı sevdiğimiz halde bu sıcak yaz günlerinde bunalır ve saçımızı toplamak isteriz. …

Devamını Oku »

Maşasız Dalgalı Saç Modelleri | Saçlarım ve Ben

Yüksek ısı ile sağlanacak daha çok ön tanımlı da saçlarımızı yarattığı için hepimiz biliyoruz. Düzleştirici ve saç maşasını sürekli kullanmak saçları kurutup daha çabuk kırılmasına sebep oluyor. Bu şekilde yıpranmış saç sık sık uçlarından aldırdığımızda istediğimiz boya gelmesi epey zaman alacaktır. Aynı zamanda saçların canlılığını ve parlaklıklarını yineleyebilirsin sebeplerini unutmayalım. Eğer saçlarınızın doğallığı gidermek için gözlem atmalısınız. Daha önce paylaştığımız …

Devamını Oku »

Yaz Trend Stili: Kıvırcık ve Dalgalı Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Son zamanlarda saç stilleri yumuşak kıvrımlı ve güzel dalgalar, son zamanlarda kadınlar arasında çok popüler. Farklı saç türleri ve yüz şekilleri için çok çeşitli kıvırcık ve dalgalı stiller ve saç ipuçları vardır. Önce, doğru saç kesimini seçmeniz gerekir, o zaman istediğiniz zaman güzel dalgalara ve virajlara sahip olabilirsiniz! 1. Kısa Kısa Kıvırcık Saçlar İşte bal güzel sarışın vurguları ve muhteşem …

Devamını Oku »

Doğadan Saçlara: Yapraklar ve Çiçeklerle Taç Yapımı

Yaratıcı bünyelerin kendine girdiği (DIY) katranları hayranlıkla izliyoruz. Stilini kişiselleştirmek isteyen, farklı olmayı sevenler için ucu bucağı olmayan müthiş alternatifler var. Saçlarınızı, ev dekorunuzu, kıyafetlerinizi ve aksesuarlarınızı hayal gücünüzle değiştirmek istediğiniz gibi yorumlayabiliyorsunuz! Saç modelleri ve saç aksesuarlarıyla ilgili onu tarza hitap eden, harika tasarımlar ve fikirler var. Bizim ilhamımız doğadan saçlarla, yapraklarla ve çiçeklerle taç yapımı. 🙂 Başlıyoruz. Yapraklarla …

Devamını Oku »

Dağınık Saç Modelleri | Saçlarım ve Ben

Son yılların trend saç modeliyle uğraş ama belli ölçü saç modellerinden oluşur. Dağınık saç modelleri hem daha modern hem de daha serin bir görünüm kazandırdığı için sokak trendini etkisi altına aldı safra. Sadece sokak trendi de değil, dağınık topuz saç modelleri hiç olmadığı kadar çok beğeni ediliyor son dönemlerde; Özel gecelerde ve davetlerde. Dağınık saç modeli bu kadar tutulmasının en …

Devamını Oku »

Altan kardeşler ve Ilıcak için karar belli oldu

                     2017-06-23 23:23:00                                                                      FETÖ'nün medya ayağına yönelik açılan davada 5 gündür savunma yapan gazeteciler Ahmet Altan, Mehmet Altan ve Nazlı Ilıcak'ın 6 tutuklu sanık hakkında karar çıktı. İstanbul Adalet Sarayı'ndaki 26. Ağır Ceza Mahkemesi'nde başlıyor beşinci duruşmaya sanıklar Nazlı Ilıcak ve Fevzi Yazıcı ve Yakup Şimşek getirildi. Tutuklu sanık Ahmet Altan, Mehmet Altan ve Şükrü Tuğrul …

Devamını Oku »

Kısa Gelin Saçı Modelleri | Saçlarım ve Ben

Yaz düğünleri tüm hızla devam ederken kısa saçlar için gelin başı modellerine bir göz atmak istedik. Tüm saç modelleri topuz olacak diye bir şey yok değil mi? Bu klasiğin biraz dışına çıkmak fena olmaz. Eskiden kırılmış, yıpranmış saçları safan ameliyattan önce kestirilmez, uzun saçtan daha şık gelin başı olur denilirdi. Sanki gelin saçının boyu güzelliği ile doğru orantılıymış gibi … …

Devamını Oku »

Neon Saç Renkleri | Saçlarım ve Ben

Saçlarınızda yeni renkler deneme konusunda ne kadar cesaretlisiniz? Saçınızı kahverengiye, siyaha, karamele gözünüz kapalı boyatabilirsiniz. Hatta birçoğumuzun cesaret edemediği sarıya safra belki. Peki ya mor, yeşil, turuncu? Aynı masalda bu renklerde de gösterebilir miydiniz? Eğer evetse cevabınız; neon renklerde dilediğiniz tonu yakalamanın zorunu bilelisiniz. Ayrıca sürekli boya istediklerini de söylemeye gerek yok herhalde. Ama yinede eveeet diyorsanız size ilham verecek …

Devamını Oku »

Saçlarla İlgili Pratik Bilgiler | Saçlarım ve Ben

1- Tel tokları uzunluğu üste gelecek şekilde takın, böylelikle saçlarınızı sımsıkı tutar ve kaymazlar. 2- Saçlarınızı yıkadıktan sonra geniş dişli bir tarak ile tarayın. Diğer taraklar saçlarınızın hasar görmesine neden olur. Daha da kolay taranmasını sormak için bir tarak kremliyken tarama işlemini yapın.

Devamını Oku »

Acun Ilıcalı ve Şeyma Subaşı'nın düğün yeri belli …

                     2017-06-22 18:24:00                                                                      Fransa'da evlenecek olan Acun Ilıcalı ve Şeyma Subaşı düğmeleri nerede yapacakları için hazırlıklara başladı. Acun Ilıcalı ve Subaşı önceki gün Fransa'nın Akdeniz kıyısında yerinde Cote d'azur bölgesine giderek düğün mekanı baktı. Ünlü işadamı Cem Hakko'nun eski eşi ve düğün planlayıcılığı işini yapan Bettina Machler ünlü çifte düğün mekanları gösterdi. Acun Ilıcalı ve Şeyma …

Devamını Oku »

10 Zırhlı Saç Stilleri – Seveceksiniz Oldukça, Posh, Eğlenceli ve Vintage Görünüyor

At kuyruğu saç stilleri sizin gibi basit veya gösterişli olabilir, çünkü her zaman moda. Bununla birlikte, en moda at kuyruklu saç modellerini giymek isterseniz, günümüzün yeni at kuyruğu fikirleri galerisine bakmanız gerekiyor. Bu saç biçimi, kadınlar için en eski saç modellerinden biri olabilir, ancak yine de kendi kişisel dokunuşumuzu eklemeyi seviyoruz! Gündelik saçlı saçlı saç modelleri için 4 sevimli detaylar

Devamını Oku »

Kıvırcık Saç Modelleri | Saçlarım ve Ben

Kıvırcık saçlı olmak güzeldir. Çok basit bir saç modeli, saf hıçkırık ve kıvır kıvır saçlarda enfes durur. Isılı şekillendiricilere maruz kalmazlar, bu yüzden de hep canlı ve sağlıklı görünürler. Kıvırcık saç modelleri saç köpüğü ile birlikte şekile girebilir ve ile saçı şekle sokmak için bir çok şey yapabilir. Tabii güzelim saçlarınızı düzleştirmek için ekstra bir efor harcamıyorsanız. 🙂 Dahası, oğul …

Devamını Oku »

Yarı Toplu Saç Modelleri | Saçlarım ve Ben

2015 saç modeli arasında kuaför yapımından uzak; Salaş ve doğal görünen saçlar yer alıyor. Önümüzdeki aylarda da yine aynı şey; Topuzdan at kuyruğuna, dalgalı saçlardan, yarı toplu saçlara tüm modelleri en doğal haliyle göreceğiz. Daha evvel paylaştığımız 8 Adımda Yarı Toplu Saç Yapımı yaz modelinde saç modelini uygulayabileceğinizden bahsetmiştik. Aynı zamanda modeller dilerseniz yardım almak.

Devamını Oku »

Ünlülerin Saç Renkleri | Saçlarım ve Ben

Saç renginde doğru karar kılmak çok önemli. Kaşınız, saçınız, göz renginiz ve teniniz saç renkleri siz yapacağınız tercih edilenlericileri. Sezonun saç trendleri arasında, iddialı bir saç rengi arayanlardan tutun minik dokunuşlar ile farklılık yaratmak isteyenlere kadar herkesin işte bu diyebileceği bir renk var. Önemli olan doğru rengi seçebilmek! Sizi sürekli makyaja mahkum bir saç rengi doğru değil. Saç renkleri öyle …

Devamını Oku »

Saçılar Gökkuşağı Modası | Saçlarım ve Ben

2015 yılının trendleri hayal sınırlarını saf zorlayacak cinsten. Neon saç modası, gri saç modası derken şimdi de gökkuşağı saç renkleri yükselişine başladı. Kimimiz bu trendlere sadece bakmakla yetiniyoruz. Ama aramızdaki bazı cesaretliler bakmıyor uygulama ve şaşırtıyor! Birçok ünlü akımın öncüsü değil, sokak trendleri de basbayağı gökkuşağı renginde. Gökkuşağının yer yüzündeki temasın kadınlarla birlikte gelin birlikte bakalım! Gökkuşağı saç modası "width …

Devamını Oku »

Tasarım Harikası Mudita Aksesuarları | Saçlarım ve Ben

Başkalarının mutluluğundan mutluluk duyanlar el kaldırsın! Sizi Mudita ile tanıştıracağız. Diğerlerinin mutluluğundan ve iyi talihinden duyulan sevinç Ücret gelir. Çevrenizde yaşayan tüm kişilere sevgi göndermek, onun koşulda iyi olmalarını dilemektir. Buda ile kahve kitabında da dünya ile aranızdaki uyumla bahsedilir. Mudita'nın anlamını öğrendikten sonra biz de içimizin özgürlük ve sevgi ile dolmasını temip ediyoruz, Ceylan Mutcalı'nın hikayesine geçiyoruz. Ceylan Mutcalı …

Devamını Oku »

Rihanna Saç Modelleri | Saçlarım ve Ben

Rihanna'ya tarzıyla şaşırtmayı başaran ünlüler arasında. Bazen gözümüzü alamıyorlar bazen de yapmak Rihanna demeden edemiyoruz. Bu galerimizde onun telden Rihanna saç modeli mevcut. 🙂 Kimi modellere bayılacak, kimilerini ise bile istemeyeceksiniz. Sürekli değiştirdiği modellerin tek ortak noktası; Hepsinin cesaret olmasını istiyor! 🙂

Devamını Oku »

Verona'da Nerede Kalınır? Otel Tavsiyeleri Otel ihtiyaçları ve rezervasyon yaptırmak için ]

Veneto bölgesinin Venedik 'ten sonra en çok Ziyaretçi çeken şehri Verona . Shakespeare'in Verona ve Juliet 'in ünlü şehri Verona esere de yakışacak şekilde romantik bir şehir. Milano ya da Venedik 'e gelmişseniz kesinlikle arada es geçmemeniz bir şehir. Kendi içinde İtalya Eğer Bologna İtalya 'in diğer ilçelerinde daha küçük, sakin ve büyük şehirlerin koşuşturmacası yoksa hollywood bir başka yerde …

Devamını Oku »

Küllü Kumral Saç Rengi | Saçlarım ve Ben

Küllü kumral, kadınlar arasında en çok tercih edilen renklerden biri. Özellikle açık ve buğday tenli kadınlar rahatlıkla küllü kumral tonlarına boyatabilir saçlarını. Esmerlerde ise küllü kumral saç rengi tercih edilecekse saç uçlarıyla doğru açılan kumral tonlar uygulanır. Küllü kumral çok beğenilen renklerden bir de olsa yine de, boyut yakışıp yakışmayacağını ufak bir testle anlayabilirsiniz. Saçını boyatmayı düşünen herkesin öncesinde bu …

Devamını Oku »

Bu yanlışlar saçları üzüyor! | Saçlarım ve Ben

Hacimli, parlak görünen, sağlıklı saçlar herkesin hayali. Bir formül var. Bir formül var. Saçla ilgili ürünlerini ayrı ve vazgeçilmez bir hale getirmek için iddiaları vardır. Bir başkasının saçlarından muhteşem görünmesini etkinleştirmek formüller sizin saçlarınızda aynı etkiyi yaratmayabiliyor. Farklı saç yapılarının ihtiyaçlarını ve uygulanan bakımların verdiği sonuçlar farklılık gösteriyor. Bütün bunlar yanında bir de herkesin doğru bilip. Neymiş o yanlışlar birlikte …

Devamını Oku »

Ünlülerin Örgü Saç Modelleri | Saçlarım ve Ben

Türk filmlerinin masum kızları, erkek kıyafetlerini, iş kıyafetlerinin, spor kombinlerin, özel davet ve günlerin çoğunda gelinliklerin şık bir tamamlayıcısı rolünde. Günlük olarak daha çok salaş örgüler, davetlerde örgü taçlar ve topuzlar tercih ediliyor. Hem doğal, hem şık örgü saç modelleri kolay kullanım olan hem de bir model. Örgü, uyguladığınız günlerde saçlarınızın daha çevreci faktörlere daha az maruz kalıyor ve kiretime …

Devamını Oku »

Okul Saç Modelleri | Saçlarım ve Ben

Kalıp gibi yapılı saçlar yerine salaş toplanmış, rahat ve pratik modeli günümüzde artık saç modeli için ayrılan süre kısaldı. Sabah okula yetişme telaşı ile hazırlanırken en çok zaman ayırdığınız başlık saç yapımı mı? Eğer bir okul atölyesi için yazımıza bir göz atın. Boyut zamandan kazandıracak ve bakımlı görünür sağlayacak seçenekler tabi ki var. Okul için saç modeli biraz uygulanan modeller …

Devamını Oku »

Yarı Toplu Bohem Örgü Modeli ve Yapılışı

Saç modelleri, kombininizi taçlandıran mücevher gibidir! Farklı saç stilleriyle kombinlerinizi taçlandırabilir, stilinizi güçlendirebilirsiniz. Saç modelleri ve yapılışlarıyla beraber en yeteneksiz olanlarımız da güzelleştirmek modelleri saçlarında rahatlıkla uygulayabilir. Yani artık, saç modeli uygulamasıyla ehli olmamıza gerek yok. Gerçekten çok güzel, doğal saç modelleri çok revaçta. Yarı toplu bohem örgü modeli de bunlardan biri ve Instagram saçları arasında popüler bir model. Kesin …

Devamını Oku »

Ve Uber'in CEO'su istifa etti

    Uber'de Şubat ayında medyaya yansıyan cinsel taciz iddiaları sonunda şirketin kurucusu ve CEO'su, Travis Kalanick'in başını yedi. Bir hafta önce ya da daha fazla sürecek "zorunlu izine" çıkartılan Kalanick bugün istifa etti. Önceden haberimizde bu zorunlu iznin aslında Kalanick'in CEO görevinden alınmasıyla sonuçlanacağının altını çizmiştik. Yeni gelen haberlere göre, izne ayrılan Kalanick, Uber'de yoğun baskısı nedeniyle istifasını sunarak CEO …

Devamını Oku »

Warcraft 3 ve Diablo 2 yeniden buluş!

StarCraft'ın yeniden hazırlanıp bu yaz tekrar satışa sunulacağının duyurusunu Geçtiğimiz aylarda yapan Blizzard firması, Oldukca sevilen ziyaretinde kült haline gelen on iki oyunu Warcraft 3 ve Diablo 2 'yi de yeniden hazırlama kararı aldı. Yeniden yapımlar ne zaman gelecek? Öncelikle Bu Konuda HERHANGİ Bir açıklama bulunmadığını belirtelim Çünkü Ortaya çıkan bu haber direkt Olarak Blizzard'ın resmi internet sitesinden duyurduğu Bir …

Devamını Oku »

Nicelik ve determinant …

Eğri altındaki alanın hesaplanması Her bir bölüm için, eğri altındaki alanın hesaplanması, farklı log viral yoğunluklarının bir zaman konsantrasyon eğrisinin Bölüm dökülme süresi ( ). Örnekleme aralıklarından kaynaklanan belirsizliği hesaba katarak, hesaplamaların aşağıda tanımlandığı minimum, orta ve maksimum AUC'yi tahmin eden üç senaryo araştırıldı; . Her senaryo için iki örnek açıklanmıştır: Birincisi bir pozitif gözlem ile ikincisi üç pozitif gözlem …

Devamını Oku »

Mezuniyet Saçı Modelleri 2016 | Saçlarım ve Ben

Dikkat etmeniz gereken şey yüze şekillendiren saçınızı tasarlatmak olmalı. Mesela yuvarlak yüz tipi ne saç modelleri tepeden toplanmış olup, yüz yüzeyi daha ince ve uzun görünür. Yüzünüz uzunsa, kaküllü saç modellerini düşünmelisiniz. Saçınızın arkasında bombe uygulatarak yüzünüzün orantısını dengeleyecek modeller tercih etmelisiniz. Saç modelleri, uzun menekşeler için uygundur, yüzün daha dengeli görünmesini sağlar. Mezuniyet balonuzda kaçınmanız gereken modelleyici ise abartılı …

Devamını Oku »

Apple ve IKEA AR uygulaması geliştiriyor

Apple, 5 Haziran'daki geliştirici konferansında iOS 11 ile birlikte AR konusuna ağırlık vereceğini duyurmuştu. Konferanstan sonra geliştiricilere sunul ARKit ile AR uygulama geliştirme süreci de başlamış oldu. Apple'ın bu konuda ilk katkısı şirket IKEA oldu. Apple ile IKEA AR uygulaması geliştiriyorlar! Apple ve IKEA, müşterilerin evliliklerinde nasıl görüneceğine bakmalarını sağlayacak bir AR uygulaması üzerinde işbirliği yapıyorlar. Bir İKEA temsilcisi, Apple …

Devamını Oku »

Saç Boyası Numaraları ve Açıklamaları

Saç boyası satın alırken, kutuadaki o muhteşem renklere aldanmamak gerekir. Kutudaki renâdanı aldanıp boyatılan saçlardaki hayal kırıklığına neden olur. Boyattığınız saçlarınızın istediğiniz renkle aynısı aynı düşününce ziyade boya numaralarına göre tercih yapmalısınız. Peki, ne numaralı işe yarıyor, numarasını söylüyor mu? 1. Rakam: Ana Renk Ana renk boyaların sürümü ilk numaradır. Bu numara boyanın açıklık ve koyuluk derecelerini gösterir. Boya numaralarının …

Devamını Oku »

Ocean Blast 2.7.0 Android Para ve Can Hile MOD APK indir

Ocean Blast 2.7.0 Android Para ve Can Hile MOD APK indir Okyanus Patlaması 2.7.0 Android Para ve Can Hile MOD APK indir Okyanus Patlaması-Android-resim "width =" 300 "height =" 300 "/> Oyunu bir dezavantajı deniz hayvanlarını ve simgeleri yerleştirmiş olacaklar Siz onu seviyede boyutlandırmışsın hamleler bitmeden o simgeleri toplamayı çalışacaksınız. Hamleler bittiğinde istenilen kadar toplamamış olursanız seviye geçemezsiniz. Sizde bu …

Devamını Oku »

Ombre Balyaj Teknikleri | Saçlarım ve Ben

Ombre balyaj nasıl uygulanıra geçmeden önce ombre balyaj nedir sorusunu cevaplayalım. Victoria Secret mankenleriyle tanıştığımız ombrelerin hayatımıza girdiği tarih 2000'li yılların başlarına denk geliyor. Güneş açılış gibi görünmesindir. Doğal saç rengine sahip bir kişinin saçı toplamı bir halde koca bir yazı geçirdiğini düşünün. Yaz sonunda güneş ve tuzlu suyun saç uçlarını açtığını görürürüz. Bu saç kurdeleyi, saç uçlarını ışıltı katarını. …

Devamını Oku »

Dünyadaki 10 Film Temalı Otel Otel tarafından inceleme ve rezervasyon yaptırmak için

Sinemanın endüstriyelleşmesiyle birlikte filmi kahramanlarının oyuncakları ve eşyalarının satılması bir yana, artık film Temalı otel odaları da yapılmaya başlandı. Film temalı otel odalarıyla birlikte; Insanların hayran sahipleri film karakterlerinin hayatını daha da yakından tecrübe etlerini amaçlanıyor. Ya da insanlar filmi izlerken kendilerinin yerine koydukları karakter gibi hissetmek için bu özenerek yapılmış otel odalarında istedi. Öyleyse okuma bakalım, otel odalarının içlerinde …

Devamını Oku »

Örgü Saç Modelleri | Saçlarım ve Ben

2015'de bohem trendin etkisinde kaldığınızda örgü saç modelleri yükselişine devam ediyor. Saç örmek yetenek işi gibi görünse de birkaç denemede eliniz hemen alış ve bir sonraki saç örgüsü modeliniz her öngörünüz daha güzel olmaya başlıyor. Ördüğünüz uzun saçlarınıza onu şekli verecek. İster saç diplerinizden önce başlayın, isterseniz de bir bölümünü örerek saçınızı toplayın. Artık özel davetlerde çok daha fazla kullanılıyor …

Devamını Oku »

Yaz Saç Renklerinde Uzun Saç İçin 10 Katmanlı Saç Stili ve Kesim Kafası

katmanlı saç modelini icat edenler mutlak bir deha idi! Saçlarınız kalın ve kontrol edilemiyorsa, inceltme katmanları güzel, doğal bir şekil oluşturur ve saçınızın güzelliğini ortaya çıkarır. Ve eğer saç ince ve kolayca tartılırsa, iyi yerleştirilmiş birkaç katman kiloyu kaldırır, böylece ipeksi trisepsleri yumuşatır ve hacimlendirir! Bugünün trend saçan, uzun saçlar için katmanlı kesim en iyi ince, orta veya kalın saç …

Devamını Oku »

Bere ve mükemmel duran saç modelleri

Soğuk havalarda kendine gelin başlangıç ​​gününde saçlarımızı da soğtan koruma zamanı geldi. Kışın kullandıkları saç ve şapkalar saç modelleri de çeşitleniyor. Bereyle mükemmel duran saç modelleri ile kışa dair fikir edinebilirsiniz. Kış saç modelleri bere ve şapkalarla uygulama kolay bir hale bürünüyor. Saçılar yıkayamadığınız veya bunlara neden olabilir.

Devamını Oku »

Şeyma Korkmaz ve sevgilisi Cüneyt Mete tatilde

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir reklam. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın doğru olduğu ve önereceğiniz bilgiler. Açıklamaları okumaya devam ediniz: Eğer siz de bu konuda reklam yayınlamayı düşünürseniz Öncelikle 2 …

Devamını Oku »

Koleston Saç Boyası Renkleri | Saçlarım ve Ben

Pek çok kadın saç boyama işlemini evde gerçekleştiriyor. Saç boyatan herkesin mutlaka bilmesi gereken şey ise boya kutusu üzerindeki mankenlerin saç renginin aldatıcı olabileceğidir. İstediğiniz saç rengini yakalayabilmeniz için saç numaralarının dilinden anlamanız gerekir. bu yazımıza göz atabilirsiniz. Yazımıza göz atabilirsiniz. Krem boya kataloğundaki Koleston saç renklerinde daha çok kızıl tonlar var, saç rengi yoğunluğunun da 8 hafta gibi bir …

Devamını Oku »

Ünlü sunucu ve anları anlattı: Yaklaştır tutup …

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

29 Ekim Cumhuriyet Bayramı Günün Anlam ve Önemi Konuşma Metni

  29 Ekim Konuşma Metni Milli günlerimiz bizet millet olma bilincini arttıran, aynı zamanda civarı birleşmemizi sağlar değerli günlerdir. Bugün bir 29 Ekim günü Cumhuriyetimizin ………. Yıl dönümünde bir aradayız. Cumhuriyet bu milletin ruhuna öz benliğine en uygun yönetim biçimi. Türk milleti Orta Asya'dan Anadolu'ya taşıdığı kültürünü, yaşam biçimi, yerleşik kültürle zenginleşirken kendi özgürlüğe düşkün karakterini hiçbir zaman kaybetmemiştir. 20. …

Devamını Oku »

Abdest ve Namaz Öğreniyorum – 2

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

Abdest ve Namaz Öğreniyorum – 1

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

Abdest ve Namaz Öğreniyorum – 3

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

2016 İlkbahar Saç Modelleri | Saçlarım ve Ben

Markalar defalarca koleksiyonlarını tanıtırken, gelecek sezon model modelleri ve makyaj trendleriyle ilgili ipuçları veriyor. Marc Jacobs'un 2016 yılı ilkbahar koleksiyonlarını sunduğu defilesinde geçen süre trend saç modellerinin özeti; Islak ve dağınık. Dağınık formda toplanmış, alına düşen saç tutamları göze çarpan Ayrıntılar arasında. Saç aksesuarları bu dağınık stilin önemli tamamlayıcıları. Göz pınarlarında yoğun olarak mavi farlar uygulanmış. Kirpikleri birbirine yapıştıran, suda …

Devamını Oku »

Damat Saç Modelleri | Saçlarım ve Ben

Tüm gelinler en mükemmel gelin modelleri için aylar öncesinden hazırlığa başlar. Model belirlemek, prova uygulamaları, duvak ve birlikte denemeler derken uzun süre gündemde gelin saçı olur. Peki ya damatlar … Gelinlik ve Gelin Saçı Her zaman yanında konuşulan konular için de geçerlidir. Büyük güne hazırlanırken en iyi görünümü elde etmek için damatlar da zaman harcar. Öncelikle her zaman geçmeyin, saç …

Devamını Oku »

Glisolilasyon ve Lipidler …

Membran Proteinler ve reseptörler Örneğin, dahil olmak üzere çeşitli hücresel işlevleri yönetmek Hücresel tanımada ve hücresel ile bağlantılı sinyaller üretirken iletişim. Bu moleküllerin membranlara bağlanmış olması Ve hücresel arayüzlerde etkileşimde bulunmanın bazı önemli sonuçları vardır. 1 Bunların başında zar tethering Reseptörlerin birbirleriyle karşılaşma yetilerini sınırlar ve bu Karşı yüzeylerin yeterince yakınına gelmesini gerektirir Yanal difüzyonla yönlendirilen bağlanma partnerlerinin angajmanına izin …

Devamını Oku »

Bob Saç Kesimi Modelleri | Saçlarım ve Ben

Uzun zamandır kendinde bir şey yapmayanlar ve bu tekdüzelikten dolayı sıkılmış olanlar için kuaföre gitme zamanı gelmemiş demektir. Son günlerde epey sözü edilen ve dünya yıldızları tarafından da seçilmiş bob saç kesimi de değiştirmeniz için alternatiflerden birisi olabilir. Bob saç modeli hem düz hem de kıvırcık saçlarda rahatça uygulanabilir. Bob saç kesimi küt saç modellerinden farklı olarak, arkalardan bombeli ve …

Devamını Oku »

Hazal Kaya ve Burak Deniz'den sürpriz buluşma

                     2017-06-17 10:59:00                                                                      Shameless uyarlaması dizi için, Hazal Kaya ve Burak Deniz ilk kez bir araya geldi. Fox'un merakla beklenen dizinin başrol oyuncuları Hazal Kaya ve Burak Deniz, ilk kez bir araya geldi. Yeni yayın döneminde Fox'ta yayınlanması planlanan, yapımcılığını Med Yapım'ın üstlendiği 'Shameless' uyarlaması yeni başlıyorum belli oldu. Hazal Kaya ve Burak Deniz ilk kez …

Devamını Oku »

Zayıf Gösteren Saç Modelleri | Saçlarım ve Ben

Saç stilinizle oluyor daha zayıf görünebiliyor biliyor muydunuz? Ayrıca çok sayıda alternatiftir '' işte bu '' dedi, boyut ve çoklu yakışacak modeli seç şansınız var. Kesim, boya ya da kolay uygulanabilen saç modelleriyle yüzünüzü daha ince gösterebilir mümkün. Bu hileli saç modellerine göre gelin birlikte göz atalım. Topuz modelleri oldukça şık durmaz karşın, tercih edilecek topuzun yüz şekline uygun olması …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Abiye Saç Modelleri | Saçlarım ve Ben

En özel günlerin hazırlıkları hem çok keyiflidir hem de biraz meşakkatli. Onlarca yumuşatılmış sebzelerle tatlı bir yorgunluğa neden olur. Mutlaka herkese özel eşyalar ve tırnağa kusursuz görünmek için çabalar. Kıyafet, ayakkabı ve çanta bu serüvenin başrol oyuncuları gibi görünse de, doğru saç ve makyajla tamamlanmadıklarında sönük kalırlar. Nişan, söz, mezuniyet gibi özel günlerde tercih edilen abiye saç modelleri arasında seçim …

Devamını Oku »

Samsung Galaxy A3 ve A5 akıllı telefonlar LetsGoMobile

S Samsung Galaxy A3 ve A5 Android cep telefonları Samsung Electronics iki yeni akıllı telefon modelini duyurdu. Yeni Samsung Galaxy A5 ve Galaxy A3 Android cep telefon modellerinin her ikisi de yeni tarz tasarım çizgileri ve sosyal ağlar destekleyen gelişmiş işlevleri ile dikkat çekiyor. Galaxy A3 ve A5 metal metallerin gövdeleri ile sırasıyla 6,7mm ve 6,9mm incelikteler için en yeni …

Devamını Oku »

Oruç ve Ramazan ile ilgili Hadis ve Ayetler

Ayet-i Kärn Ramazan ayı, okula giden yol gösterici, doğrulan ve doğruyu eğriden ayırmanın açık delilleri olarak Kur'an'ın indirildiği aydır. Öyle ki sizden ramazan ayını idrak edenler onda oruç tutsun. Başka bir günlerde kaza etsin. Allah senin için kolaylık ister, zorluk istemez. Bütün bunlar, sayıyı tamamlamanız ve doğru yolu göstermesine karşılık, Allah'ı tazim etmeniz, şükretmeniz içindir. (Bakara Suresi 185) Ey iman …

Devamını Oku »

Ramazan Ayı ve Önemi Hakkında Bilgi

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Balık Sırtı Örgü Modelleri ve Yapılışı

Defilelerde çok daha sık görmeye başladığımız örgü modelleri, romantik ama daha sofistike görünümden hoşlananların vazgeçilmezi. Neredeyse onun tarza uyumuş bir havası var. Gündüz işe giderken ördüğünüz saçınızla akşam özel bir yemeğe katılabilirsiniz. Saç örgüsü modeller. Saç örgüsü modeller. Balık sırtı modelleri, saç örgüsü modelleri arasında en kolay uygulanan. Örme tekniğini öğrendikten sonra, saç örgüsü modellerinin boyutunu yakışan stili belirleyip uygulayabilirsiniz. …

Devamını Oku »

Yeni Trend: Konfeti Saçlar | Saçlarım ve Ben

Londra moda haftasında modeller, göz kapaklarında ve saçlarında konfetilerle piste geldiler. Yoğunlukla saç diplerine ve daha seyrek olarak saç uçlarına serpiştirilen konfetilerle saçlar çılgın bir şekilde ışıl ışıl görünüyor. Bu yeni saç trendini benimsemek için bir miktar delirmek şart gibi. Podyumlardan günlük hayatımıza kendine yer edinmeyecekse, bu yeni akım pist dünyasından partilere sıçrayacak gibi duruyor. Festival ve partilerde, hazır yılbaşı …

Devamını Oku »

Kalem ve kalemtras sanatı ….

                                         184 Takipçi | 0 Takip                        Kategorilerim                                                                       Diğer İçeriklerim (9340)                                        Tüm içeriklerim                       Takipçilerim (184)                                                              2017-06-16 17:53:00                                                                                                        2                      0                      0                                                                                                                                                                                         …

Devamını Oku »

Samsung Galaxy J7 ve Galaxy J7 Pro LetsGoMobile

G Alaxy J-Serisi ve çok satan Galaxy J serisi 2017 model orta seviye cep telefonları serisin genişleten Samsung, Android işletim sistemli iki yeni modeli Galaxy J7 Pro ve Galaxy J7 Max'in akıllı telefonlarıyla resmedi duyurdu. Galaxy J Serisi Hindistan'da en çok beğenilen akıllı telefonlar. Yeni modellerde yeni sosyal kamera ve Samsung Pay uygulaması beraber geliyor. Samsung'un tüketicilerin çok yönlü yaşam …

Devamını Oku »

Lerzan Mutlu ve Seren Serengil'in Instagram kavgas …

                     2017-06-15 22:22:00                                                                      Kanal D ekranlarında yayınlanacak Magazin D Yaz programının sunucusu Özge Ulusoy oldu. Programın yapımcısı olan Timuçin Güner de bu haberi Instagram hesabından verdi. Seren Serengil ve Lerzan Mutlu bu kadarını paylaşımın altında kavga etti. Paylaşımın altına "Hah teorisi kaliteli kadınlar yakışır Kanal D'ye neydi o Flash Tv kafası 'diyerek Lerzan Mutlu'ya gönderildi Seren …

Devamını Oku »

LG G7 ve V30 çıkış tarihleri ​​sızdırıldı!

LG ' nin yeni amiral gemileri hakkında yeni bilgiler gelmeye devam ediyor. Öncelikdeki yılavalış için V30 ve LG G7 ile ilgili önemli bir iddia ortaya atıldı. LG G7 ve V30 çıkış tarihleri ​​sızdırıldı! Güney Kore'nin yeni amiral gemilerini ne zaman piyasaya süreceği sızdırıldı. LG yetkililerinin planına göre yeni amiral gemileri beklediğimizden daha kısa sürede karşımıza çıkabilir. G7 ve V30 için …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Saç Renkleri Ve İsimleri

Saçların renkleri kataloğu ve isimleri özellikle kuaförlerde çok büyük kolaylık sağlamaktadır. Saç rengi değişeceğinden saç boyası renkleri ve isimleri ile ilgili ön bilgi alınması sonrasında boya işlemi yaptırırken kolaylık sağlayacaktır. Saç boya renkleri ve isimleri onun markada değişkenlik cümle renk seçenekleri aynı olmaktadır. Siyah, kahverengi, kızıl ve sarı olan diğer renkler ile karıştırılacak kullanabilmektedir. Açık tenli kişilerin sıkça beğenildi sarı …

Devamını Oku »

30+ En Popüler ve Seksi Kısa Saç Fikirleri | Kısa Saç Stilleri 2016 – 2017

Kısa saç stilleri çok modern ve seksi olabilir, böylece uygun bir kısa saç kesimi ile gerçekten şık görünürsünüz. Yeni kısa saç kesimi 'u benimsemek için saçınızı kesmek isterseniz aşağıdaki galeriden biraz ilham alabilirsiniz: 1. Popüler Kısa Seksi Saçlar Kadınlar için en seksi görünümlerden biri, aşağıdaki gibi doğal yumuşak kıvrımlarla gri bob saç kesimi yapıyor: Kaynak 2. Kısa Seksi Saçlar Karanlık …

Devamını Oku »

Motorola Moto E4 ve Moto E4 Plus tanıtıldı LetsGoMobile

M Otorola Moto E4 ve Moto E4 Plus akıllı telefonlar tanıtıldı – Motorola ekonomik model serisinden iki yeni akıllı telefon Moto E4 ve Moto E4 Plus'ı resmen tanıttı. Moto E4 modeli 5 inç ekran ve Moto E4 Plus cep telefonu da 5.5 inç büyüklüğündeki ekrana sahipler. Motorola Moto E4 Moto E4 akıllı telefon Snapdragon 425 veya 427 işlemci seçeneklerine birlikte …

Devamını Oku »