25 Haziran 2017,Pazar
Anasayfa » Tag Archives: uzun

Tag Archives: uzun


[19459013 <! – ->                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        BURDAN BUYUR                                                                                                                 BENİDE GÖR                                                                                ->                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    Kaynak

Devamını Oku »

En Güzel Uzun Saç Modelleri

Kadınların saçlarını birleştiği noktalardan biri de saç uzatmadır. Gerçekten saçıcı kestirmeyi kafasına koyup, kısacık saçlarıyla mutlu olan, hatta bir daha saçlı vazgeçmeyenler konumuuz tabii. KEŞKE kestirmeseydimler. KEŞKE kestirmeseydimler. KEŞKE kestirmeseydimler. İş işten geçtik, bir anda gündem hızlı saç uzatma yöntemleri olarak değişir. O dönemin popülerleri. Mesela şimdinin en popüler saç uzatma yöntemleri arasında çam terebentin var. Uzun saçlı zaafı olan …

Devamını Oku »

Yaz Saç Renklerinde Uzun Saç İçin 10 Katmanlı Saç Stili ve Kesim Kafası

katmanlı saç modelini icat edenler mutlak bir deha idi! Saçlarınız kalın ve kontrol edilemiyorsa, inceltme katmanları güzel, doğal bir şekil oluşturur ve saçınızın güzelliğini ortaya çıkarır. Ve eğer saç ince ve kolayca tartılırsa, iyi yerleştirilmiş birkaç katman kiloyu kaldırır, böylece ipeksi trisepsleri yumuşatır ve hacimlendirir! Bugünün trend saçan, uzun saçlar için katmanlı kesim en iyi ince, orta veya kalın saç …

Devamını Oku »

Uzun Saçlar İçin Muhteşem Saç Stilleri

Dönemin saç boyu trendi, uzun saçlarından asla vazgeçmeyecekler için yeni sezonun trendlerini araştırdık. Upuzun saçlarınız, saç modeli konusunda da şanslı olmanızı sağlar; Istediğiniz modeli uygulayabilirsiniz. Ama bir de günün ortasında çıkanları var değiştirebilir ve yenileniyor. Mesela dağınık topuzlar! Saç modellerinden bir once. Şimdiyse fantastik modeline göre değişti modeller yerini bıraktı. Kuyruğu modelleyici olarak, diğer model modellerine göre farklı modeller de …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

2016 Yılının Uzun Saç Modelleri

Uzun saçlı kesimle kolaylıkla alan alan, ufak dokunuşlarla bambaşka modeller yaratılan, basit modelin safra havalı durduğu, pek çok kadın için saçların en güzel hali, bazıları içinse özlemle beklenendir. 🙂 Kontrolü kolay bakımı biraz zor olan bu saç tipi için biz 2016 yılının uzun saç trendlerini araştırdık. 1- Koyu saç dipleri "bakımsızlığı" çağrıştırmıyor artık. Özgür bir yıldız yakalamak için saç diplerinizi …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Sağlam uzun okunan yerli DNA se …

Wellcome Open Res. Yazarın el yazması; PMCID: PMC5426553 EMSID: EMS72771 Sorumlu yazar Katkıda bulunan: SH, çalışma geliştirdi ve nanopore sıralama deneylerini tasarladı ve uyguladı. JMC, verilerin bilgisayar analizini tasarladı ve gerçekleştirdi. SH ve JMC gazeteyi yazdı. Rekabet Hakları: Rekabet konusu olmayan herhangi bir çıkar bildirilmedi. Bu, sınırsız kullanım, dağıtımın yapılmasına izin veren Creative Commons Atıf Lisansının koşulları altında dağıtılan açık …

Devamını Oku »

Casper VIA F1: Uzun Kullanım Testi

Casper VIA F1 Uzun Kullanım Testi ile karşınızdayız. Merakla beklediğiniz Casper VIA F1 UKT videosunda, bu telefonla yaşadığımız deneyimleri sizlere iletiyoruz. Iyi seyirler! Casper VIA F1 özellikleri Casper VIA F1, öncelikli olarak arka kısmındaki çift kamera ile dikkat çeken bir model. Telefonun arka kısmıında 13 Megapiksel ve 5 Megapiksel olmak üzere iki adet kamera yer alıyor. Bu kameralar alan derinlik …

Devamını Oku »

+100 Uzun Yüzlü Erkek Saç Modelleri ile Karizmanı Yeniden Keşfet

Uzun yüz saç modelleri erkek 2017: Yüz modelinde bazı modeller var. Var. Bazı erkek saç modelleri, uzun yüzlerde çok hoş dururken bazısı da hoş olmayan bir görüntü yaratabiliyor. Uzun yüze yani uzun bir kafaya sahip beylerin de yüzlerine uygun saç modeli seçmeleri önemli bir faktör. Kısa saçlarla daha iyi sağlandığını düşünorum. Dikdörtgen formundaki bu uzun yüz saç modelleri erkek lerin …

Devamını Oku »

Tam 256 yıl yaşayan adamın uzun yaşam sırrı!

                     2017-06-03 10:45:00                                                                      Öldüğünde 256 yaşındaydı … Zaman dergisine haber oldu oldu. Günümüzde insan ömrü 80 yıl bunu biliyor ancak Çinli dövüş sanatları ustası ve uzun yaşam araştırmacısı olarak nam salan Li Ching-Yuen'in hayatı bunun aksini iddia eder cinsten … İşte tam 256 yıl yaşadığı iddia edilen Yuen'in ilginç hayatı ve uzun yaşam sırrı. Çinli dövüş …

Devamını Oku »

Önü Uzun Arkası Kısa Saç Modeli

Kısa saç kullanımı en rahat saç modeli biridir ama onun yüzü tipine gitmez. Ilk önce kendin yüzünüzü iyi tanımalısın sonra yüzünüze gidecek saç modelini belirlemelisiniz. Bir döneme damgasını vurmuş olan Beckham modeli özellikle ince yüz yapılı kadınların tercih etmesi bir model. Dönem dönem ünlülerin çoğunlukla hoşnutsuzluk saç hiç bir zaman modası geçmez bir model. Önceden uzun arkası kısa saç modelleri …

Devamını Oku »

Arkası Kısa Önü Uzun Saç Modelleri

Profesyonel saç kesim alanlarına giren bazı modeller vardır. Özelleşmek ve farklı görünmek isteyen kişiler bu tarza ayak uydurmak yanı sıra, hiç bir zaman sona ermeyecek kombin currentını oluşturmak ve oluşturmak. arkası kısa önü uzun saç modelleri özel tarz sahibi olmak isteyenlerin lekeler arasındadır. Simetrik Kesimin Konuştuğu Saç Modeli İlk olarak önü uzun arkası kısa saç modelleri Hazal kaya Güneş ışığından …

Devamını Oku »

Uzun V Saç Kesim Modelleri

Katlı saç kesimlerinin çok sevileni uzun v saç kesim modelleridir. Katlı modellerin en katlısı elbette bu saç kesimidir. Saç ucuna kadar belirgin katlar bulunur. Bu saç kesimi iyi bir kuaför tarafından yaptırılırsa çok dikkat çekici bir model elde edilmiş olur. V kesim uzun saç modelleri saç tipine uygulandı. Uzun v kesim saç modelleri nin en çok yakıştığı saç şekli irdelenirse …

Devamını Oku »

Uzun Düz Saç Kesim Modelleri

Düz uzun saç kesim modelleri makyajla desteklenmediği sürece kişiiye masum bir hava verir. Düz saçın sadeliği bu havayı veren asıl şeydir. Uzun düz saç kesimleri ya da sadeliği destekleyecek şekilde ya da sadeliği bozacak şekilde tasarlanmış. Uzun saç kesim modelleri kahkül ve perçem en rahat kullanıldığı saç şeklidir. Saçın sadeliğinden sıkılan pek çok kişi saçı bu tür kesimler ile daha …

Devamını Oku »

Uzun Saç Modelleri Bayan

Son yılların popüler saç modelleri kısa saç modelleridir. Özellikle Bob, Lob ve Pixie'nin saç kesimi pek çok kadına uzun saç kesimlerini unutturmuştur. Ancak uzun saç modellerinin yeri ayrıdır. Asla uzun saçtan vazgeçmeyen veya ara ara uzun saçı özleyen kadınlar bulunur. Uzun saç bir kadının saçlarından tam olarak yararlanmasını sağlar. İstediği şekle sokabilir. Kendine istediği görüntüye verebilir. Bu nedenle çok kullanışlıdır. …

Devamını Oku »

Yanlar Kısa Üstler Uzun Saç Modeli

Son dönemin en popüler saç modeli olarak bilinen yıldızlar uzun saç modelinin modern adı Amerikan traşıdır. Yolda yanınızdan geçen iki tane erkekten birinde rastlayabileceğiniz bu saç modeli, pek çok erkeğin kendi tarzını bulmasını istiyorsanız saç modelidir. Son birkaç yıldır mevcut olan bu saç modeli, herkes tarafından kullanılacak başlanınca sıradanlaşmaya başlamıştır. Bunun önüne geçilebilmesi için birkaç değişiklikler yapılarak yeni modelleri öne …

Devamını Oku »

Lenovo VIBE P1 Uzun pil ömürlü telefon LetsGoMobile

L Enovo, tükenmeyen pil ömürlü VIBE P1 akıllı telefonunu tanıttı. Lenovo Berlin Tüketici Elektroniği Fuarı IFA'da, tanıttı yeni smartphone modelini tanıttı. 5.5 inç ekranlı VIBE P1 Lenovo'nun güç gösterisi yapan yeni modeli oldu. Lenovo VIBE P1 ve VIBE P1m 5000m AH kapasiteli devasa batarya ve güç tasarrufu özelliğiyle günümüz şarjı tükenmeyen rekortmen bir akıllı telefon. Lenovo VIBE P1 Hazırlanan ve …

Devamını Oku »

Japon laboratuvarının 'değer bilincine sahip' SSD'leri daha uzun sürüyor …

                                  Japonya'nın Takeuchi Laboratuarı, görüntülerin rakiplerinden daha hızlı tanıdığı ve disklerin çalışma ömrünü de uzattığını söylediği "değer farkında" bir yarı iletken disk önerdi.                  Katı hal diskleri yaşlandıkça bozulur, çünkü silisyumun kendisi zarar görmeden ve daha çok hataya eğilimli hale gelmeden önce katılan yarıiletkenleri çok fazla sarsabilir. Sürücüler denetleyicileri bunu bilir ve bir hücrenin güvenilmez hale gelmeye başlayacağını bildiren …

Devamını Oku »

Yirmi binde / kenar boşluksuz resim Bizi nasıl kurtaracağımıza kalp kırıklığı. Herkesin bize aşık olabileceğini anlamayan olanlar. Güzelliğimizi, kusurlarımızı, derinliklerini ve kalanları görüyoruz. Yeniden hazır olmamızı bekleyen olanlar bize hak ettiğimiz sevgiyi, yoksun olduğumuz aşkı ve verebileceğimiz sevgiyi gösterebilirler. Ağlamamızda bile, başarısız olduğumuzda bile, kendimizden hoşlandığımız tek bir şeyi bulamayacağımız zaman bile güzel olduğumuzu söyleyen kişilere. Yavaş yavaş bizi tekrar inandıranlar; Hayatta, sevgide ve potansiyelimizde. Bilmeden bizi sadece bizi dinleyip dinleyerek ve orada hiçbir yere gitmemelerini sağlayarak rahatlatarak orada olmak suretiyle hayata döndürenler. Rüyalarımızı, görüşlerimizi ve planlarımızı değiştirmemize rağmen, hayatlarımızda anlam bulmak için uğraştığımızda bile kendimizi anlamadığımızda bile bizi anlamaya çalışanlara. Herkes uzaklaştığında yanımızda olanlara. Bizi mutlu ve eğlenceli olmayı beklemeyenler, acı çekmemiz veya acı çekmememiz için bizi suçlamayanlar. Aşkın gerçekte ne olduğunu bize gösterecek kişilere. Çubuğu çok yüksek kılan, metinlerimize zamanında cevap veren ve konuşmayı sürdüren olanlar, meşgulken bile bizi görmeye çalışan olanlar, gerçekten sordukları için derin sorular soran olanlar Bizi tanımaya ilgi duyuyoruz, mazeret bulamayan ya da bir şeyler ters gittiğinde çok kolay vazgeçenlere ve bizi gerçekten isteyenler bizimle olmak için ne gerekiyorsa yapacaklarını hatırlatanlara Sonsuza dek kalamayacakları halde, sevilmeyi hak ettiğimizi ve fazla talep etmediğimizi anlamamız için [19459109] iyileştirmek için bizim için yeterince uzun kalmış olanlara. Kalplerimizi kıranların bize karşı doğru olmadığını, bize saygı duymadığını, bizi takdir etmediklerini ve bize nasıl davranacaklarını bilmediklerini göstermek için hayatımıza girenler. Sana gerçekten ihtiyaç duyduğumuz zaman geldiğiniz için teşekkür ederiz. Sevgiye layık olduğumuzu ve istediğimizden daha büyük bir sevgiyi gösterdiğiniz için teşekkürler. Bize umut verdiğiniz için teşekkür ederiz. İnancımızı yenilediğiniz için teşekkür ederiz. Korkusuz olduklarından ve diğerlerinin korktuğu her şeye çok teşekkür ederim. Bize yarı sevgi ya da neredeyse ilişkiler ya da mazeretler ya da maybes için yerleşmemenizi hatırlattığınız için teşekkür ederiz. Bize öncelik verilebileceğimizi göstermiş olduğunuz için teşekkür ederiz. Bizi sevenlerin hep bizi ilk tercihte bulunduklarını hatırlattığı için teşekkür ederim. Bizi gülümsettiğiniz için teşekkür ederiz. Bizi güldürdüğün için teşekkürler.

Devamını Oku »

Uzun Mesafeli Elektrikli Araba Şarj Problemleri Plug-In Hybrids'leri Artıracaktır

Elektrikli otomobil devriminin istenmeyen sonuçlarından biri, danışmanlık hizmeti Frost'a göre, şarj yapısı bastığından, uzun mesafeli yolculuk sürelerinde acı verici bir katlanma veya üç kat artma olacaktır & Sullivan. Bu aynı zamanda, plug-in hibritleri için mükemmel bir geleceğin olacağı anlamına gelecektir. Kaynak

Devamını Oku »

Uzun Bob Kesim

Bob saç kesimi ortaya çıktığı ilk günden beri çok çok kadının kendi tarzını bulabilmesini sağlamış bir saç kesimidir. Neredeyse tüm ünlü isimler en çok tercih edilen ve modanın kalbine oturmuş bir saç kesimidir. Ancak bu kadar güzel olmanız yanında cesur sayıldığı için çok çok kadının da geride durduğu neden olmuştur. Saç kesiminden daha fazla kullanışlı uzun okula Bob saç kesimi …

Devamını Oku »

Toplumsal bağlar hayvanlara daha uzun yaşama yardımcı olur

                                                                                                          Rhesus makak bir anne (sağda) yetişkin kızı (solda) ve yavrularıyla. Kredi: Lauren Brent      Büyük aileler ve güçlü sosyal bağlar hayvanların daha uzun yaşatılmasına yardım ediyor, yeni araştırmalara göre.                                                                                 Kadın rhesus makakların büyük bir çalışmasında, Exeter Üniversitesi'nden bir bilim adamı, yakın akraba yakınlarının ortalama ömrünün daha iyi olduğunu tespit etti. Bununla …

Devamını Oku »

Uzun vadeli 2017 Genesis G90 incelemesi ve test sürüş güncellemesi

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Hyundai'nin M.O. – Bina gaz yudumluyor, uygun fiyatlı otomobiller – 30 yıl boyunca iyi hizmet etti – birkaç yıl. Genesis alt markasını başlatmak, yine de Cadillac, Lexus ve Infiniti gibi markalara karşı kusursuzca balık yiyen bir su ısıtıcısı. Almanlar da. Ve bilmek istediğimiz de buydu: Genesis, üst seviye …

Devamını Oku »

Uzun Erkek Saç Modelleri

Kadınlar uzun saçlı olur, erkekler kısa saçlı olur algısı yıkılmaya başlanalı bir süre olmuş. Bu süre içerinde, uzun saçlı erkeklerin sayısı her biri bir tane artmıştır. Bu sanatma üniversite yıllarına tekabül eder. Bunun nedeni ve ilkokulda saça karışılıyor olmasıdır. Saçlarını uzatmak istiyor ve uzatan erkeklere büyük bir deneyime sahip olmadıkları için bu konuda zorlukler. Ancak tek gerekli şeyleri yapmak. Erkek …

Devamını Oku »

Amerika'da En Uzun Süren 10 Vasıta »AutoGuide.com News

Yakın tarihli bir araştırmaya göre, uzun süren bir araç istiyorsanız, SUV'ler yola çıkıyor. Otomotiv araştırma şirketi iSeeCars.com, yolcu üzerinde kilometre otomobile 200.000'den fazla kilometre kazandıran yolcuların sayısını öğrenmek için 13 milyonun üzerinde otomobilini analiz ettiler. Ortalama model, 200.000 milin üzerinde yolda 1.3 oranında otomobil sahibi iken, ilk 10'daki her araç en az% 2.3 oranında bu üstün ömrüyle sahip. Şunlara bakın: …

Devamını Oku »

Uzun Saç Kesimi

Uzun saçlı bazı insanların asla terk edemediği bir saç kesimidir. Herkes kendilerindeki değişiklikler saçlarını kısaltarak yaparken uzun saçlı müptelası kişiler saçlarının çocuklarını çok değiştirerek kesimlerini değiştirerek değişiklik ihtiyaçlarını gidermiş ederlar. Uzun saça uygulanabilecek pek çok farklı saç kesimi. Bu saç kesimlerinin en iyi şekilde durabilmesi yüz hattınıza uygun bir saç kesimi seçebilmenize bağlıdır. Saç kesiminde etkili bir şey var saç …

Devamını Oku »

Erkek Saç Modelleri Yanlar Kısa Üstler Uzun

Etrafınıza baktığınızda özellikle gençlerde iki erkek birinin saçlarının yanları kısa üstlerinin uzun kesildiğini görürsünüz. Son birkaç yılın en popüler saç kesimi olan bu saç kesiminin ismi Amerikan saç kesimidir. Bu dünya çapında ünlüler dünyadaki diğer tüm dünya erkekleri arasında yayılmıştır. Bu saç modeli sayesinde birçok çok erkek kendi havalarını bulabilmişlerdir. Kendine bakmaya başlamadan çok erkeğin ilk başta olmak üzere saç …

Devamını Oku »

İngiltere, uzun zamandır beklenen hava kirliliği planını yayınladı

                                                                                                          Geçen yıl yapılan bir ankete göre, yılda 40.000 İngiliz ölümleri dış hava kirliliğine maruz kalma nedeniyledir      Kaynak

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Tropik ormanların uzun vadeli kaderi olamaz …

                                                                                                          Yeni bir CU Boulder çalışması, tropik ormanların şaşırtıcı bir şekilde daha sıcak ve daha sulu koşullarda büyümelerini hızlandırabileceğini gösteriyor – iyi haberler, çünkü bu koşullar altında atmosferden daha fazla CO2 alabilirler. Kredi: Colorado Üniversitesi      Kaynak

Devamını Oku »

Uzun pil ömürlü Asus akıllı telefon LetsGoMobile

A Sus ZenFone 3 Max akıllı telefon – 5.2 inç büyüklüğünde ekrana sahip Asus ZenFone 3 akıllı cep telefonu uzun pil ömrü sayesinde tüm günlerce kullana imkan veriyor. Yüksek kapasiteli 4100mAh yeni Asus ZenFone cep telefonu 30 güne varan bekleme süresi sunuyor. Günümüzde daha uzun konuşma, müzik dinleme ve video seyretme sürelerine ihtiyaç duyuyoruz. Asus ZenFone 3 Max'ın 4.100 mAh …

Devamını Oku »

Uzun vadeli 2016 Jeep Wrangler Rubicon ikinci çeyreği güncellemesi

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             "Yarım yıl geçti ve Wrangler hala burada bulunduğu gibi davranıyor," dedi bir editör. "Dişli kutusunun bulanık olduğu, direksiyonun sonunda değişen yöne dönüşeceği ve yolun sizi her yere fırlattığı anlamına geliyor. Yolun aşağısına inen büyük bir kutu, bu nedenle rüzgar sesi ve büfeyi önemli. Tüm bu pencerelerin olduğundan emin …

Devamını Oku »

En Uzun Saç Modelleri

Her saç dökümü modelleri revaçta olsa da, omuzlardan aşağı dökülen ya da bel hizasında en uzun saç modelleri de popüler durum. Uzun saçlara biçmek, kısa ya da orta boy saçlara şekil vermek daha zordur. Farklı yapıda bir kaç adet en uzun saç modeli ve yapılış aşamalarını boyutlarıyla birlikte incelemek istiyoruz. Ona ne kadar bakımlı ve hoşgörülmüş olsanızın zaman zamanını farklı …

Devamını Oku »

Uzun Saç Modelleri Erkek

Uzun saç bayanlarda olduğu gibi erkeklerde de son dönemlerde görülür. Kimi zaman saçlarının tamamında görülen uzunluk, kimi zamansa sadece saçın üst kısmında karşımıza çıkıyor. uzun erkek saç modelleri ve bu modellere örnekleri konumuuzun devamında bulabilirsiniz. Birinci okunmamış mesaja git Erkekler için uzun saç modelleri, son dönemlerde daha yaygın kullanılan modellerdir. Son dönemlerin en popüler erkek uzun saç modelleri genel açıklama …

Devamını Oku »

Uzun Saç Örgü Modelleri

Uzun ve sağlıklı saçlar, hemen herkese bayının hayalidir … Dümdüz ya da hafif dalgalarla hareketlendirilen uzun saçlar, kuyruğu, örgü, topuz, yarım toplu ya da yarım topuz saç modelleri birlikte birlikte kullanılamaz. uzun saç modelleri örgü çeşitlerini ve yapılışlarını açıklayacağız. Uzun saçlarla birlikte kullanılan örgüler, onun için güzel saç modelleri arasındadır. Tek başına bir başka model de uygulanamaz farklı tekniklerle örülen …

Devamını Oku »

Saçı uzun kadınlar için küt saç modelleri

Uzun küt saç modelleri saç modelleri kısa boylu kestirmeye yönelik bir model kadınlar için kurtarıcı bir model. Şimdi çok moda olan küt saçları herkes yapmak istiyor çünkü. Bu da onlara imkan sağlamış oluyor. Bu uzun küt saç modelleri herkesin tercih edebileceği bir model. Yüzü gidebilecek bir model. Tercih edilmesinin en büyük sebeplerinden birisi de bu diye düşünüyorum. Saç bunları rahatlaştırmak …

Devamını Oku »

Şanghay'daki Çinli Market BMW 5 Serisi Uzun Dingil Başlangıçları

Plug-in hibrid varyant mevcut olacak Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi …

Devamını Oku »

SAVI kamerası, uzak görüntüler için uzun mercekli hendekleri eğiyor

                                                                                                          Rice ve Northwestern üniversitelerinde geliştirilen SAVI prototipi ile 1 metrelik bir mesafeden alınan parmak izi görüntüsünün ayrıntıları. Üstte, orijinal görüntüyü yansıtacak şekilde bir lazerden çekilmiş birçok benek modelinden biri var. Altta, net bir baskı, parmak izinin birkaç farklı açıdan çekilen ve "sentetik diyafram" programı ile işlenmiş düzinelerce görüntü kombinasyonunun sonucudur. Kredi: Jason Holloway / …

Devamını Oku »

Çalışma, uzun süredir devam eden Fermi'yi bulmuyorum …

                                                                                                          Enrico Fermi tahtada. Kredi: Wiki Commons.      Fizikte, bazı doğrusal olmayan sistemlerin, enerjilerini dağıtmayan ancak başlangıçtaki heyecanlı durumlarına geri döndüklerini bulan Fermi-Makarna-Ulam-Tsingou (FPUT) sorunu bir meydan okuma olmuştur Bu bilim adamları 1955'ten beri defalarca uğraştılar.                                                                                 FPUT sorununun içindeki meydan okuma, bilim insanlarının, sistemin rahat bir duruma, muhtemelen dengeye erişmesini beklediği, bunun …

Devamını Oku »

Yerel topluluğa güven, daha uzun vadeli olmasını sağlar …

                                     Yoksulluk döngülerinden kaçmak, Princeton Üniversitesi liderliğindeki araştırmalara göre, bir kişinin yerel topluluklara güvenebileceğini düşündüğüne bağlı olabilir.                                                                                 National Academy of Sciences Bildiriler Kitabında yayınlanan çalışma, toplumlarına güvenen düşük gelirli kişilerin daha iyi uzun vadeli finansal kararlar verdiğini ortaya koyuyor. Büyük olasılıkla bunun nedeni, vatandaşların kendilerini daha fazla borçlu avans kredileri gibi çabuk düzeltmeler yerine, arkadaşları ve komşuları …

Devamını Oku »

Kıvanç Tatlıtuğ uzun artı sonrasında ilk kez fotoğ …

                     2017-04-13 17:31:00                                           Sosyal medya hesabını kullanma ve uzun zaman önce tüm fotoğrafları Kıvanç Tatlıtuğ, eşi Başak Dize'nin doğum günü için bu kuralını bozdu. Ancak fotoğrafını kapadı. Yaklaşık 3 ay önce, Başak Dizer'in Kıvanç Tatlıtuğ ile paylaşımına bir takipçisi Dizer hakkında 'çirkin' yorumunda bulunmuş, Tatlıtuğ da eşine yapılan bu saygısızlığa ateş püskürmüş ve tüm fotoğrafları silmişti. Uzun süredir …

Devamını Oku »

Renault, EV rekabetini ağırlıyor; Uzun menzilli yeni gelenlerle 'devrilme noktası' görür

Renault Zoe Avrupa'nın en çok satan EV'sidir. Peter Sigal Otomotiv Haberleri Avrupa 7 Nisan 2017 06:01 CET Elektrikli otomobillerin öncülerinden olan PARIS – Renault, EV'lerin genel kabul görmesinin bir devrilme noktasına geldiğini ve Volkswagen ve Opel gibi Avrupalı ​​rakiplerin piyasaya daha fazla girdikçe rekabetin artmasını memnuniyetle karşılıyor. 2011 yılında Renault-Nissan ittifakı, 2016 yılına kadar 1,5 milyon sıfır emisyonlu araç satma …

Devamını Oku »

Uzun Saç Kesimleri

Yıllar geç de uzun saç modası bir türlü geçmiyor. Kısa saçın egemenlik sürdüğü son yıllarda safra, uzun saçlı gündeme rahatlıkla oturabiliyor. Uzun saçın bu kadar sevilmesinin ilk nedeni onlarca saç modeli yapabilmenizdir. Kendi biçene yansıtabilecek bir model bulmak, biraz araştırrağım bakacaktır. Ancak saçlarını kesmek, saçlarını güzelleştirmek ve farklılaşmak saçlarını kesmek. Saç kesimi, saçın duruşunda çok önemli rol oynar. İyi bir …

Devamını Oku »

NOAA'nın en büyük gemisi en uzun voyag sonrasında eve geliyor …

                                     Ulusal Okyanus ve Atmosfer İdaresi'nin en büyük oşinografik araştırma gemisi, acentenin tarihinde herhangi bir geminin en uzun süre konuşlandırılmasının ardından ana sayfaya geri döndü.                                                                       NOAA Gemisi Robert H. Brown, 3½ yıllık konuşlandırma sırasında yaklaşık 800 gün denizde kalmıştı. NOAA, geminin çevresel verileri toplamak için yaklaşık 130.000 mil boyunca bilimsel araştırma yaparak ve şamandıralara hizmet ettiğini söyledi. Ajans, …

Devamını Oku »

Hyundai uzun menzilli SUV yakıt hücresi itmek yenilemek istiyor

Hyundai, bu yılki Cenevre otomobil fuarında FE Yakıt Pili konseptini sundu. Sohee Kim Bloomberg 30 Mart 2017 11:39 CET Hyundai Motor Co, yakıt hücreli araç üreten ilk otomobil üreticisi, Toyota Motor Corp ve Honda'nın rakip tekliflerine göre daha uzun sürüş aralığı ile gelecek yıl yeni bir hidrojenle çalışan SUV'yi piyasaya çıkarmayı planlıyor Motor Co.'da sahada liderliği geri kazanmaya çalıştığı için. …

Devamını Oku »

Başbakan Narendra Modi, Srinagar'ı ve Cammu'yu birbirine bağlayan Hindistan'ın en uzun yol tünelini açtı

                         Başbakan (PM) Narendra Modi, bugün ülkenin en uzun karayolu tünelini – Cammu ve Keşmir'deki Chenani-Nashri otoyol tünelini açtı. 9 km'den uzun bir sürede, Hindistan'daki en uzun karayolları tüneli değil aynı zamanda Asya'nın en uzun iki yönlü karayolları tüneli. J & K'deki yeni tünelden bahsettik. Jammu-Srinagar Ulusal Otoyolunun 286 km uzunluğundaki dört şeritli projesinin bir kısmı olan Chenani-Nashri otoyol tüneli, …

Devamını Oku »

Chenani-Nashri Otoyol Tüneli: Hindistan'ın En Uzun Yol Tüneli Hakkında 10 Şey

                         Başbakan Narendra Modi, hükümetin 'Make in India' ve 'Beceri Hindistan'ı' girişimi için ideal bir örnek olarak görülebilir, bugün ülkenin Cammu ve Keşmir'deki en uzun yol tünelini açacak. Sana Mart ayının başlarında bahsettiğimiz 'Chenani-Nashri Otoyolu Tüneli', Cammu ve Srinagar'ı birbirine bağladı ve bugün resmi kullanıma açık olacak. Bu gerçekten Hint hükümeti için prestijli bir andır ve burada Hindistan'ın en uzun …

Devamını Oku »

RNA helikazları, RNA yapılarını modüle etmek ve RNA-protein (RNP) kompleks montajını kolaylaştırmada temel roller oynamaktadır ] In vivo . Daha önceleri, laboratuarımızda S'de DEAD-box RNA helikaz Dbp2 gösterildi. Cerevisiae ko-transkripsiyonel olarak ilişkili mRNA'ya bağlanan protein Yra1, Nab2 ve Mex67'nin poli (A) + RNA üzerine etkili bir şekilde birleştirilmesini teşvik etmek için gereklidir. Ayrıca, Yra1'in doğrudan Dbp2 ile ilişkili olduğunu ve Dbp2'nin çözülme ve inhibisyon döngüsünü düşündüren Dbp2'ye bağlı dupleks çözme inhibitörü olarak işlev gördüğünü bulduk. Bunu test etmek için birlikte transkripsiyonel mRNP montajında ​​Dbp2 olaylarının sırasını aydınlatmak için bir dizi deney yaptık. Şimdi, Dbp2'nin RNA yoluyla kromatin içine alındığını ve Yra1 ve Mex67 ile geniş, RNA'ya bağlı bir kompleks oluşturduğunu gösteriyoruz. Dahası, tek moleküllü (smFRET) ve toplu biyokimyasal analizler, Yra1'in Dbp2'nin tek sarmallı RNA ile ilişkisini engelleyerek konsantrasyona bağlı bir tarzda çözmeyi engellediğini göstermektedir. Bu inhibisyon, Dbp2'nin mRNA üzerinde aşırı birikmesini ve RNA Pol II transkriptlerinin bir alt grubunun stabilize edilmesini önler. Yra1'in, mRNA'nın bir araya getirme işlemini Dbp2 ile sonlandırdığı bir model öneriyoruz. Anahtar kelimeler: DEAD-box, helicase, RNA-Protein kompleksi, kromatin, RNA [Giriş Gen ifadesi sayısız, koreografi yapılan basamakları içeren son derece karmaşık bir süreçtir . Giriş Ökaryotlarda transkripsiyon sırasında, yeni sentezlenmiş haberci RNA'ya (mRNA), nükleer ihracat ve çeviriden önce 5 'kapak, ekleme ve 3' son oluşumu da dahil olmak üzere çeşitli birbirine yakından bağlantılı işleme olaylarına rastlanır [1–3]. Bu adımların her biri boyunca, mRNA, her olgunlaşma evresinde kompozisyonu sürekli değişen haberci ribonükleoprotein kompleksleri (mRNP) oluşturmak için RNA-bağlayıcı proteinlerle bağlanır [4]. Uygun mRNP oluşumu gen ekspresyonu için kritiktir ve uygun biyolojik zaman noktasında doğru yapılandırılmış mRNA gerektirir [2,5]. Fiziksel özelliklerine bakıldığında, RNA molekülleri, uzun ömürlü ve alternatif konformasyonları açıp tekrar konrol etmek için büyük miktarda enerjiye ihtiyaç duyan kararlı ikincil yapılar oluşturma eğilimindedir [6,7]. Bu, hücrelerdeki RNA yapısal dönüşümlerini hızlandıran proteinlere ihtiyaç duyar. Tomurcuklanan mayada S. Cerevisiae mRNA, anormal yapıların oluşumunu önlemek için aktif mekanizmaların dahil edilmesini düşündüren, termodinamik tahminlerden farklı olarak in vivo olarak . Sürekli olarak, mayalanma maymundaki ATP tükenmesi, mRNA'da artmış sekonder yapıya neden olur [2]. Dahası, mRNA sekonder yapısının son genom analizleri, yapısal sapmaların gen regülasyonunu değiştirebileceğini gösteren düzenleyici bölgelerdeki tek nükleotid polimorfizmleri ile değiştirilmiş RNA yapısı (yani, miRNA-bağlanma alanları) arasında çarpıcı bir korelasyon bulmuştur Hücresel mRNA'ların yapısal yeniden düzenlenmesi için olası adaylar, RNA çözen veya RNA-protein (RNP) yeniden şekillendirme enzimleri olarak işlev gören ATP'ye bağımlı RNA helikazlarıdır [10,11]. DEAD-box proteinleri insan hücrelerinde yaklaşık 40 üyeyle (mayada 25) RNA helikaz familyasındaki en büyük enzim sınıfını oluştururlar. Bu sınıfın üyeleri, yaşamın tüm alanlarında bakterilerden memelilere kadar her yerde bulunur ve pre-mRNP meclisi [12] dahil olmak üzere RNA metabolizmasının her alanında yer alırlar. Örneğin, insan Tau proteinini kodlayan pre-mRNA'nın alternatif bağlanması, ekzon 10'un 5 'ek yeri [13]' in aşağısındaki bir kök-ilmek yapısıyla düzenlenir. U1 snRNP'nin tau ekzonunun 5 'ekleme sitesine erişebilmesi için, bu kök-döngünün DEAD-proteini DDX5 [13] tarafından çözülmesi gerekir. tau genindeki eklemenin yanlış düzenlenmesi, demans ile ilişkilidir ve doğru gen ifadesi için yeniden modellemenin önemini vurgulamaktadır [14,15]. Bununla birlikte, pre-mRNA / mRNA yeniden şekillendirme biyokimyasal mekanizması (lar) ımız konusundaki anlayışımız, birlikte transkripsiyonel süreçlerin karmaşık ve oldukça birbirine bağımlı doğası nedeniyle engellenmiştir. Dahası, bireysel DEAD-kutusu protein ailesi üyeleri, düzenleyici yardımcı proteinlerin verdiği biyolojik fonksiyonların çeşitlendirilmesiyle birlikte RNA tavlama, nükleotid algılama ve RNP yeniden biçimlendirme dahil olmak üzere geniş biyokimyasal farklı aktiviteler sergilemektedir S. DDX5'in cerevisiae ortologu Dbp2 [19] 'dır. Laboratuvarımız daha önce, Dbp2'nin kromatin kopyalama ile ilişkili olan aktif bir ATPaz ve RNA helikazının olduğunu tespit etmiştir [17,20]. Üstelik mRNA'ya bağlanan protein Yra1 ve Nab2'nin yanı sıra mRNA ihracat reseptörü Mex67'nin mRNA üzerine birleştirilmesi için Dbp2 gereklidir [17]. İlginç olarak, Yra1 doğrudan Dbp2 ile etkileşime girer ve bu etkileşim, Yra1'in Dbp2'nin çözülmesini kısıtladığını gösteren çoklu döngü, toplu analizlerde Dbp2'nin çözülmesini engeller [17]. Bununla birlikte, Yra1'e bağlı inhibisyonun mekanizması ve biyolojik rolü anlaşılamamıştır. Biyokimyasal, moleküler biyoloji ve biyofiziksel yöntemlerin bir kombinasyonunu kullanarak, şimdi Yra1'in Dbp2'nin aktivitesini -transkripsiyonel mRNP montaj adımları. Bu inhibisyon, transkript seviyelerinin bakımı için önemlidir in vivo . Tek moleküllü (sm) FRET ve floresan anizotropi çalışmaları, Yra1'in Dbp2'nin RNA ile ilişkisini önleyerek Dbp2'nin çözülmesini engellediğini göstermektedir. Sürekli olarak, maya hücrelerindeki Yra1-Dbp2 etkileşiminin kaybı, mRNA üzerinde Dbp2'nin transkripsiyon sonrası birikmesine neden olur. Birlikte ele alındığında, bu, Yra1'in in vivo olarak Dbp2'ye bağımlı mRNP birleşiminin bir döngüsünü sonlandırdığını düşündürmektedir

Sonuçlar Dbp2 işe alındı DEAD-box RNA helikaz Dbp2 ağırlıklı olarak aktif olarak transkripsiyona uğramış genler ile çekirdekte lokalizedir [20–23]. Dbp2'nin başlangıçtaki RNA aracılığıyla kromatin ile işe alınıp alınmadığını belirlemek için, RNaz ile veya olmadan RNase ile kromatin immünopresipitasyon (ChIP) analizleri yaptık [24]. Kısaca, endojen DBP2 kodlama bölgesinin 3 'ucuna kaynaşmış bir 3XFLAG epitop etiketi barındıran maya hücreleri, bilinen gen olan …

Devamını Oku »

Bu güvensiz kızlar neden bu kadar uzun süre bek değil

Unsplash / Ryan Winterbotham Tek kişilik değilsin, çünkü senin büyüklüğün Göğüsler, burun veya bel. Bekar değilsin, çünkü çirkin ya da sıkıcısın ya da aptal. Tek değilsin, çünkü hasar görmüş, kırık ya da dokunulmazsın. Aynaya ya da fotoğrafa baktığınızda kendinize söylediğiniz o pis şey doğru değil. Bir erkek arkadaşı bulmakta zorluk çekmenin nedeni, sözde 'kusurların' değil. Bekar, çünkü övgüleri kabul etmeyi …

Devamını Oku »

Allef Vinicius Sana nasıl hissettiğimi anlatmayı öğreniyorum çünkü tek rüya gören tek kişi olmak istemiyorum ve dışarıda yaşıyorsun. Çok erken olsa bile bunu söylemeyi öğreniyorum. – Sana neden cevap vermek için çok uzun sürdüğünü sorduğumda, neden beni görmeye çalışmadığını sorduğumda, kabul etmediğim zaman konuşmaya başlıyorum ve sana inanmadığımı söylediğimde. Sana asla yapmayacağım şeyleri, beni inciten her şeyi kurtarmana izin vererek seni kaybetmekten korktum. Seni kabul etmeyi öğrenmeyi değil, aynı zamanda kendime karşı dürüst olabilmeyi öğreniyorum.

hareket etmeye devam edersem bu film sonunda kaybolur. ]] Gülüşümün arkasında saklanmaya devam edersem, sonunda gözyaşlarına boğacağım ve beni her zaman ağlamam insanları sevmeyi öğreniyorum. Sana karşı dürüst olmayı ve nasıl sevileceğimi ve 19459008 yıllarında sevmeyi istediğimi ve bana ihtiyacım olanı veremiyorsan yaşamanın nasıl olduğunu öğrendim ] Olmadan sen. Rania Naim, burada mevcut olan yeni kitabın Söylenmesi Gereken Tüm Sözcüklerin …

Devamını Oku »

2016 Toyota Mirai İnceleme – Uzun Süreli Güncelleme 2

                                  Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram …

Devamını Oku »

Yabani şempanzelerin şaşırtıcı derecede uzun ömürlü olması

                                                                                                          Uganda'nın Kibale Ulusal Parkı'ndaki şempanzelerin Nogo topluluğunun bir üyesi. Yeni bir araştırma Ngogo şempanzelerinin şaşırtıcı derecede uzun ömür beklentilerine sahip olduğunu gösteriyor. Kredi: Brian Wood / Yale Üniversitesi      Uganda'nın Kibale Ulusal Parkı'ndaki büyük bir şempanze topluluğunun 20 yıllık demografik bir çalışması, sağ ekolojik koşullar altında, yakın primat akrabalarımızın vahşi doğada şaşırtıcı derecede uzun …

Devamını Oku »

BMW Mini'nin uzun süredir ABD'li reklam ajansı incelemeden önce hesabından istifa etti

Mini'nin ABD satışları, 2016 yılında% 11,1 düşüşle 52.030 araç oldu. Butler Shine Stern & Partners, BMW'nin Mini markası için ABD reklam ajansı olarak istifa etti, otomobilin yaklaşmakta olan yaratıcı incelemesinin öncesinde bir hareket. Son incelemeye katılan ve şirketi elinde tutan BSSP, ajansın geçen haftaki bir bildiriye göre, bir başka öngörülen inceleme öncesinde "sözleşmesinde fesih şartını başlattı" dedi. 2012'deki en son …

Devamını Oku »

Jammu ve Srinagar'ı Bağlayan Hindistan'ın En Uzun Yol Tüneli Mart-Sonuna Kadar Halkın Kullanımına Açılacak

                         Deneme sürümü başarıyla tamamlandıktan sonra, yeni Cammu-Srinagar Ulusal Yolu dört şeritli projesindeki yeni ikiz tüp tünelin kamuya açık hale getirilmesi ve yakında trafiğe açık hale getirilmesi bekleniyor. 9.2 km'de, bu ülkedeki en uzun yol tüneli ve Başbakan Narendra Modi'nin, ay sonunda, otoyol tünelini açması muhtemel. 1200 metrelik bir yükseklikte bulunan tünel, aynı zamanda, dünya standartlarında 'entegre tünel kontrol sistemi' …

Devamını Oku »

Nanotüp filminin uzun ömür problemini çözebilir …

                                                                                                          Bir perovskit güneş pilinin bir illüstrasyonu. Kredi: Fotoğraf Aalto Üniversitesi / Uppsala Üniversitesi / EPFL      Beş yıl önce, dünya geleneksel silikon hücrelere, daha az enerji tüketen daha basit ve daha basit bir üretim süreci ile meydan okuyan üçüncü nesil güneş pilleri hakkında konuşmaya başladı.                                                                                 Metilamonyum kurşun iyodür, perovskite kristal yapısındaki …

Devamını Oku »

Daha uzun süreli zamanlamalar insanlara daha fazla para bağışlar

                                                                                                          Kredi: George Hodan / kamu malı      "Üç gün içinde bir bağış yaparsanız, isimsiz bir katkıda bulunan kişi ek bir DKK 10 bağışta bulunuyor"                                                                                 Bu, Ekonomi ve İşletme Ekonomisi Bölümü'nden araştırmacılar tarafından Aarhus BSS – Aarhus Üniversitesi tarafından DanChurchAid adına e-posta ve kısa mesaj yoluyla daha önce para bağışlanan yaklaşık 53.000 …

Devamını Oku »

Raporda Hugh Jackman, Enzo Ferrari'yi uzun zamandır beklenen filmde oynayacak

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Avustralya'nın aktörü Hugh Jackman'ın Ferrari rolünü oynamasıyla birlikte, Enzo Ferrari biyografisi yıllarca yanlış başlangıçların ardından nihayet yeniden yoluna çıktı, Son Başvuru raporları. İsveçli oyuncu Noomi Rapace, Ferrari'nin eşi Laura'yla birlikte projeye bağlandı. Yönetmen ve yapımcı Michael Mann'in geç Sydney Pollack'le 2008'de ölümüne kadar üzerinde çalıştığı film şu anda …

Devamını Oku »

Ben Warren Geleceğin Konuşmalarını Düşündüğümde, gelecekte kesinlikle çıkacaksın; Konuşmalarımda. İnsanlarla bile bilmiyorum. Bundan sonra en yakın arkadaşımla kahve içeceğim ve geçmiş sevgiler hakkında konuşmaya başlayacağız. "Bu adam vardı …" Ona söyleyeceğim ve çünkü seni tanımıyor, yalnızca istediğimi görecek. Ona söylediğim kısımları yalnızca biliyor. Bunda büyülü bir şey olacak, caydırca dürüst bir açıklama olacak ancak aynı zamanda da kör olacak. Öyküyü nasıl anlatacağımı düşünürüm, çünkü yalnızca şimdiye kadar görüşlerini paylaşan insanlara kısmen anlattım. "Bir süre birlikte olduk, uzun değil, sadece on beş ya da on altı" belki söyleyeceğim ama yine de tüm hatıralarımızın tarih ve saatlerini hatırlayacağım. " o adam, bilirsiniz?" Dedim ki, ne demek istediğimi anlamak için ona bakıyorum. "Ne

o adam?" Diye soracak. "Seni hiç unutmayacak o adam biliyor musun? İlk aşkınız belki; Bilmiyorum, gözlerini açan ve dünyayı farklı gören ilk kişi. Sizi hiç tanımadığınız bir çeşit his ile dolduran kişi, onlardan önce var olduğunu ve sonra da gittiklerinde sizi asla mümkün olduğunu düşündüğünüz bir tür boş boşlukla terk ettiler … " Başını salacak, çünkü itiraf etmek istemiyorum bile …

Devamını Oku »

Kısa Vadide Arkadaşlık Uzun boylu kadın Tırmanan Kazada Ölüyor …

Ben White Cincinnati, OH'den bir emlak komisyoncusu öldü Onun daha uzun boylu kız arkadaşı sarılmak için bir basamak çıkarken. Belchen, tahta dışkı parçasının üst basamağından düştüğünde ölümcül bir dökülme yaşadı ve başını boynunu kırparak beton bir zemine çarptı. Paul Belchen, Alexa Marcarian'ın başını hafifçe öpmek için ayaklarına dikildi ve aniden geri çekildi ve dengeye düştü ve bir şeye yakalamak için …

Devamını Oku »

Yeni bir uzun vadeli ekolojik araştırma sitesi ilan edildi …

                                                                                               için ilan edilen yeni bir uzun vadeli ekolojik araştırma sitesi                                            Yeni kurulan NES-LTER'deki çalışmalar, karmaşık kıyı okyanusu ekosistemini daha iyi anlamak ve yönetmek için yardımcı olacaktır. Site, önceden kurulmuş, teknolojik açıdan gelişmiş araştırma yerlerinden (kuzeydeki Martha's Vineyard Coastal Observatory (MVCO) ve güneydeki Ocean Observatories Initiative (OOI) Pioneer Array) toplanan verilere dayanıyor ve araştırmacılarla yapılan …

Devamını Oku »

Volvo Eyes Uzun Vadeli Taşımacılık Segmenti Hindistan'da

                         İsveçli ticari araçlar büyük Volvo, kategorideki büyümeyi teşvik etmesi beklenen GST'le Hindistan'daki uzun mesafeli nakliye segmentini inceliyor. Madencilik, otobüs ve inşaat ekipmanları gibi özel sektörler için premium kamyon üreten şirket ayrıca daha fazla verimlilik ve fireyi en aza indirgemek suretiyle lojistik maliyetini düşürmeyi hedefliyor. "GST girip vergilendirme değişiklikleri yaparken, nakliye sektöründe olumlu değişiklikler olacak ve örneğin çapraz geçişle daha …

Devamını Oku »

Dünyanın En Uzun Koşu Pisti Amerika'da Oluyor »AutoGuide.com News

John Morris, Spring Mountain Resort & Country Club için büyük planları var. Dünyanın En Uzun Koşeli En Köşk Nevada'daki Pahrump'da bulunan Spring Mountain Motorsports Ranch yavaş yavaş yarış meraklıları için bir yer haline geliyor. Sahibi olan John Morris, 2004 yılında sadece 2,2 mil'lik bir pistte satın aldı. O günden bu yana, Morris, kulüp üyelerinden birinin "yetişkin bir Disneyland" dediği lüks …

Devamını Oku »

Almanya'da İş Yerleri | Gezipgordum.com Uzun ve köklü tarihi ile ön plana getirildi Almanya dünyanın en iyi göçünü alıp götürüyor. Batı ve Orta Avrupa'da yayılma gösteren ülke, özellikle sıcaklıkların artlarına ilkbahar ve yaz aylarında yoğun bir turist popülasyonu ile karşılaşıyor.

Almanya'da tatil mekanları Listesi Almanya'da tatil mekanları 1871 yıllarında milli birliğini tamamlamış olan Almanya, 16 federal alt bölgesi ile her yıl çok fazla turisti ağırlıyor. Müzik, tiyatro ve felsefe gibi sanat dalları ise Avrupa'da medeniyetine büyük katkılar yaratıyor modern ülkeye uçuşlarını gerçekleştirerek, kültürel ve tarihi bir gezi deneyimi yaşayabilirsiniz. Uzatmadan Almanya gezilecek yerler listemizde detaylara geçelim … Otel için inceleme …

Devamını Oku »

Araştırmacı, daha temiz ve uzun bir ada için aracı ortaya koydu …

                                                                                                          Branford fotoğrafı, alta uzanıp tırmığı yukarı çekerek toplanan yosunu gösterir. Kırmızı yosun dalları ve toplanan miktar sadece bir geçişte, bu bölgede yosun gelişimini artıran besin maddelerinin büyük bir miktarının işaret ediyor. Kredi: Jamie Vaudrey, UConn, 2016      UConn ekolojisti Jamie Vaudrey tarafından geliştirilen Amerikan Bilim Derneği toplantısında yeni bir model bugün, Long Island Sound …

Devamını Oku »

£ 120m aşağı, UK.gov hala çok uzun bir yol olduğunu buluyor …

                                  Birçok olağanüstü mülkiyete sahip olan Graphene, İngiltere hükümetinin fonlarında £ 120m civarında yuttu ancak gelişme ve ticaret dünyası, işkenceyle yavaş yavaş hayal kırıklığı yaşıyor.                  Geçen yılın ilerleyen aşamasında, ilerleme eksikliği olan milletvekilleri, ilgili konuyu Avam Kamarası Bilim ve Teknoloji Komitesi aracılığıyla bir dizi duruşma yaptıklarından endişeliler.                                                    Milletvekilleri üç endişeli figürle karşılaştı: Baroness Neville-Rolfe, Enerji …

Devamını Oku »

Tayland Yüzen Pazar Turu Hakkında Bilgiler Tayland ve Bangkok denilince akıllara gelen ilk yerlerden biri Yüzen Pazar ya da kullanılan diğer adı ile Yüzen Market oluyor. Seyahat programlarında uzun uzadıya yapılan tanıtımlar ve geçmişte çekilmiş ünlü filmler ve yüzen pazarlar çok daha popüler bir yerleşik olun ve pazarlar bu coğrafyaya yolculuk planlayan herkesin hayalini süslüyor.

Uzun süren araştırmalar sonucunda Bangkok seyahatin kararı verdiniz ve Bangkok gezilecek yerler listenizi hazırlıyorsunuz. Bu listeeye göre güzel bir seyahat planı oluşturacaksınız. Bangkok planınızda Sıra Yüzen Pazar turuna geldiginde ISE siz de benim gibi biraz şaşırıp moraliniz bozulabilir. Otel fiyatlarını incelemek Rezervasyon yaptırmak Için [19459019ziyaretinde] Şöyle anlatayım, Tayland 'nın başkenti Bangkok Damnoen Saduak Yüzen Pazarı ve burası başkent Bangkok'tan 100 …

Devamını Oku »