17 Aralık 2017,Pazar
Anasayfa » Tag Archives: uygun

Tag Archives: uygun

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Amiloide Yapısal Değişiklik … Aβ fibril polimorfizminin AD'nin klinik ve patolojik özelliklerinde değişikliklerle ilişkili olabileceğine dair kanıtlar şunları içerir: (i) Farklı molekül yapılarına sahip Aβ40 fibrilleri, primerde farklı toksisite seviyeleri sergiler Nöronal hücre kültürleri 1 ; (Ii) Harici amiloid içeren biyolojik materyal tarafından indüklenen, transjenik farelerde amiloid biriktirme şekilleri, bu maddenin kaynağına göre değişir 13,14 ; (Iii) Transgenik farelerde sentetik Aβ42 fibrilleri ile indüklenen amiloid plaklarının boyutu ve bileşimi, bu fibrillerin morfolojisi ve büyüme koşullarına bağlıdır 15 ; (Iv) Aβ42 agregalarının beyin dokusunda kimyasal dağılımı ve direnci, hızla ilerleyen ve yavaş yavaş ilerleyen AD hastalarında farklılık göstermektedir. 16 AD'deki nörotoksik Aβ yapılarının yapılarının karakterizasyonu geliştirilmiş ve yapı ile Hastalık fenotipinin, patogenez hakkındaki anlayışımızda, uygun tanı ve terapötik biyolojik belirteçlerin gelişimine ve ilaç geliştirme üzerine önemli bir etkisi olacaktır. ssNMR'den gelen veriler, yapısal değişikliklere özellikle duyarlıdır ve iki boyutlu (2D ) 13 C- C ve N- 13 C ssNMR spektrumları, spesifik fibril polimorflarının "parmak izleri" olarak kullanılmaktadır. 1,4,20,21 ssNMR, miligram ölçekli miktarda izotopik olarak işaretlenmiş fibril gerektirdiğinden, beyin dokusunu tohum büyümesi ile büyüttüğü ve etiketlediği beyin dokusunun kaynağı olarak . . tarafından tanımlanan fibril tohumları Farklı suşların farklı hastalık süreleri ürettiği prion hastalıklarına benzer olarak, Ve hastalıkla ilişkili prion proteinlerinde konformasyonel farklılıklar ile ilişkilidir 17-19,22 görme işleminin bozulması ile ilişkili PCA-AD gibi olağandışı iki AD alt tipindeki hastalardan doku örnekleri seçtik. 23 ve n-dejenerasyonunun aylar içinde gerçekleştiği ve kliniksel olarak Creutzfeldt-Jakob hastalığına benzediği r-AD 24 Demans olmadan ölen üç kişi (ND) Otopside Aβ depolanması bulunduğu tespit edildi. Aβ40 ve Aβ42 fibrillerini, amiloidle zenginleştirilmiş korteks özlerinden tohumlanmış büyüme ile ayrı ayrı hazırladık. Tüm fibril numuneleri için transmisyon elektron mikroskopu (TEM) görüntüleri alındı. Tüm örnekler için ssNMR ölçümleri denendi, ancak bazı durumlarda sinyal / gürültü oranları 2D spektrumlarının edinimi veya müteakip analizi için yetersizdi. Doku örneklerini, hasta kategorilerini ve ssNMR ölçümlerini özetler. TEM görüntülerinin örnekleri ve 2D spektrumlarının tam setleri -. AD olmayan bir hastanın korteks özü ile kontrol deneyleri önemli Aβ depolanmasına sahip değildir Ek Tartışma ve

Beyin tohumlanmış Aβ42 fibrillerinin temsili TEM görüntüleri ve 2D ssNMR spektrumu

Devamını Oku »

Esmer Tene Uygun Saç Renkleri

Saç rengi Tercihen Yaparken Kesinlikle Teninizle uyumlu olmasına dikkat etmelisiniz. Bir başkasında çok beğendiğiniz saç renginin de aynı etkiyi yaratmasını bekleyemezsiniz. Birçok kadında sarı saç zaafı var ki sarı saç; Açık tenli kadınların tümünde aynı şekilde durmayan; Kimin çok yakışan ancak bazılarında emanet gibi duran bir renk. Hele ki teniniz esmerse özellikle sarılmış bazı tonlarından kesinlikle uzak durmalısınız. Ancak sarının …

Devamını Oku »

Üçgen Yüze Uygun Saç Modelleri

Saç modeli seçiminizi belirleyecek; Zevkleriniz, yaşınız, statünüz, saçınıza ayırdığınız vakit vb pek çok farklı etken vardır. Ancak bu etkenlerden en önemlisi yüz tarifinizdir. Yüz şekline uygun olmayan bir saç modeli ne kadar beğenerek kestirmiş olursanız olunca siz de sonuçta mutlu etmeyecektir. Bu nedenle öncelikle yüzünüzü tanımalı ve buna göre karar vermelisiniz. Üçgen yüz şekli uzun ve sivri bir çene hattıyla …

Devamını Oku »

Yüz Şekline Uygun Perçem Modelleri

Birçoğumuz belli dönemlerde kahkül kestirmeyi düşünmüş ve uygulamışızdır. Bu modelin en güzel yanı yakışması, üstelik fark edilmemi ihtimali de sıfır. Ama sadece saçlarını yapmaya çalışmak zor olabilir. Örneğin, dalgalı saçlara sahip kadınların kahkül kestirmesi, kahkül fikrinden safra nefret ettirebilir, sürekli düzleştirmek gerekir. Yağmurlu ve nemli havalarda da bu zorluk ikiye katlanır. Kahküllü saç modelleri nden kaçınması gereken diğer bir grup …

Devamını Oku »

Yüz Şekillerine Uygun Saç Ayrımı

Her saç modeli onun yüze gitmediği gibi onun yüzünü de şekli için uygun değildir. Saç modelinizi nasıl desen yapabilirsin ve saç tipinize göre belirliyorsanız aynı şekilde saç ayrımını da yüz stilinize yakışacak şekilde belirlemelisiniz. Yüz modelinde uygun ayrılmış saç modelleri ile küçük hileler şeklinde. Yüzünüzü devam daha ince gösteri; Birinci okunmamış Mesaja git Yüz Tipleri ve Saç Ayrımları Yuvarlak ve …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Soyutlama Cinsel üreme, her kromozomun yalnızca bir kopyası ile haploid gametlerin (sperm ve yumurta) üretimini gerektirir; Döllenme sonraki nesildeki diploid kromozom içeriğini geri yükler. Genetik içeriğindeki bu azalma, iki tur kromozom ayrışmasının DNA replikasyonunun tek bir turunu izlediği, mayoz olarak adlandırılan özel bir hücre bölünmesi sırasında başarılır. İlk mayot bölünmeye hazırlanırken, homolog kromozomlar çift ve sinaps, çapraz rekombinasyon olaylarının oluşumunu teşvik eden bir bağlam yaratır. Bu geçitler, kız kardeş kromatid bağlılığı ile bağlantılı olarak, iki homolojiyi birbirine bağlar ve ilk mayoz bölünme sırasında karşı kutuplara ayrılmalarını kolaylaştırır. Mitoz benzer ikinci mayos bölünme sırasında, kız kardeş kromatidler ayrı; Sonuçta üretilen ürünler gamet haline gelen haploid hücrelerdir. In C. Elegans (ve birçoğu ökaryotların çoğunu) mayooz sırasında uygun kromozom kalıtımı için homolog eşleştirme ve rekombinasyon gereklidir; Dolayısıyla, bu olayların düzgün şekilde yürütülmesini sağlamak için mayoz olayları sıkı bir şekilde koordine edilmektedir. Bu bölümde, mayoz bölünme olaylarını gözden geçiriyoruz: homolog kromozomların eşleştirilmesi; Kromozomların mayoz döneminde geçirdiği kromozom yapısındaki değişiklikler; Mayotik rekombinasyon olayları; Homolog kromozom çiftlerinin Meizoz I'de uygun kromozom ayrımı için optimize edilmiş yapılara ayrılması; Ve mayotik bölünmeler sırasında kromozomların nihai ayrımı. Ayrıca, I. evre boyunca bu mayotik olayların koordineli yürütülmesini sağlayan düzenleyici süreçleri de gözden geçirdik.

1. Genel Açıklama Cinsel üreme, mezozun uzmanlaşmış hücre bölüşümü programı aracılığıyla diploid öncülerden haploid gametlerin üretilmesini gerektirir. Ploidy'deki bu azalma döllenmeyle ilgili olarak diploidyondaki restorasyonun sağlanması için gereklidir ve birkaç önemli olayı tamamlamayı gerektirir (). Erken evre (leptoten ve ziggoten evreleri) sırasında, her kromozom, uygun homolog eşleştirme partnerini bulmalı ve tanımalı ve buna uyumlu olmalıdır. Ziggoten safhasında, homologları bir arada …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

Depoları daha uygun hale getirmek, geri dönüşüm ve kazanıyor …

                                                                                            Kredi: University of British Columbia      Daha fazla geri dönüşüm veya komposto yapmak ister misiniz? UBC tarafından yapılan yeni araştırmalara göre, bidonları daha da hareket ettirmeyi deneyin.                                                                                 Çalışma, süit kapılardan 1,5 metre uzaklıktaki kutuları yerleştirmenin geri dönüşüm ve kompostlaştırma oranlarını yüzde 141 oranında büyük ölçüde artırdığını gösteriyor. Bulgular, kolaylıktaki küçük değişikliklerin performans üzerinde …

Devamını Oku »

Van finansmanı açıklandı: van alıcılar için kiralama, kontrat kiralama ve kişisel kredi fırsatlarını araştırmak Yeni bir minibüs satın almak istiyorsanız, bunun için çok sayıda yol bulacaksınız . Gün dönersek nakit kral oldu ve en yakındaki minibüs tezgah bürosuna gitip, paranızı işinize yeni bir araç için teslim ettiniz ve yolda olun. Endişelenmeniz gereken tek harcama, yakıt, karayolu vergisi ve hizmet olacaktı ve o zaman bir tane giydiğinde yeni bir minibüsün bedelini ödemeniz gerekecekti. Ama bugün, minibüs finans piyasası, bir araba satın alırken karşılaştığınız kadar karmaşıktır. Van alıcılarına açık çok çeşitli seçenek, bütçeniz ne olursa olsun bir kamyon finansmanı çözümü olması gerektiği anlamına gelir; hüner doğru seçer. Peki hangi tür van finansmanı sizin için ve işletmeniz için en iyisi? Başka türlü görünmüyor çünkü mevcut farklı finans seçenekleri incelenmiş ve onları artı ve eksileriyle derecelendirdik, işinize uygun finansman anlaşmasını seçmenize yardımcı olmak için. • Van sigortası: en iyi anlaşmayı nasıl alabilirim Van finans seçenekleri açıklandı Nakit Basit işlem, karmaşık bir finans anlaşması gerekmiyor

Eksileri: Gri bir alan olabilir Vergi için, yeni bir tane satın alana kadar minibüste sıkıştın Yeni bir minibüs satın almanın en basit yoludur, ancak nakit ödeme mutlaka en akıllı seçenek değildir. Paranızın bedelini ödedikten sonra işte budur: kamyonet sizinkindir ve onunla birlikte istediğiniz şeyi yapabilirsiniz. Fakat bunun anlamı, bakımından sorumlu olduğunuz anlamına gelir ve işinizle çok uzakta kalırsanız bu pahalı …

Devamını Oku »

RNA helikazları, RNA yapılarını modüle etmek ve RNA-protein (RNP) kompleks montajını kolaylaştırmada temel roller oynamaktadır ] In vivo . Daha önceleri, laboratuarımızda S'de DEAD-box RNA helikaz Dbp2 gösterildi. Cerevisiae ko-transkripsiyonel olarak ilişkili mRNA'ya bağlanan protein Yra1, Nab2 ve Mex67'nin poli (A) + RNA üzerine etkili bir şekilde birleştirilmesini teşvik etmek için gereklidir. Ayrıca, Yra1'in doğrudan Dbp2 ile ilişkili olduğunu ve Dbp2'nin çözülme ve inhibisyon döngüsünü düşündüren Dbp2'ye bağlı dupleks çözme inhibitörü olarak işlev gördüğünü bulduk. Bunu test etmek için birlikte transkripsiyonel mRNP montajında ​​Dbp2 olaylarının sırasını aydınlatmak için bir dizi deney yaptık. Şimdi, Dbp2'nin RNA yoluyla kromatin içine alındığını ve Yra1 ve Mex67 ile geniş, RNA'ya bağlı bir kompleks oluşturduğunu gösteriyoruz. Dahası, tek moleküllü (smFRET) ve toplu biyokimyasal analizler, Yra1'in Dbp2'nin tek sarmallı RNA ile ilişkisini engelleyerek konsantrasyona bağlı bir tarzda çözmeyi engellediğini göstermektedir. Bu inhibisyon, Dbp2'nin mRNA üzerinde aşırı birikmesini ve RNA Pol II transkriptlerinin bir alt grubunun stabilize edilmesini önler. Yra1'in, mRNA'nın bir araya getirme işlemini Dbp2 ile sonlandırdığı bir model öneriyoruz. Anahtar kelimeler: DEAD-box, helicase, RNA-Protein kompleksi, kromatin, RNA [Giriş Gen ifadesi sayısız, koreografi yapılan basamakları içeren son derece karmaşık bir süreçtir . Giriş Ökaryotlarda transkripsiyon sırasında, yeni sentezlenmiş haberci RNA'ya (mRNA), nükleer ihracat ve çeviriden önce 5 'kapak, ekleme ve 3' son oluşumu da dahil olmak üzere çeşitli birbirine yakından bağlantılı işleme olaylarına rastlanır [1–3]. Bu adımların her biri boyunca, mRNA, her olgunlaşma evresinde kompozisyonu sürekli değişen haberci ribonükleoprotein kompleksleri (mRNP) oluşturmak için RNA-bağlayıcı proteinlerle bağlanır [4]. Uygun mRNP oluşumu gen ekspresyonu için kritiktir ve uygun biyolojik zaman noktasında doğru yapılandırılmış mRNA gerektirir [2,5]. Fiziksel özelliklerine bakıldığında, RNA molekülleri, uzun ömürlü ve alternatif konformasyonları açıp tekrar konrol etmek için büyük miktarda enerjiye ihtiyaç duyan kararlı ikincil yapılar oluşturma eğilimindedir [6,7]. Bu, hücrelerdeki RNA yapısal dönüşümlerini hızlandıran proteinlere ihtiyaç duyar. Tomurcuklanan mayada S. Cerevisiae mRNA, anormal yapıların oluşumunu önlemek için aktif mekanizmaların dahil edilmesini düşündüren, termodinamik tahminlerden farklı olarak in vivo olarak . Sürekli olarak, mayalanma maymundaki ATP tükenmesi, mRNA'da artmış sekonder yapıya neden olur [2]. Dahası, mRNA sekonder yapısının son genom analizleri, yapısal sapmaların gen regülasyonunu değiştirebileceğini gösteren düzenleyici bölgelerdeki tek nükleotid polimorfizmleri ile değiştirilmiş RNA yapısı (yani, miRNA-bağlanma alanları) arasında çarpıcı bir korelasyon bulmuştur Hücresel mRNA'ların yapısal yeniden düzenlenmesi için olası adaylar, RNA çözen veya RNA-protein (RNP) yeniden şekillendirme enzimleri olarak işlev gören ATP'ye bağımlı RNA helikazlarıdır [10,11]. DEAD-box proteinleri insan hücrelerinde yaklaşık 40 üyeyle (mayada 25) RNA helikaz familyasındaki en büyük enzim sınıfını oluştururlar. Bu sınıfın üyeleri, yaşamın tüm alanlarında bakterilerden memelilere kadar her yerde bulunur ve pre-mRNP meclisi [12] dahil olmak üzere RNA metabolizmasının her alanında yer alırlar. Örneğin, insan Tau proteinini kodlayan pre-mRNA'nın alternatif bağlanması, ekzon 10'un 5 'ek yeri [13]' in aşağısındaki bir kök-ilmek yapısıyla düzenlenir. U1 snRNP'nin tau ekzonunun 5 'ekleme sitesine erişebilmesi için, bu kök-döngünün DEAD-proteini DDX5 [13] tarafından çözülmesi gerekir. tau genindeki eklemenin yanlış düzenlenmesi, demans ile ilişkilidir ve doğru gen ifadesi için yeniden modellemenin önemini vurgulamaktadır [14,15]. Bununla birlikte, pre-mRNA / mRNA yeniden şekillendirme biyokimyasal mekanizması (lar) ımız konusundaki anlayışımız, birlikte transkripsiyonel süreçlerin karmaşık ve oldukça birbirine bağımlı doğası nedeniyle engellenmiştir. Dahası, bireysel DEAD-kutusu protein ailesi üyeleri, düzenleyici yardımcı proteinlerin verdiği biyolojik fonksiyonların çeşitlendirilmesiyle birlikte RNA tavlama, nükleotid algılama ve RNP yeniden biçimlendirme dahil olmak üzere geniş biyokimyasal farklı aktiviteler sergilemektedir S. DDX5'in cerevisiae ortologu Dbp2 [19] 'dır. Laboratuvarımız daha önce, Dbp2'nin kromatin kopyalama ile ilişkili olan aktif bir ATPaz ve RNA helikazının olduğunu tespit etmiştir [17,20]. Üstelik mRNA'ya bağlanan protein Yra1 ve Nab2'nin yanı sıra mRNA ihracat reseptörü Mex67'nin mRNA üzerine birleştirilmesi için Dbp2 gereklidir [17]. İlginç olarak, Yra1 doğrudan Dbp2 ile etkileşime girer ve bu etkileşim, Yra1'in Dbp2'nin çözülmesini kısıtladığını gösteren çoklu döngü, toplu analizlerde Dbp2'nin çözülmesini engeller [17]. Bununla birlikte, Yra1'e bağlı inhibisyonun mekanizması ve biyolojik rolü anlaşılamamıştır. Biyokimyasal, moleküler biyoloji ve biyofiziksel yöntemlerin bir kombinasyonunu kullanarak, şimdi Yra1'in Dbp2'nin aktivitesini -transkripsiyonel mRNP montaj adımları. Bu inhibisyon, transkript seviyelerinin bakımı için önemlidir in vivo . Tek moleküllü (sm) FRET ve floresan anizotropi çalışmaları, Yra1'in Dbp2'nin RNA ile ilişkisini önleyerek Dbp2'nin çözülmesini engellediğini göstermektedir. Sürekli olarak, maya hücrelerindeki Yra1-Dbp2 etkileşiminin kaybı, mRNA üzerinde Dbp2'nin transkripsiyon sonrası birikmesine neden olur. Birlikte ele alındığında, bu, Yra1'in in vivo olarak Dbp2'ye bağımlı mRNP birleşiminin bir döngüsünü sonlandırdığını düşündürmektedir

Sonuçlar Dbp2 işe alındı DEAD-box RNA helikaz Dbp2 ağırlıklı olarak aktif olarak transkripsiyona uğramış genler ile çekirdekte lokalizedir [20–23]. Dbp2'nin başlangıçtaki RNA aracılığıyla kromatin ile işe alınıp alınmadığını belirlemek için, RNaz ile veya olmadan RNase ile kromatin immünopresipitasyon (ChIP) analizleri yaptık [24]. Kısaca, endojen DBP2 kodlama bölgesinin 3 'ucuna kaynaşmış bir 3XFLAG epitop etiketi barındıran maya hücreleri, bilinen gen olan …

Devamını Oku »

Yüz Şekline Uygun Kahküllü Saçlar

Kahkül modelleri ne bakarak iç geçiren çok fazla kadın vardır. Kahkül bir anlık karar veriek kestireceğiniz bir şeyin olursa ve fırsatı alamazsanız saçınızın uzamasını bekleyin sizin için azap haline gelebilir. Bu tür aksiliklerin önüne geçebilmek için onun kadın yüzü iyi bilerek, kendine yakışmayacak bir şey seç şansını en aza Indirebilir. Kahkül kestirmek istiyor bir kadının cevabını bilmesi gerekir iki soru …

Devamını Oku »

Yaprak kesen karıncalar, uygun olmayan plakları tanımayı öğrenirler …

                                                                                                          Yaprak kesen karıncalar, koloni içinde ipuçlarından uygun olmayan bitkileri tanımayı öğrenirler Kredi: Erik Frank      Yaprak kesen karıncalar, 8 Mart 2017'de açık erişim dergisinde yayınlanan bir araştırmaya göre, hangi bitkilerin yiyeceğini koloniden ayrılmadan önce tedarik eden mantar bahçeleri için uygun olmadığını bilebilirler PLOS ONE Andrés Arenas ve Flavio Roces, Würzburg Üniversitesi'nden.                                                                       Yaprak …

Devamını Oku »

Yo'da Uygun Nail Design Mağazasını Bulmanın 5 Yolu …

(Aynı kullanıcı tarafından gösterilmeyen bir ara revizyon) 1. satır: Satır 1: – Dışarı çıkıp güvenilir bir tırnak tasarım atölyesi bulmaya çalışırsanız, gereksinimlerin doğru hizmetle birleşeceği yeri bulmak neredeyse imkansızdır. Piyasadaki en iyi hizmeti vermeye söz veren dükkanların bolluğu olmasına rağmen, çoğu zaman aynı şeyi yapmazlar. Çoğu insan, aradığı tam dükkânı bulamasa da, çivi ile ilgilenildiğinde kesinlikle aynı kategoride olmak istemezsiniz. …

Devamını Oku »

1. Sınıf Matematik Veren Örüntüye Uygun Örüntüyü …

Açıklama Verilen Örüntüsü Uygun Örüntüyü Belirleme 1. Sınıf Matematik Verilen Örüntüye Uygun Örüntüyü Belirleme dosyası, 1. Sınıf Matematik Etkinlik ve Çalışma Kağıtları bölümünde bulunmaktadır. 1. Sınıf Matematik Verilen Örüntüye Uygun Örüntüyü Belirleme Eğitimhanesi, 1. Sınıf Matematik Verilen Örüntüye Uygun Örüntüyü Belirleme indir. Kaynak

Devamını Oku »

Nissan, köpek sahiplerinin neredeyse yüzde 90'ının hayvanlara uygun özelliklere sahip bir araba satın alacağına dair bir ankete yanıt verdi

Nissan, X-Trail'i donatarak Nissan X-Trail 4Dogs konseptini yol açtı Bu 4Dogs konsept paketi ile Nissan X-Trail 4Dogs konsepti, standart SUV'nin önyükleme alanını, iki ailenin evcil hayvanları için silinen deri ile döşenmiş bir ısmarlama 445 litrelik seyahat bölmesine dönüştürür. Ayrılmış arka, çamurlu yürüyüşlerden sonra kolay temizlik için 360 ° açılır duş ile donatılmıştır ve ayrıca nemli kürklerden nemi uzaklaştırmak için bir …

Devamını Oku »

Tubercu'nun Küresel Epidemiyolojisi … Etkili kemoterapinin varlığına rağmen, tüberküloz (TB) 2012'de 1.3 milyon insanı öldürdü. HIV ile birlikte, Enfeksiyöz bir hastalığın ölüm nedeninin başında gelir. TBC'nin epidemiyolojik yükünün azaltılması için küresel hedefler, Binyıl Kalkınma Hedefleri (Binyıl Kalkınma Hedefleri) ve Stop TB Ortaklığı bağlamında 2015 ve 2050 yılları için belirlenmiştir. Bu hedeflere ulaşmak, Tütün kontrolü konusunda ulusal ve uluslararası çabaların odak noktasındadır ve elde edilip edilmediğini göstermek, gelecekteki ve sürdürülebilir yatırımlara rehberlik etmek için büyük önem taşımaktadır. Bu makale, TB hastalığının yükünü tahmin etmek için veri kaynakları hakkında kısa bir bakış sunar; 2012 yılında TB insidansı, prevalans ve mortalite tahminlerini ve 1990 yılından bu yana eğilimlere ve 2015 yılına kadar projeksiyonlara dayalı olarak bu göstergelerdeki düşüşler için 2015 hedeflerine yönelik bir ilerlemenin değerlendirmesini sunar; TB bildiriminde ve Stop TB Stratejisinin uygulanmasında eğilimleri analiz eder; Ve 2015'ten sonra TBC'nin ortadan kaldırılma ihtimalini göz önünde bulundurmaktadır. Tüberküloz (TB), insanlar için tarihlerinin çoğunu etkilemiş olabilir (Holloway ve ark., 2011; Comas ve ark. 2013) ve 50 yılı aşkın süredir etkili ve uygun fiyatlı kemoterapi bulgusuna rağmen dünya çapında ölümün ana nedenlerinden biri olmaya devam etmektedir. 2012'de (WHO 2013a) 1,3 milyon TB ölümle (HIV pozitif kişilerde TB ölümleri dahil), TB ve insan bağışıklık yetersizliği virüsü (HIV) dünya üzerindeki tek bir bulaşıcı ajandan ölümün en büyük nedenidir (Lozano ve ark., 2012; Ortblad ve diğerleri, 2013). TB, en ekonomik olarak üretken yaş gruplarında ve HIV ile yaşayan insanlarda önde gelen bir katildir (Lopez ve ark. 2006) ve TB'den sağlanan iyileştirmeler bile hayat kalitesini önemli derecede azaltan yaşam boyu sekellerle bırakılabilir (Miller ve ark. 2009). Bu gerçeklerin tanınması, 1990'ların başından bu yana TBC kontrolünü uluslararası toplum sağlığı gündeminde yüksek tutmuştur (Zumla ve diğerleri 2009; Lienhardt ve diğerleri 2012a), 1980'ler boyunca yıllarca ihmal edildikten sonra (Raviglione ve Pio 2002). Kemoterapinin, tüm sağlık bakım müdahalelerinden en uygun maliyetli olanı (Murray ve diğerleri 1991; Dye and Floyd 2006), HIV epidemisinin Afrika'daki TB üzerindeki katastrofik etkileri ve Çoklu ilaca dirençli TB'nin (ÇİD-TB) büyümesi, TB önleme ve kontrolünün iyileştirilmesine olan ihtiyacı vurgulamıştır. TBC'nin epidemiyolojik yükünün azaltılmasına yönelik küresel hedefler, 2015 ve 2050 yılları için Binyıl Kalkınma Hedefleri (BKH) bağlamında ve ayrıca uluslararası çabaları koordine etmek için kurulan paydaşların küresel bir koalisyonu olan TBT Ortaklığı tarafından belirlenmiştir (Kutu 1) . DSÖ'nün bu hedeflere ulaşması için önerilen yaklaşım, aktif TB bulunan hastaların tanı ve tedavisinde en iyi uygulamaları, büyük epidemiyolojik ve sistem zorluklarını gidermeye yönelik yaklaşımları ve araştırmaların desteklenmesini içeren TB Stratejisini Durdurma (Raviglione and Uplekar 2006) dur. Yenilikler (Kutu 2). 2006'da başlatılmış ve küresel hedeflere ulaşmak için kapsamlı ve bütçelenmiş bir plan olan Global Plan 2011-2015'in temelini oluşturmaktadır (Raviglione 2006b; 2007; Korenromp ve diğerleri 2012). KUTU 1. Hedefler, HEDEF ve TBC KONTROLÜ GÖSTERGELERİ Binyıl Kalkınma Hedefleri'nde Sağlık Hedef 6: HIV / Hedef 6c : Sıtma ve diğer önemli hastalıkların görülme sıklığını durdurun ve başlatın

TB ile ilişkili insidans, yaygınlık ve ölüm oranları Gösterge 6.10 : : : DOTS kapsamında tespit edilen ve tedavi edilen tBC vakalarının oranı TB Ortaklığı Hedeflerini Durdurun 2005'e kadar : Balgam yayma pozitif TB hastalarının en az% 70'inde teşhis konulacak (DOTS stratejisi altında) ve en az% 85'i başarıyla tedavi edilecektir. En az% 70'lik bir vaka tespit oranı hedefi ve en …

Devamını Oku »

GM, Honda 2020 için uygun yakıt hücresi teknolojisi üzerinde çalışıyor

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Gürkan Uygun Kimdir? Gürkan Uygun Nereli Kaç Yaşındadır?

Gürkan Uygun Kimdir? Gürcü asıllı olan Gürkan Uygun 27 Mayıs 1974 İzmit doğumludur. Kariyerinde tiyatro, dizi ve film oyunculuğu için uygun olan tiyatro ile tanışması lise yıllarına dayanmaktadır. Lise yıllarına, amatör tiyatroyla ilgilenerek oyunculuk sevgi ve ilgisini belli etmiştir. Dormen Tiyatrosu'nda profesyonel oyunculuk için eğitim bölgesi Uygun'un televizyon dizisi oyunculuğu kariyeri 1996 yılında Tatlı Kaçıklar'ın dizini başlamıştır. Devamında, Böyle mi …

Devamını Oku »

Uygun fiyatlı abiye modelleri | Hanimefendi.com

01 Temmuz 2014 Güzellik, Moda 2,241 defa okundu Özellikle yaz aylarında, sıcak hava ile gösteriliyor davetler, kadınların abiye elbise arayışı içine girmek neden olur. uygun fiyatlı abiye modelleri çok cazip bir hal alır. Binlerce model içerisinden kendi vücutla şekillendirin ve on renginize uydurduğunuz uygun fiyatlı abiyeler İle bakınız, kendinizi çok daha iyi ve mutlu hissedebilirsiniz. Onun yaşta kadının gardolabında bulunması …

Devamını Oku »

Modaya uygun bayanlar seçimi: Bob saç kesimleri | Kısa Saç Stilleri 2016 – 2017

Şık bayanlar arasında Bob saç kesimi giderek daha popüler hale geldi. Ayrıca herhangi bir kadının kendine uygun bir bob kesimi bulabilmesi çok yönlüdür. bob saç stilleri fikirleri size yeni ve taze görünmelerini sağlamak için ilham verebilir! 1. Beyzbol Şapkalı Bob Saç Stili Düz ve ince saçlı kadınlar bu görüntüden biraz ilham alabilir, bu bob saç kesimi hafif açılıdır ve beyzbol …

Devamını Oku »

Bsio'lara Uygun Tekrar Amaçlı Yarıyıl Tatil Ödevi

Açıklama BSİO lara uygun tekrarlanabilir-kısa 11 sayfa matematik ve türkçe ağırlıklı Bsio'lara Uygun Tekrar Amaçlı Yarıyıl Tatil Ödevi dosyası, 4. Sınıf Yarıyıl Tatil Ödevleri bölümünde bulunmaktadır. Bsio'lara Uygun Tekrar Amaçlı Yarıyıl Tatil Ödevi Eğitimhane, Bsio'lara Uygun Tekrar Amaçlı Yarıyıl Tatil Ödevi indir. Kaynak

Devamını Oku »