25 Kasım 2017,Cumartesi
Anasayfa » Tag Archives: Son

Tag Archives: Son

Coğrafya Bölümü, Cambridge »Son haberler

# CCRU aşağıya iniyor 17 Kasım 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public lecture, …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Memorial Konferans Dizisi 2017'yi Dolduruyor: AbdouMaliq Simone AbdouMaliq Simone "border =" 0 "/> Smuts Anıtı Ders Sekansı Serisi 2017: Eski Abdulmaliq Simone Eski Ziyaretçi, AbdouMaliq Simone, Yaşar Olmaz: Kentsel Güneyin Hayat Sonrası başlıklı Smuts Anıtı Ders Seri Dizisinin ilk setini verecek. Üç ders, 7 Aralık, 9-13 Kasım tarihlerinde saat 15: 15'de Coğrafya Büyük Konferans Tiyatrosunda yapılacak. Birtakım şehirlerden örnekler …

Devamını Oku »

Shamayeta Bhattacharya, son NESTVAL toplantısında öğrenci kağıt ödülü aldı

Yakınlarda NESTVAL öğrenci kağıt yarışmasında 2 ve ligi kazanan Shamayeta Bhattacharya'yı tebrik ediyoruz. Makalesi başlıklı: Turistin algısına dayanılarak plaj yürünebilirlik konseptini keşfetmek ve operasyonelleştirmek: Doğu Midnapore plajlarında yapılan ampirik bir çalışma Kaynak

Devamını Oku »

Genişletilmiş Son Başvuru Tarihi: RSSAC Kurumsal Dergisi için Teklif İsteme

Son Sunucu Kök Sunucu Sistemi Danışma Komitesi (RSSAC) Bağımsız Gözden Geçirme Önerisi isteği için uzatıldı. yeni son başvuru tarihi 24 Temmuz 2017, saat 12:00 PDT . Atanmış İsimler ve Numaralar İnternet Kurumu (ICANN), Kök Sunucu Sistemi Danışma Komitesinin (RSSAC) bağımsız bir değerlendirmesini yapmak için bir sağlayıcı arıyor. Sağlayıcı alan adı veya İnternet sunucusu operasyonları konusunda teknik bilgiye sahip olmalı veya …

Devamını Oku »

Son Denuvo engeli aşılanmış – ShiftDelete.Net

Denvo maalesef geçtiğimiz aylarda 3DM tarafından başarıyla kırılmıştı. Anti-tamper sistem olan Denuvo bu kırılmanın yönetiminde birçok oyun koruyamamış ve korsan sürümlerinin yayınlanmasına engel oluyor olamamıştı. Deep Silver tarafından pazaraya sunulan Evden Saha: Devrim oyun oynamıştır yeni bir güncelleme ile bütün Denuvo sistemini oyunlarından kaldırmıştı. Buna Denuvo 'nun sisteme göre zarar verdiği birisi olarak, yoksa firmanın korunması başarısızlığı yüzünden imzalanan anlaşmanın …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Son Bobları Dahil Zihin Üfleme Kısa Saç Modeli Fikirleri | Kısa Saç Stilleri 2016 – 2017

Kısa saç, her yaştan kadınlar için en popüler saç stilidir. Onlar cesur, şık ve zahmetsizce modern. Günümüz galerisi, kısa saçlı saç fırçaları için akıl karıştırıcı fikirleri görmek isteyen kadınlara ayrılmıştır, lütfen bu resimlere bir göz atın ve saç stilistinize en sevdiğiniz şeyi göstermeyi unutmayın! 1. Sarışın Kısa Bob Saç Stilleri Körelmiş, parlak sarışın bob saç stili kalın saçlı kadınlar için …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Coğrafya Departmanında Cambridge'i Deneyin 30 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public …

Devamını Oku »

ÇKP'deki son gelişmeler …

Acta Crystallogr D Struct Biol. 2017 1 Haziran; 73 (Pt 6): 469-477. a Bilimsel Bilgisayar Bölümü, Bilim ve Teknoloji Tesisleri Konseyi, Harwell'deki Araştırma Kompleksi, Didcot Konferans ÇKP-EM Bahar Sempozyumu Bildirileri Alınan 2017 14 Mayıs; Kabul Edildi 2017 26 Mayıs. Bu, Creative Commons Atıfı (CC-BY) Lisansı'nın koşulları altında dağıtılmış ve aşağıdakilerle sınırsız kullanım, dağıtım ve çoğaltmaya izin veren açık erişimli bir …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

Cambridge araştırması, dünyayı dokuz milyar nüfusu idame ettirmek için nasıl yardımcı olabilir? 28 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Cambridge araştırmacıları iklim değişikliğini 900 yıldır haritalıyor The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Coğrafya Günü: Rezervasyonlar açık! 19 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Coğrafya Günü: Rezervasyonlar açık! 19 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Coğrafya Bilimi Laboratuarları, Platinum NUS Yeşil Etki ödülünü kazandı 16 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in …

Devamını Oku »

Tarihte bugün: Türkçe ezan zulmüne son verildi | Tarihte bugün |

     Dünya Bülteni – Tarih Servisi GÜNÜN OLAYI 18 Yıllık English Ezan Uygulamasına Son Verildi (1950) İlk defa Yusuf Hikmet Bayur başkanlığındaki Millet Partisi icek özgürlüğünü savunmuştur. 1950 yılında iktidara gelen Demokrat Parti 16 Haziran 1950'de çıkardığı bir kanunla Türkçe ezan okunmasını zorunlu kılan kanunu ortadan kaldırmıştır. Böylece Müslüman Türk halkının 18 yıllık özlemi bitmiş oldu. GÜNÜN ÖNEMLİ OLAYLARI Osmanlı …

Devamını Oku »

Son dakika … Sisi'den skandal öneri! 'Türkiye'ye …

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir reklam. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

Tephrokronolojide yeni gelişmeler 14 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public lecture, a …

Devamını Oku »

Dünyanın en güzel çocuğunun son hali

                     2017-06-13 21:03:00                                                                      Thylane Blondeau, 'Dünyanın en güzel kız çocuğu' olarak anılıyordu. 2000'li yılların ortalarından beri internette dolaşıyor. Blondeau da zaten 2001 doğumlu. Blondeau artık 16 yaşında. 2016'da "Dünyanın En Güzel Yüz Yüzü" listesinde yer aldı. 4 yaşındayken dünyanın en önemli tasarımcılarının defilelerine çıkmıştı. Gelecekteki Büyük Şarkı Sözleri.                      6                      0                      0                      …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Amerika'nın aşınan kenarları: tarladan hikayeler 12 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a …

Devamını Oku »

Dokulu Stil için Son Kısa Saç Kesimler | Kısa Saç Stilleri 2016 – 2017

Eğer saçınıza biraz ekstra stil ve doku isterseniz saçınıza güzel bir doku katacak bu muhteşem dağınık katmanlı saç modellerini deneyin. Aşağıdaki galeride muhteşem bob saç kesimi var ve hemen seveceksin pixie kesiyor. 1. En Kısa Saç Dökülmüş Saç Stil Mavi tonları olan pastel gümüş rengi dalgalı uçları ve dalgaları olan bu bob üzerinde kesinlikle muhteşem görünüyor Kaynak 2. Kısa Dalgalı …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Araştırmalar ortaçağ Batı Sibirya köyünü ilk kez doğru bir şekilde tarihlendiriyor 9 Haziran, 2017 Çevresel Sistemler Analizi Profesörü Ulf Buentgen'in yer aldığı bir ekip tarafından Dendochronologica 'de yayınlanan yeni araştırmalar, ilk kez Rusya'nın Kuzey Sibirya'sında bir ortaçağ yerleşimini tarihledi. Buchta Nakhodka yerleşimi Batı Sibirya'nın kuzey kesiminde bulunan ve tamamen kazılan arkeolojik alan. Ekip dendrokronolojik (ağaç halkası analizi) tekniğini uygulayarak …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# İngiltere'nin jeolojik çıkışının arkasındaki gerçek hikaye 8 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Natura Urbana, Alman Biyolojik Çeşitlilik Film Ödülüne aday gösterildi 8 Haziran, 2017 Natura Urbana'nın NaturVision Film Festivalinde Alman Biyolojik Çeşitlilik Film Ödülüne aday gösterilen film olan Profesör Matthew Gandy'yi tebrik ediyoruz. 'Natura Urbana', Profesör Gandy'nin ERC tarafından finanse edilen Urban Nature Rethinking projesinin bir bölümünü oluşturur. # Monako'nun II. Prens Albert SPRI'nin himayesine yükseldi 7 Haziran 2017 The Department …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Natura Urbana, Alman Biyolojik Çeşitlilik Film Ödülüne aday gösterildi 8 Haziran, 2017 Natura Urbana'nın NaturVision Film Festivalinde Alman Biyolojik Çeşitlilik Film Ödülüne aday gösterilen film olan Profesör Matthew Gandy'yi tebrik ediyoruz. 'Natura Urbana', Profesör Gandy'nin ERC tarafından finanse edilen Urban Nature Rethinking projesinin bir bölümünü oluşturur. # Monako'nun II. Prens Albert SPRI'nin himayesine yükseldi 7 Haziran 2017 The Department …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Üniversiteler yeni bir bilime hazır mı? 7 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Üniversiteler yeni bir bilim dalında hazır mısınız? 7 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, …

Devamını Oku »

Son Empire-Savaş Z v1.0.138 Android APK indir

Yazar: Gökhan Öğütcü Kategori: Android Strateji Oyunları, Android Zombi Oyunları 6 Haziran 2017 1.066 Görüntülenme Son İmparatorluk Savaşı Z-Android-resim "width =" 300 "height =" 300 "/> Son Empire Savaşı Z v1.0.138 Android APK indir Kıyamet günü yaklaşıyor ve zombiler insanların bu korkularından faydalanıp baskın yapmaya çalışacaklar. Siz hayatta kalmış insanlara öncülü edip onları da arkanıza alarak zombilerle mücadele etmeye başlayacaksınız. …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Modern İçki Atılımında Nasıl Savaşır 6 Haziran 2017 Üniversite öğretim görevlisi Dr. David Beckingham Liverpool Üniversitesi Basın tarafından 'Lisanslı Şehir: Liverpool'da İçki Düzenleme 1830-1920' adlı yeni kitabı ile röportaj yapıyor. On dokuzuncu yüzyıl İngiltere'sinde birkaç şehir, kaydedilen sarhoşluk yüzünden Liverpool ile yarışabilirdi. Liverpool'un imparatorluk etkisinde yaşanan sivil toplum gururu, şehrin sokaklarındaki mezhep huzursuzluğundan ve fahişelikten gecekondu bölgelerinde çocuk ihmaline …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Cambridge Coğrafyacısı nükleer risk hakkında konuşuyor 2 Haziran 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving …

Devamını Oku »

Hyundai Kona Temelde Son Teaser Images'da Ortaya Çıktı »AutoGuide.com News

Hyundai'nin yeni geçidi, 12 Haziran'da resmen başlayacak, oysa bu teaser görüntüleri aslında hepsini uzak tutuyor. Hyundai, Kona için yeni oyunculardan ve Kore otomobil şirketine göre "Hyundai'nin yeni tasarım kimliğini sürdürüyor ve kompakt SUV segmentinde eşsiz bir öneri oluşturmak için ilerici bir karakter ve en yeni teknolojiler sunuyor" dedi. Ön uç cüretkar ve Jeep Cherokee'de bulunana benzer şekilde ince farlar içeriyor. …

Devamını Oku »

İstanbul boğazından son dev gemi ….

                     2017-05-31 13:36:00                                                              İstanbul boğazından bu sabah 445 metrelik dev kablo döşeme gemisi geçti … Kaynak: sözcü.com.tr                                           0                      0                      0                                                                                                                                       Kaynak

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Fırtınalı Jeomorfoloji: yeni EGU blogu Fırtınalı Jeomorfoloji: Yeni EGU blogu "border =" 0 "align =" right "class =" shiftup "/> Yeni Fırtına Günlüğü blogu" border = "0" align = "0x0000" James Tempest, Dr Iris Moeller ve Prof Tom Spencer'ın da bulunduğu bir ekip tarafından Avrupa Jeosciences Birliği blogunda yayınlanan yeni bir yazı, aşırı fırtına ve sel olaylarıyla sel riski …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Fırtınalı Jeomorfoloji: yeni EGU blogu Fırtınalı Jeomorfoloji: Yeni EGU blogu "border =" 0 "align =" right "class =" shiftup "/> Yeni Fırtına Günlüğü blogu" border = "0" align = "0x0000" James Tempest, Dr Iris Moeller ve Prof Tom Spencer'ın da bulunduğu bir ekip tarafından Avrupa Jeosciences Birliği blogunda yayınlanan yeni bir yazı, aşırı fırtına ve sel olaylarıyla sel riski …

Devamını Oku »

'Cesur ve Güzel'in son tarihi belli oldu

                     2017-05-29 09:27:00                                                                      Kıvanç Tatlıtuğ ve Tuba Büyüküstün'ün rolü aldı 'Cesur ve Güzel' dizisinin final tarihi belli oldu. Ay Yapımında Star TV'de ekranlara gelen Cesur ve Güzel 22 Haziran'da final bölümüyle ekrana gelecek.                      0                      0                      0                                                                                                                                                      Kaynak

Devamını Oku »

En son trafik lambası uygulaması için yeşil ışık yok …

                                                                                                          Psikolog Dr Kyle Wilson, benzer araçların "bağlı araçlara" sokulması planlanmadan önce yeni bir araç trafik lambası uygulamasına 'insan bakışı' getiriyor Kredi: University of Huddersfield      Sat-nav'dan otomatik park etme ve çarpışma önleme sistemlerine – otomobiller, insan hatası kapsamını azaltmak için tasarlanan artan elektronik bir dizi dizi ile donatılmıştır. Kitin en yeni modellerinden biri, trafik …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Esnek şehirler: yeni film 25 Mayıs 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, giving a public …

Devamını Oku »

Alluring Styles için 30+ Son Katmanlı Saç Kesimi Resimleri | Kısa Saç Stilleri 2016 – 2017

Katmanlar, kısa saç kesiminin stilini belirler; saç tipinize ve yüz şeklinize uyacak bir katman seçmeniz çok önemlidir. 1. Son Katmanlı Sarışın Saçlar Kabartmalı katmanlı açılı sarışın bob saç ince saçlı kadınlar için mükemmel. Kaynak 2. Kısa Katmanlı Saç Kestirme

Devamını Oku »

Sıvı helyum yok, ama yine de son derece havalı

                                                                                            Sae Woo Nam (solda) ve Vincent Kotsubo yeni kriyo soğutucusunun prototipini inceliyorlar. Kredi: Ulusal Standartlar ve Teknoloji Enstitüsü      NIST bilim insanları, daha önce gösterilenlerden çok daha küçük, birçok ileri teknoloji araştırma için süperiletken nanotel tekli foton dedektörlerini (SNSPD) soğutmak için yeni bir hibrid sistem geliştirdiler Sıvı helyum gibi klasik kriyojenlerin gereğini ortadan kaldırır.                                                                          …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Kamchatkan volkanik külü dünyayı yarı yarıya dolaştı 24 Mayıs 2017 The Department of Geography is committed to bringing internationally renowned scholars to Cambridge, under our Distinguished Visitors Scheme. Our most recent guest was Professor Don Mitchell of the Maxwell School of Citizenship and Public Affairs at Syracuse University, who came to Cambridge for the first time in his career, …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Coğrafya Gümüş Yeşil Etki Ödülü'ne layık görüldü 23 Mayıs, 2017 Coğrafya Gümüş Yeşil Darbe Ödülü'ne layık "border =" 0 "align =" right "class =" shiftup "/> Coğrafya Bölümü, Gümüş NUS Yeşil Etki Ödülü aldı. Coğrafya Yeşil Etki Ekibi, dış denetçiler tarafından gözden geçirilen, yeşil eylemler için hazırlanan bir ısmarlama çalışma kitabını tamamlamak için çok çalıştı. Departmanın üzerinde değerlendirilen kategoriler …

Devamını Oku »

MESSENGER'in son gelişmeleri arasında 3 boyutlu navigasyon aracı …

                                                                                                          Merkür etrafındaki yörüngedeki MESSENGER uzay aracının sanatçı tasvirleri. Kredi: NASA / JHU / APL      NASA'nın Mercury'ye olan MESSENGER görevi, Caloris darboğazının bu "çarpık etrafında" görünümü ile gösterildiği gibi, yeni 3 Boyutlu navigasyon özelliklerine sahip güncellenmiş bir ACT-QuickMap aracını piyasaya sürdü. Bu güncelleme, tüm ABD gezegen misyon verilerini arşivleyen ve dağıtan ajansın Gezegen Veri …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Avrupa Birliği ve Disunion: film 19 Mayıs 2017 Avrupa Birliği ve Disunion: "border =" 0 "align =" right "class =" shiftup "/> Bölüm Başkanlığı ve 1931 Profesör Coğrafya Profesörü Ash Amin, British Academy'nin "Avrupa Birliği ve Uyuşmazlık" konulu yeni bir filminde yer almaktadır. Film, İngiliz Academy'de düzenlenen ve Kasım 2016'da Prof Amin'in başkanlığında, farklı zamanlarda Avrupa'nın hayal ve işleyişine …

Devamını Oku »

Ve son olarak, mürşit, ince ince bir hologram … S …

                                                   'Dünyanın en ince hologramı boffins tarafından hükmetti                                               Not: Bu bir hologramın sahte bir görüntüsüdür                                                                                                        Bir grup bilimadamı "dünyanın en ince hologramını" geliştirdi; insan saçlarından bin kat daha ince, iddia ediyorlar.                  Hologramlar, lazer ışıklarının etkileşimiyle yaratılan üç boyutlu görüntülerdir ve merceklerden oluşturulmuş görüntülerden daha fazla derinlik kazanmış görünürler. …

Devamını Oku »

Transformers 5: Son Şövalye için yeni fragman!

Transformers serisi, Transformers 5: Son Şövalye filmiyle devam ediyor. Merakla beklenen film için bugün, nispeten daha detaylı yeni bir fragman yayınlandı. Transformers 5 için yeni fragman! Farklı ipucu barındıran, efsane Michael Bay 'da Yönetmenliğindeki Transformers 5: Son Şövalye filminin yeni fragmanını, Türkçe Altyazılı olarak aşağıdan izleyebilirsiniz. Büyüteç eskisine nazaran ( parçluğp tekrar birleşebilme gibi ) çok parçalanmış fragman uzun boylu …

Devamını Oku »

Son Otomobil 3 Trailer, Yıldırımda Parlayan Işın McQueen'in Yeni Rakibi »AutoGuide.com

Son Otomobil 3 Trailer Yıldızı Parlatıyor McQueen'in Yeni Rakibi »AutoGuide.com News <! – – [     Otomobil Haberleri En Son Otomobil 3 Fragmanı, Yıldırım McQueen'in Yeni Rakibi                                 AutoGuide.com'u Gelen Kutunuza Alın                                AutoGuide.com'da Facebook gibi                                 Adı Jackson Storm ve yeni nesil yarış otomobillerini sunuyor. 16 Haziran'da Sinema salonlarına varmak, Cars 3 …

Devamını Oku »

Son zamanlarda beni ikna etmekte olan 21 Şey

@hellomikee 1. Bu hafta bir kuzenin annesiyle yapacağım söylenmeden gerçek para ile bir mezuniyet kartı gönderdim. 2. Annemin gün hediyelerini zamanında postayla aldım. 3. Parke zeminler için uzmanlaşmış bir vakum aldım. İki yıl boyunca ahşap döşemelerle evimde oturdum. 4 Geri dönüşümümü bir kez değil de son bir haftada iki kez çıkardım. 5. Ayrıca dün, yeni kapüşonumda barbekü sos bulunduğunda, sadece …

Devamını Oku »

Coğrafya Bölümü, Cambridge »Son haberler

# Suya Oy Verildi: Nepal Seçimleri 15 Mayıs 2017 Su için oylar: Nepal seçimleri "border =" 0 "align =" right "class =" shiftup "/> Department Research Associate Eszter Kovac ve fotoğrafçı Toby Smith, Nepal'de bulunuyor ve 20 yılda düzenlenen ilk yerel yönetim seçimlerini belgeliyor. Seçimleri ve Nepal siyasetinde suyun artan rolünü araştıran bu fotoğraf makinesini ürettiler. Devamını oku … # …

Devamını Oku »

Motorola Moto X4 modellerinden son model

Motorola tarafından Moto X serisinin tekrar geçirilmesi isteye bilinirken, şimdiye kadarki iddialar tek model üzerinde yoğunlaşıyordu. Öte yandan oğlu haberlere bakılırsa ikilamaz üç modelden bahsediliyor . Moto X4 Çal ve Moto X4 Stil geliyor Şimdiye kadar Motorola Moto X (2017) adıyla çıkması beklenen modellerin, Moto X4 serisi adı altında çıkacağı vurgulanıyor. Evan Blass (@evleaks) tarafından paylaşıldı. ve Moto X4 Stil …

Devamını Oku »

Son 10 yılda yaşanan büyük siber saldırılar

                                                                                                          12 Mayıs 2007'de meydana gelen saldırı dalgası İngiltere'nin sağlık servisine, Rusya'nın içişleri bakanlığına ve Fransız otomobil üreticisi Renault'a ve dünyanın birçok başka organizasyonuna çarptı      Dünyanın dört bir yanındaki çok çeşitli organizasyon ve şirketler, AB kolluk kuvvetleri tarafından "benzeri görülmemiş" olarak nitelendirilen WannaCry fidyeciliği siber saldırısından etkileniyor.                                                                                 "cyberwar" den "hacktivism" e …

Devamını Oku »