26 Eylül 2017,Salı
Anasayfa » Tag Archives: sahip

Tag Archives: sahip

Ölen manyetik alana sahip yabancılar 'lav lambası' …

                                                   Antik Ay, uzay dinamolojisi çalışmasında hayati ipucu taşır                                                                                                                        Ay'ın sıvı çekirdeği manyetik bir alan oluşturmak için dinamo gibi hareket ediyordu … Illustration by Hernán Cañellas                                                Tarih öncesi ay kayaçlarını inceleyen bilim adamları, Ay'ın metalik göbeğinin kalbinde uzun süreli bir manyetik alan oluşturan lav lamba benzeri bir dinamo …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

En hızlı uluslar arası sahip 5 ülke!

İnternet çağımızda en büyük gereksinimlerinden birisi halini almışken, internet erişimi yok veya çok kısıtlı. Fakat bazı ülkeler internet hızlarıyla dünyanın en iyisi olmayı başarmışlar. Bağımsız bir araştırma şirketi tarafından yapılan çalışmaya göre 2017 yılında en yüksek internet hızı ortalamasına sahip olduğu ülkeler açıklandı. Birleşik Devletler İngiltere, Almanya ve Kanada gibi devletler bulunmuyor. Listenin en tepesinde Çin 'e bağı özel yönetim …

Devamını Oku »

Amiloide Yapısal Değişiklik … Aβ fibril polimorfizminin AD'nin klinik ve patolojik özelliklerinde değişikliklerle ilişkili olabileceğine dair kanıtlar şunları içerir: (i) Farklı molekül yapılarına sahip Aβ40 fibrilleri, primerde farklı toksisite seviyeleri sergiler Nöronal hücre kültürleri 1 ; (Ii) Harici amiloid içeren biyolojik materyal tarafından indüklenen, transjenik farelerde amiloid biriktirme şekilleri, bu maddenin kaynağına göre değişir 13,14 ; (Iii) Transgenik farelerde sentetik Aβ42 fibrilleri ile indüklenen amiloid plaklarının boyutu ve bileşimi, bu fibrillerin morfolojisi ve büyüme koşullarına bağlıdır 15 ; (Iv) Aβ42 agregalarının beyin dokusunda kimyasal dağılımı ve direnci, hızla ilerleyen ve yavaş yavaş ilerleyen AD hastalarında farklılık göstermektedir. 16 AD'deki nörotoksik Aβ yapılarının yapılarının karakterizasyonu geliştirilmiş ve yapı ile Hastalık fenotipinin, patogenez hakkındaki anlayışımızda, uygun tanı ve terapötik biyolojik belirteçlerin gelişimine ve ilaç geliştirme üzerine önemli bir etkisi olacaktır. ssNMR'den gelen veriler, yapısal değişikliklere özellikle duyarlıdır ve iki boyutlu (2D ) 13 C- C ve N- 13 C ssNMR spektrumları, spesifik fibril polimorflarının "parmak izleri" olarak kullanılmaktadır. 1,4,20,21 ssNMR, miligram ölçekli miktarda izotopik olarak işaretlenmiş fibril gerektirdiğinden, beyin dokusunu tohum büyümesi ile büyüttüğü ve etiketlediği beyin dokusunun kaynağı olarak . . tarafından tanımlanan fibril tohumları Farklı suşların farklı hastalık süreleri ürettiği prion hastalıklarına benzer olarak, Ve hastalıkla ilişkili prion proteinlerinde konformasyonel farklılıklar ile ilişkilidir 17-19,22 görme işleminin bozulması ile ilişkili PCA-AD gibi olağandışı iki AD alt tipindeki hastalardan doku örnekleri seçtik. 23 ve n-dejenerasyonunun aylar içinde gerçekleştiği ve kliniksel olarak Creutzfeldt-Jakob hastalığına benzediği r-AD 24 Demans olmadan ölen üç kişi (ND) Otopside Aβ depolanması bulunduğu tespit edildi. Aβ40 ve Aβ42 fibrillerini, amiloidle zenginleştirilmiş korteks özlerinden tohumlanmış büyüme ile ayrı ayrı hazırladık. Tüm fibril numuneleri için transmisyon elektron mikroskopu (TEM) görüntüleri alındı. Tüm örnekler için ssNMR ölçümleri denendi, ancak bazı durumlarda sinyal / gürültü oranları 2D spektrumlarının edinimi veya müteakip analizi için yetersizdi. Doku örneklerini, hasta kategorilerini ve ssNMR ölçümlerini özetler. TEM görüntülerinin örnekleri ve 2D spektrumlarının tam setleri -. AD olmayan bir hastanın korteks özü ile kontrol deneyleri önemli Aβ depolanmasına sahip değildir Ek Tartışma ve

Beyin tohumlanmış Aβ42 fibrillerinin temsili TEM görüntüleri ve 2D ssNMR spektrumu

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Mühürlü yavrulara sahip olan benlik hayır

                                     ABD. Yetkililer ne kadar cazip olursa olsun, insanlara mühürlerle kendini kabul etmemesi konusunda uyarıyorlar.                                                                       Ulusal Okyanus ve Atmosfer İdaresi balıkçılık bürosu, New England'da mühür yavru mevsimi devam ettiğini ve bu, Insanlar Anma Günü hafta sonu boyunca plajda mühür yavruları görebileceği anlamına geliyor diyor. Fakat bir mühür yavrusunun kendine güvenli bir şekilde girmesini sağlayacak kadar uzun ömürlü çubuk …

Devamını Oku »

IPhone 6s çok sayı yeni özelliğe sahip LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/05/iphone-6s-cok-sayi-yeni-ozellige-sahip-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 11604', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/05/iphone-6s-cok-sayi-yeni-ozellige-sahip-letsgomobile.org"; Oy verme "id =" Artıtı “/> '+ sayfa [‘positive’] +'% '+ ' ' + sayfa [‘negative’] + '% ' + …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

Sürtünmesiz Brexit anlaşması İngiltere'de yatırımlar için kritik öneme sahip: Ford patronu

Ford'un Avrupa patronu İngiltere'nin Brezilya'yı takiben İngiltere'deki fabrikalarına yaptığı yatırımları engelleyebilecek "sınır sürtünmesine" karşı uyarıda bulundu – İngiltere'nin Avrupa Birliği'nden çıkacağı çıkış . Londra'daki Araç Zirvesi'nin Financial Times Geleceği'nde konuşan Jim Farley, motor fabrikalarını ve mühendislik tesislerini içeren Ford'un İngiltere altyapısının AB çevresinde malların taşınması zorlaşırsa "engel" edebileceğini söyledi. Ve hükümetlerden, gelecekte yapılacak olan serbest ticaret anlaşması müzakerelerinde herhangi bir …

Devamını Oku »

Soyutlanmış pluripotent kök hücre (iPSC) teknolojileri, erişilemeyen hasta hücre tiplerinin incelenmesini sağlarken, hücresel heterojenite, hücre kökenli heterojeniteye sahip olabilmekle birlikte, hücre kökenli heterojenite özelliklerine sahip olabilmektedir.

IPSC'den türetilen hücre çizgileri arasındaki gen ekspresyon profillerinin karşılaştırılmasını karıştırır. Burada, iPSC türevi insan dopaminerjik nöronlarını (DaNs) intrasellüler işaretleyici tirozin hidroksilaz kullanarak saflaştırdık. Saflaştırıldıktan sonra, iPSC'den türetilen DaN'lerin transkriptomik profilleri olgun post-mortem DaN'lardan elde edilen profillere oldukça benzer görünür. LRRK2 G2019S varyantlarını taşıyan Parkinson hastalığı (PD) hastalarından türetilen saflaştırılmış iPSC türevi DaN'ların profillerine, farklı alanlarda eksprese edilen (DE) genler arasında …

Devamını Oku »

Neden Mercedes Tesla'dan Daha İyi Kendi Kendine Sürüş Teknolojisine Sahip? »AutoGuide.com News

Mercedes-Benz uzun süredir kendinden tahrik sistemleri söz konusuysa, güncellenmiş S-Serisi'nin piyasaya sürülmesiyle korunmayı planladığı bir konumda. Mercedes, bu yılın ilerleyen saatlerinde piyasaya çıkacak olan büyük gövdeli sedan revize edilmiş versiyonunu "özerk sürüşün geleceğine doğru atacak bir adım daha atacak" dedi. Ve bu, zekice hazırlanmış halkla ilişkiler propagandası gibi görünse de – çoğunlukla öyleyse- şüphe etmek için hiçbir neden yok Geçen …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

'Müşteri her şeyin bir Ferrari'ye sahip olduğunu, bu utanç verici olduğunu'

Motor endüstrisinde 'kolay' ama çekici bir kariyer mi arıyorsunuz? Ardından en az altı rakama mal olan rüyalar satan bir işe başlamadan önce kendinize keskin bir kıyafet edin. Bu erkekler için pozisyonlar ve artan bir şekilde kadınlar supercar dünyasında yükselişte. New York City ve Los Angeles'taki göz alıcı, zengin alıcılar sayesinde – çünkü ABD yine de bunun gibi tekerlekler için en …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

Mink Mingle Sevdiğim birisi derinden beni çağırıyor. Kalbi kırıldığını söylüyor, bana geri kazanmaya çalıştığını söylüyor, ona ihtiyacı olan şeyi, nasıl güvenini kazanabileceğini, doğru şeyleri yapmak için neler yapabileceğini soruyor. Dinliyorum. Ona değerini hatırlatırım. Ve sonra sinirlenirim. Çünkü yardım edemem ama neden bu adamın bir milyon ve bir şeyi denemediğini merak ediyorum. Neden çiçeklerini almadı? Her sabah ve her gece ve hatta gün boyunca onu neden düşünüyor olduğunu göstermek için neden ona mesaj atmadı? Neden ona bir mektup yazmadığı ya da onu yemeğe götürmediği ya da en sevdiği şeker çubuğunu alıp çantasına sokmadığı ya da bir rölyefle rengarenk bir battaniye üzerinde sergileneceğini sorup durmadığını sordu. yıldızlar? Yoksa onu tekrar tekrar hatırlattı, nasıl berbat ettiğini ve onu kaybetmek istemediğini mi? Dinlediğimde, onu geri getirmek için sahip olabileceği bir milyon ve bir fırsattan geçtim, onun endişeli zihnini hafiflettiği söylenebilecek tüm sözleri, ona göstermek için yapabileceği tüm küçük şeyler Önemli olan, katlanarak, ona. Ağlıyor Diye bağırıyor bağırıyor. Neye ihtiyacı olduğunu söyledi, bana neden korktuğunu, nasıl incildiğini, kalbinin güvensizlikten ve kırılmasından nasıl acı çektiğini ve hiçbir şey yapmadığını söylediğini söyledi. Ona sadece ona ihtiyacı olan şeyi gösterebileceğini, kendisini sevmenin yollarını söyleyebileceğini istiyor olduğunu söyledi. Yardım edemem ama bunun yanlış olduğunu düşünüyorum. Çünkü bu adama onu nasıl seveceğini söylemek zorunda kalmamalı, işleri doğru yapmalı. Ona nasıl zarar verdiğini görmesine izin vermemeli, kırık olanı nasıl düzeltebileceğini ona göstermeliydi. Hiçbir şeyi açıklamak zorunda kalmamalı, çünkü onu sevilen biri olarak zaten biliyor olmalıydı. Sözünü dinlerken, kendi ilişkilerimi düşünüyorum. İlk aşkım olduğu için bana nasıl bakacağından emin olmadığı için ya da çok duygusal olduğum için, güvenime ne kazandığından emin olmadığı için ya da benim güvenimi kazandığımdan emin olmadığına inandığım insanlardan bahsediyorum. Hassas ve inatçı olduğum için sevmeyi zorladım. Mazeretlerim var. Aklıma getirdim. Sorun olduğunu düşündüm. Ben, çok fazla kaleyi seven, o adamların beni nasıl seveceğini bilmediğini sanıyordum. Fakat birileri seni seviyorsa seni seveceklerdir. İhtiyacınız olan her şekilde sizi seveceklerdir. Nasıl yapacaklarını bildikleri her şekilde seveceklerdir. Seni sevecekler ve bu sevgiyi defalarca kanıtlayacaklar, çünkü seni kaybetmek istemiyorlar. Gerçek aşk bu. Hepimiz kusuruz, ama birisi gerçekten mahvederse, onu doğru yapmak için her şeyi yapıyor olacaklar. Beklentileri çok yüksek tuttuğunuza inanmak için sizi suçlamaya çalışmazlar. Senaryoyu ters çevirmezler ve sadece zaman çizelgesinde onları bağışlamadığınız için yanıltıcı olanınız gibi davranırlar. Onları kol uzunluğunda tutmak için kendinizi kötü hissettirmezler, çünkü hala inciniyorsunuz. İhtiyacınız olduğunu düşündükleri ya da ne istediklerini algılarlarıyla eşleşmediğinden, ihtiyacınız olan şeyi görmezden gelmeyeceklerdir. Sorunlar olduğunda bir arka koltuk almayacaklar ve onlarla nasıl başa çıkılacağına dair ipucu olmayacak. Bakın, biri sizi sevdiğinde ne yapılacağı söylenemez. Nasýl bakým, nasýl hazineden geçirileceði, kayıp zamanın veya bencil eylemlerin telafi edileceği konularında söylenecekleri yoktur. Seni öpmek, nasıl tutmak, özür dilemek ya da takdir etmek ya da istediğini hissettirmek gibi neden söylenmesi gerekmiyor. Seni seven biri seni gerçekten seviyor, seni düzeltmek için elinden geleni yapıyorlar, ne yaparsan yap, elinden geleni yapabileceklerinden emin olman için elinden geleni yapıyorlar. Sana neye ihtiyaç duyduğunu özel olarak anlatmamalarını istiyorlar. Adım adım açıklamanı beklemeyecekler. Hayır, her zaman doğru yolu bulamıyor olabilirler, ancak


Devamını Oku »

Sürpriz! Lotus, bir başka sınırlı sayıda baskıya sahip bizi alçalttı Exige Sahip olamayacağız »AutoGuide.com News

Sadece 60 ünite ile sınırlı olan Lotus Exige Cup 380, Kuzey Amerika'ya gelmeyen bir başka spor otomobilidir. İngiliz otomobil üreticisi, spor otomobillerinden ağırlığı kesmenin yollarını bulmaya devam ediyor ve bu Exige Cup 380, terazileri 2,330 pound (1.057 kilogram) kuru olarak öneriyor. Exige Sport 380 modeline dayanılarak aynı 3.5 litrelik süperşarjlı V6 motoru 375 beygir gücü ve 302 pound feetlik tork …

Devamını Oku »

Vurulan köpeğe belediye sahip çıktı

                     2017-04-23 11:16:00                                           Samsun'un Terme İlçe Belediyesi, kimliği belirsiz bir kişi tarafından tüfekle vurulan yaralı sokak köpeğine, çıktı çıktı. Terme İlçesi Bazlamaç Mahallesi'nde sokak köpeği, kimliği belirsiz bir kişi tarafından tüfekle vuruldu. Bir vatandaşın ihbarı üzerine Terme Belediyesi ekipleri, sokak köpeğine sahip çıktı. Ekipler, Büyükşehir Belediyesi'ne bağlı yaralı köpeği Sokak Hayvanları Rehabilitasyon Merkezi'ne götürdü. Köpeğin ciddi yaralar ve …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

2018 Cadillac CT6, 'Gerçek Eller-Serbest Sürüşe Sahip Olma Sözü "» AutoGuide.com News

Cadillac, "Süper Cruise" un otoyol için endüstrinin ilk hands-free sürüş teknolojisi olduğunu ve çok yakında piyasaya çıkacağını söylüyor. Bazı Tesla sahipleri karayolu üzerinde eller serbest sürüş teknolojisi olarak Autopilot'u kullanma özgürlüğünü elinden almışken, Autopilot'un eller serbest bırakılması amaçlanmamıştır. Cadillac, bununla birlikte, süper Cruise'ın iki ileri teknoloji sistemi kullandığını övünmekte – bir sürücü dikkat sistemi ve hassas LiDAR harita verileri – …

Devamını Oku »

Lotus, klasik F1 ilham verici Evora Sport 410 GP Edition'ı ortaya çıkarıyor Lotus, başka bir özel baskı Evora Sport 410'u ortaya çıkardı ve markanın diğer özel sürümleri gibi, müşterilerin firmanın 'Exclusive 'Bitirme programı ve şirketin zengin geçmişi. • En iyi spor araba satışı 2017 Evora Sport 410 GP Edition olarak adlandırılan bu, Lotus'nun en başarılı Formula 1 otomobillerinden bazılarını hatırlatan bir renk şemasına sahip Kuzey Amerika pazarında yeni özel bir baskı otomobilidir. Altın kapaklı klasik siyah kaplama, 1972'den 1986'ya kadar Formula 1'de Team Lotus'un kullandığı renk şemasıydı. Dövme alüminyum jantlar altın renkli özelliklere sahipken, kabin içinde altın kontrast dikiş siyah Deri.      Başka yerde, araba değişmedi. Evora Sport 410, firmanın en güçlü otomobili ve 410 bhp'lik bir süper yüklü 3.5 litrelik V6 kullanıyor. Bol miktarda karbon fiber parça ve ağırlık azaltma tekniği sayesinde 1.370kg kuru ağırlık ile birleştirildiğinde, dört saniyede 0-62mph ve 190mph'lik en üst hızda iyi olur. Evora Sport 410, üretim sayıları bakımından sınırlıdır – Lotus, global sürüm için yılda 150 kere yapar. ABD'de standart araba fiyatı 104.200 $ 'dan (83.700 £), siyah ve altın renkli GP baskısı ise 110.000 ABD Dolarından (£ 88.500) fiyatlandırılacak.      Bu yılın başlarında, Lotus bir kezlik bir Evora Sport 410'u, The Lovely Me olan The Spy'de James Bond'un yönlendirdiği Esprit S1'e verdiklerini açıkladı. GP Edition'ın gelişiyle, Lotus'un esin kaynağı olan Evoras'ın gelecekte gelebileceği anlamına gelebilir.

GP Edition Evora Sport 410'u Esprit S1'den esinlenerek tercih ediyor musunuz? Yorumları bize bildirin! Kaynak

Devamını Oku »

2017 Honda Accord Hybrid i'de en iyi seyahat yelpazesine sahip …

                                                                                                          American Honda Motor Co., Inc. tarafından sağlanan bu fotoğraf, 2017 Honda Accord Hybrid'ini gösteriyor. Honda'nın Accord Hybrid, sınıfının en yakıt tasarruflu benzinli-elektrikli hibrid dört kapılı otomobil olan geniş, konforlu, orta boy bir sedan olarak 2017'ye döndü. (American Honda Motor Co., Inc.'den AP yoluyla)      Honda'nın Accord Hybrid, sınıfında en yakıt tasarruflu benzinli-elektrikli hibrid dört …

Devamını Oku »

İşte Cumhurbaşkanı Trump'ın Ferrarı'na Sahip Olma şansınız »AutoGuide.com News

Bir zamanlar Başkan Trump'a ait Ferrari F430 bugün açık arttırma blokunu aşıyor. 2007 Ferrari F430, Auctions America etkinliğine başlamadan önce şu anda Fort Lauderdale, Florida'daki bir kongre merkezinde sergilenmektedir. Egzotik 250,000 ila 350,000 dolar arasında yükselmesi bekleniyor. Trump, kişisel kullanım için yeni olan F430 markasını satın aldı ve kilometre sayacında 2,400 mil açılarak dört yılı aşkın zamana sahipti. O zamandan …

Devamını Oku »

PSA'nın Opel'i satın alması, Avrupa otomobil endüstrisini sarsma gücüne sahip

OTOMOTİV HABERLERİ AVRUPA AYLIK DERGİ PSA CEO'su Carlos Tavares, yılın en büyük otomobil anlaşmasını tamamladıktan sonra GM CEO'su Mary Barra ile el sıkıştı. Fotoğraf kredi: Reuters PSA Grubunun General Motors'tan Opel / Vauxhall'u satın almasını sağlamaya çalışan insanlar için zorlu çalışma şimdi otomobil endüstrisinin yılın anlaşması üzerine çöktü. PSA-Opel'in büyük değişiklikler yaptığı Fransa ve Almanya'da ve Avrupa'daki otomotiv sektöründe şok …

Devamını Oku »

PSA'nın Opel'i satın alması, Avrupa otomobil endüstrisini sarsma gücüne sahip

OTOMOTİV HABERLERİ AVRUPA AYLIK DERGİ PSA CEO'su Carlos Tavares, yılın en büyük otomobil anlaşmasını tamamladıktan sonra GM CEO'su Mary Barra ile el sıkıştı. Fotoğraf kredi: Reuters PSA Grubunun General Motors'tan Opel / Vauxhall'u satın almasını sağlamaya çalışan insanlar için zorlu çalışma şimdi otomobil endüstrisinin yılın anlaşması üzerine çöktü. PSA-Opel'in büyük değişiklikler yaptığı Fransa ve Almanya'da ve Avrupa'daki otomotiv sektöründe şok …

Devamını Oku »

2018 Ford Mustangı Sevimli / Kitschy Yeni Özelliğe Sahip »AutoGuide.com News

Mustang'ın yeni başlatma düğmesi, dinlendirici bir midilliğin kalbi gibi dakikada 30 kez atıyor. 2018 Ford Mustang'da değişen çok şey var ve küçük yeni özelliklerden biri, kapı kilidi açıldığında kırmızı renk atan bir ateşleme düğmesidir. Motor çalışıncaya kadar darbeli olmaya devam ediyor ve Ford, Mustang'a bir çeşit kalp atışı vermek gibi bir şey olduğunu söylüyor. Amerikalı otomobil üreticisi aynı zamanda midillinin …

Devamını Oku »

Hassas Hâle Sahip Olmak Gerçekten En Büyük Adam Olur …

@ Lesia.Valentain Ben Bir Kanser'im. Ve hastalık anlamına gelmez, yani astrolojik işareti ifade eder. Ben bir kanserim. Duygusal, sezgisel ve hassasım. Başka bir deyişle, ben şeyleri önemsiyorum. Çok. Komik olan, "hassas" kelimenin Kanser'in iyi ve kötü nitelikleri altında listelenmesidir. Astroloji-Insight'a göre, sevgi dolu ve duygusal, kurnaz ve ihtiyatlıyım, hassas ve besleyici. Fakat kapak tarafında, ben de kararsız ve duygusal, aşırı …

Devamını Oku »

Danimarka, en iyi iş-yaşam dengesine sahip. Peki neden?

OECD Better Life raporuna göre; Danimarkalılar'ın iş-yaşam dengesi rapordaki diğer ülkelerden daha iyi durumda. Raporda yerinde ülkelerin uzun çalışma saatleri olan çalışanları, toplam çalışanların% 13'ünü kapsıyor; Danimarka'da bu oran,% 2'ye düşmüş durumda. Danimarkalılar günün 16 saatinde boş zaman geçirmek, uyumak ve yemek yemek için harcıyorlar. Danimarkalılar; Raporda çevreel kalite, sivil katılım, eğitim, vasıflar, iş sektörü, kazanç, refah, kişisel güvenlik ve …

Devamını Oku »

ABD Yollarında Unfixed Recall'a Sahip Milyonlarca Araç Var »AutoGuide.com News

Anılarını geri çağırmadan gittikçe daha fazla araç kullanılıyor. Bir Carfax raporuna göre, ABD yollarındaki dört araçtan birinde toplam 63 milyonun üzerinde açık çağrı var. Bu, ülkedeki en yüksek oranda Texas'ta üç araçtan yaklaşık birinin etkilendiği bir araştırma ile 2016 yılındaki yüzde 34'lük bir artışı temsil ediyor. Texas'tan sonra Hawaii, Mississippi, Louisiana, Alabama, California, Texas, Florida, Pennsylvania ve New York. Top …

Devamını Oku »

Biyologlar, kurt örümceklerinin daha geniş bir yelpazesine sahip olduklarını söylüyor …

                                                                                                          UC, insanlara fayda sağlayacak hastalık veya çevre konularını incelemek için kurt örümceklerini örnek bir organizma haline getirmeye yardımcı oluyor. Kredi: University of Cincinnati      Charming, örümceği tanımlamak için en iyi yol olmayabilir, ancak Cincinnati Üniversitesi'ndeki araştırmacılar, davranışlarında genlerinde esnek ve kablolanmayan bir yaratıkta geniş bir kişilik yelpazesi buluyorlar .                                                                                 UC biyoloji …

Devamını Oku »

2019'da döner menzil teknolojisine sahip yeni Mazda elektrikli otomobil

Mazda, elektrikli sürüş teknolojisini dünyadaki otomobillerine tanıtmak için hazırlanıyor ve çıkıştaki başlıklar bir Tamamen yeni, özel elektrikli araç, Auto Express yalnızca ortaya koyabilir. Mazda'daki içerdekiler, Japon markasının yeni EV için 2019'un başlatma tarihini hedeflediğini söylediler. Yeni CX-5 ve RX Vision konsepti (bu resim 2014 Hazumi konseptidir) tarafından ortaya konan Mazda'nın en son tasarım dilini kullanacaktır. • En iyi elektrikli otomobiller …

Devamını Oku »

Nicole Mason Gerçek: Vücudumdaki her organ başarısız oluyordu ve kilomuz 56 kiloya düştüğünde anoreksiya nihayetinde kazanmış gibi göründüğünden ailemden cenaze törenimi planlaması söylendi. Ben: Ben iyiyim! Şişmanım! Kendimden nefret ediyorum! Ben değersiz biriyim. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Gerçek: Sadece 1 ½ yıl sonra, 221 pound'luk bir şiddetle çarpan bir ölçeğe baktım. Her gün boş yiyecek sarmalayıcılar şirketinde uyuşukluk yaşlı yemek yeme bozukluğu yerini anoreksi yerini aldı. Ben: Kendimden nefret ediyorum! Umutsuzum! Artık kendimi tanımıyorum bile. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Bulimia, umutsuzca kilo vermeye çalışırken yavaş yavaş hayatıma girdi. Aşırı müshil ile yakalanan – kısıtlama döngüsü; Bir defada 100 müshil ürünü yuttuğumda kaya tabanına düştüm. Ben: Ben iyiyim! Bu yemin ederim son olacak! Kendimden nefret ediyorum! Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Başlangıç ​​ İsmim Brittany Burgunder'dır, ancak hayatımın çoğunu kendim koşturarak geçirdim. On yıldan fazla bir süredir, dünyadaki en yüksek ölüm oranına sahip zihinsel hastalık olan bir yeme bozukluğu ile savaştım. Sevgi dolu ebeveynlerle büyüdüm, ulusal derecede tenis sporcusuyum, düz 'A' öğrencisi ve yetenekli bir at binicisiyim. Mükemmel bir gülümseme üzerine – parlak bir geleceği olan normal bir hayatını tasvir eden bir gülümseme, ancak altında yatan sıkıntılı ruhu kamufle eden bir gülümseme üzerine boyadım. Gerçeğim, acı çekingen, sürekli alay ve reddettiğim akranlarımın korkunç kaygı, depresyon ve OKB'ye yol açmasıydı. Neden herkes gibi uymadığımın ve hayatın neden bu kadar zor olduğunu anlamadım. Bildiğim şey, ben ile ilgili bir sorun olması ve yeterince iyi olmaması gerektiğiydi. Anoreksiya Anoreksi, 13 yaşındayken hayatıma girdi. Yeme bozukluğunun ne olduğunu, sadece yiyecek konusunda tuhaflaştığım ve kalori, bedenim ve egzersizle ilgili garip yeni ritüeller geliştirdiğim hakkında hiçbir fikrim yoktu. Hastalığım beni yaşamak istemediğim bir yaşama yönlendirmede yeni bir yol bulduğum için endişelerim yatıştı. Ailem hızla müdahale etti ve eve tedavi edeceğim düşüncesiyle beni ilk tedavi merkezime yolladı. Meydan okurcasına, bir sorunum olduğu gerçeğinden habersiz davrandım. Benim gibi diğer insanlar olduğuna şaşkına döndüm ve bir sefer yalnız hissetmedim ve arkadaş oldum. İyi fiziksel sağlıkta eve döndüğüm halde aklım kesinlikle düzelmedi ve bir dizi yeni hileyle silahlı olarak döndüm. Egzersiz bağımlısı oldum. Üç farklı spor müsabakası üyeliğime sahibim, bu nedenle aynı kişiler aşırı davranışsal davranışı gözlemlemiyorlardı. Çoğu yaş grubum baloya giderken, 20'li yıllarda kalp atış hızı ile hastanede yatıyordum. Bir zamanlar Division 1 üniversite tenisi oynamak için bir potansiyel buldum, ama şimdi eğlenmek için babamla bile uğraşamayacak kadar zayıftı. Bir zamanlar en büyük sevincim olan atım satıldı, çünkü ben daha derin ve daha derin bir yanılsama dünyasına girdim. Gerçeklerime olan tek tanık – gerçek düşüncelerim ve gerçek çatışma – bir günlük ve kalemdi. Her gün yoğun bir şekilde yazmıştım. Yeme bozukluğumun yanı sıra, sahip olduğum diğer tek şirket buydu. Günlüklerimde yazarken başımdaki karışıklığın bir kısmını boşaltmaya yardımcı oldular, ancak sırlarımı korumak için dergilerimi gizli tutmayı emrediyorum. Davis Kaliforniya Üniversitesi'ne kabul edildi. Ailem, ihtiyacım olan yeni başlangıç ​​olabileceğini düşünerek gitmeme kararı verdi, ancak yanılıyorlardı. Sınıf arkadaşlarımla sosyalleşmeye çalıştım, ama açıkçası onlar gibi değildi ve dışarı çıkmak için yapılan her davetiyeyi geri çevirmek için bir bahanem vardı: Eğer yiyecek veya alkol olsaydı ne olurdu? Egzersiz programıma müdahale etseydi ne olurdu?

ise Yeme bozukluğumla hayatım çabucak bana oldu. Profesörleri sevdiğim kadarıyla UC Davis'teki vaktim kısa sürede korkunç bir varlığa dönüştü. Özel bir yeme bozukluğu istikrar programına kabul edilmeden çok önce değildi. Tüm dolaşımı kaybettim, saçlarım düştü ve karaciğer yetmezliğiyle yüzleştim. Kilom çok düşük bir kilo aldı ve ailemden cenaze düzenlemeleri yapılması söylendi. Ancak bu bana gerçek dışı geldi. Ben şişmanım. İyiydim. …

Devamını Oku »

Yüksek Standartlara Sahip Olmanız Çok Fazla P olduğunuz anlamına gelmiyor …

Unsplash / Allef Vinicius Yüksek standartlara sahip olmak, Çok seçicisin Bu, altı metrelik boyların altındaki çocuklarla çıkmayı reddettiğiniz anlamına gelmez veya her maaş kontrolünde altı basamaklı bir adama ihtiyacınız olduğunu belirtir. Değerli olmak istediğiniz anlamına geliyor. Anladım. Saygıdeğer. Akıllarına veya vücuduna ilgi duymuyorsan birini aşağı indirmene karşı suçluluk hissetmemelisin. Standartların olması gerekiyor. Yerleşmemelisin. Ulaşılamayan bir şey artığınızı iddia eden kişileri …

Devamını Oku »

Metanobaktiğin ve Bakır ile Bactanın Bağlantısı … Özet Methanobactins (mbs), düşük molekül ağırlıklı (<1,200 Da) bakır- Birçok metan oksitleyici bakteri (metanotrof) tarafından üretilen bağlayıcı peptidler veya chalkophores. Bu moleküller belirli demir bağlama sideroforlarına benzerlikler gösterir, ancak bakır sınırlamasına yanıt olarak eksprese edilir ve salgılanır. Yapısal olarak, mbs, bakır koordinasyon bölgesini oluşturan ilişkili tiyoamit gruplarına sahip bir çift heterosiklik halkayla karakterize edilir. Halkalardan biri her zaman bir oksazolondur ve ikinci halka bir oksazolon, bir imidazolon veya bir pirazindion parçasıdır. Mb molekülü, (i) halka oluşumu, (ii) bir lider peptid dizisinin bölünmesi ve (iii) bazı durumlarda bir sülfat grubunun eklenmesi de dahil olmak üzere bir dizi posttranslasyonel modifikasyona uğramış bir peptid öncüsünden kaynaklanmaktadır. İşlevsel olarak, mbs bakır alım sisteminin hücre dışı bileşenini temsil eder. Bakır alımındaki bu rolü ile tutarlı olarak, mbs bakır iyonları için yüksek afiniteye sahiptir. Bağlandıktan sonra, mbs hızla Cu 2+ 'i Cu 1+ e indirir. Bağlayıcı bağlamaya ek olarak, mbs çoğu geçiş metalini ve geçiş metaline yakın bağlar ve ana metanotrof yanı sıra diğer bakterileri toksik metallerden korur. Mbslere, başta redoks ve metal bağlayıcı özelliklerine dayanan diğer birçok fizyolojik fonksiyonlar atanmıştır. Bu derlemede, bu yeni metal bağlayıcı peptit tipinin mevcut durumunu inceliyoruz. Potansiyel uygulamalarını, mbslerin çoklu metallerin biyoyararlanımını nasıl değiştirebildiğini ve mbs'lerin metanotrofların fizyolojisinde nasıl oynayabileceğini de keşfediyoruz. GİRİŞ Methanobactins (mbs) ilk önce aerobik metan oksitleyici bakterilerde (metanotroflar) tanımlandı. Bu göze çarpan bakteri grubu, karbon ve enerjinin tek kaynağı olarak metan kullanarak büyüyebilir. Oksijen ve metanın bulunduğu ortamlarda bulunurlar ve biyosferde üretilen metanların çoğunun tüketilmesinde önemli bir rol oynarlar ve böylece küresel ısınmaya olan etkilerini azaltıyorlar (1, -4). Metanogenezis (5) yoluyla üretilen, ucuz, kolay bulunabilen ve yenilenebilir karbon kaynağı ile üretildikleri takdirde, metanotrofların toplu ve ince kimyasalların üretimi için ve çevre kirleticilerin biyolojik olarak temizlenmesinde önemli bir potansiyeli vardır (2, 6 , -8). Metan üzerinde yetişen bir bakterinin ilk raporu, 1906'da Hollanda'da Delft'te bulunan Beijerinck'in laboratuvarında çalışan Söhngen tarafından yapıldı; bu gaz, 1906'da Bacillus metanicus'un izolasyonunu Su bitkileri ve gölet suyu (9). 50 yıl sonra bu mikropun yeniden izole edildiği ve adı değiştirildi Pseudomonas metanica (10, 11). İkinci metanotrof, Metilokokus kapsülatus (Texas türü), 1966'da izole edildi (12). Methanotrof biyolojisindeki bir dönüm noktası, Whittenbury ve meslektaşları tarafından çeşitli karasal ve tatlı su ortamlarından izole edildiğinde ve metan üzerinde büyüyen 100 yeni aerobik metanotrofu anlatan 1970'de geldi (13). Daha sonra bu metanotrofların metan üzerinde yetişebilme yeteneği, karbon asimilasyonunun yolakları, istirahat evreleri (kistler ve sporlar) oluşumu, morfoloji, kompleks intrasitoplazmik zarın bulunduğuna dayanarak tip II'ye karşı tip II sınıflandırması geliştirdiler. Düzenlemeler ve DNA'ların mol yüzdeleri G + C içeriği. Daha sonra, Bowman ve meslektaşları çeşitli ortamlardan benzer sayıda metanotrof izole etti ve bunları Whittenbury ve meslektaşlarının programına ve 16S rRNA filogenezine (14, 15) göre sınıflandırdılar. O sırada hiçbir DNA sıralamasının yapılmamış olmasına rağmen, Whittenbury ve arkadaşlarının genel sınıflandırma şeması bugün metanotrofların gruplandırılmasında sağlam ve kullanışlı bir yöntem olmaya devam etmektedir. Buna göre şu anda 15 jenerat metanotrof bulunmaktadır Gammaproteobakteri sınıfının Methylococcaceae ve 3'ünde Methylothermaceae ailesi bulunmaktadır. Metilobakter Metilokaldum Metilokokus Metilogea Metiloglobulus Metilomagnum ] Metilomarinat Metilpomfurus Metilfosfamid Metilfosfat, Metilpomkarboksilik Asit Metanol, Metilokarboksilik Asit Metilpomkarboksilik Asit Metilpomkarboksilik Asit Metanol (19459016, Metilosarkin (19459016) ve Metilovüum ailesi metanotroflarıdır ve Metilohalobius Metilomarinovum , Ve Metiltermermus Metiltothermaceae familyasındaki metanotroflardır (16, -21, 227). Methylocystaceae familyasında ve Metilocella familyasında Alphaproteobacteria cins Methylosinus ve Methylocystis , Metiloferula ve Metilokapsa 'nın ailesi Beijerinkiaceae'de . Son 15 yılda, çoğul bileşiklerini büyüme için kullanabilen Metilokolella Metilokapsa ve Metilokistis cinslerinde fakültatif metanotroflara ilişkin raporlar artmaktadır Metan (22, -26). Günümüzde ayrıca, Crenothrix ve Clonothrix gibi diğer cinslerden filamentli metanotroflar ve yüksek sıcaklıklarda büyüyen ve düşük sıcaklıklarda yetişen cins Methylacidiphilum'un nonproteobakteriyel (verrucomicrobial) metanotrofları PH da yakınlarda keşfedilmiştir (27). Son olarak NC10 filumunun bir üyesi olan "Candidatus Metilomirabilis oksifizasyonu" zorunlu anaerob olmasına rağmen metan oksidasyonu için dioksijen ürettiğini gösterdi (28,29). Birlikte ele alındığında, bu veriler gezegenimizin birçok ekosisteminde metanotrofik bakterilerin yaygın doğasını açık bir şekilde göstermektedir. Metanotrofların fizyolojisi ve biyokimyası Metanotroflar metan'ı bir enerji kaynağı olarak kullanabilir ve ayrıca (6, 30, 31) için karbon sağlamaktır. Metanın metanole ilk oksidasyonu metan monooksigenaz enzim (MMO) tarafından katalize edilir. Aynı moleküler metan oksidasyon problemine (32, -37) evrimsel olarak bağımsız çözümler üreten MMO, membrana bağlı veya partikülat MMO (pMMO) ve sitoplazmik veya çözünür MMO (sMMO) olmak üzere iki yapısal ve biyokimyasal açıdan farklı formlar vardır . SMMO, aynı zamanda sınıf I ribonükleotid R2 alt-birimi için homolog olan çözünebilir di-demir monooksigenazlar (SDIMOs) (38) olarak bilinen geniş bir bakteri hidrokarbon oksijenaz grubuna ait olan üç komponentli bir bin nuclear demir aktif merkez monooksigenazdır Redüktaz. Methylococcus capsulatus (Bath) (39, -43) ve Methylosinus trichosporium OB3b (44, -47) 'den elde edilen iki çok benzer sMMO sistemi ayrıntılı olarak incelenmiştir. SMMO altı genli bir operon, mmoXYBZDC tarafından kodlanır ve üç bileşene sahiptir: (i) bir α-hidroksilazokinaz ile bir 250-kDa hidroksilaz (19459022) α alt birimlerinin (MmoX) substrat oksijenasyonunun meydana geldiği yerde çift çekirdekli demir aktif merkezini içerdiği yapı, (ii) flavin adenin dinükleotidli 39-kDa NAD (P) H bağımlı redüktaz (MmoC) FAD) ve Fe (19459022) 2 2 protez grupları ve (iii) protein B olarak bilinen bir 16-kDa bileşenini (MmoB) veya protez grupları içermeyen kuplaj / geçitlendirme proteini veya Metal iyonları (39, 48). Protein B için (39, 53, 54) hidroksilaz bileşeni (49, -52), nükleer manyetik rezonans (NMR) -tabutulan yapılar için X-ışını kristal yapıları vardır ve bu bileşiğin flavin alanı için bir NMR türetilmiş yapı vardır Redüktaz (55). Üç bileşen tarafından oluşturulan kompleks, küçük açı X-ışını saçılım analizi ve biyofiziksel olarak elektron paramanyetik rezonans spektroskopi, ultra-santrifüjleme ve kalorimetrik analiz ile yapısal olarak incelenmiştir (56, 57). SMMO'nun katalitik döngüsü kapsamlı bir şekilde incelenmiş ve çift-çekirdekli demir merkezindeki oksijen ve hidrokarbon aktivasyon mekanizmasının anlaşılmasına yönelik mükemmel ilerlemeler yapılmıştır (45) (45, 58, -62). Bununla birlikte, pMMO, bakır ve muhtemelen demir içeren membrana bağlı enzimdir (6, 37, 47, 63, 64). Tip I metanotroflardaki veziküler disklerin şeklini alan sıradışı intrasitoplazmik membranlar ve tip II organizmalarda eşleştirilmiş periferik tabakalar ile ilişkilidir (65, -75). İntrasitoplazmik membranlar pMMO'da zenginleştirilir ve sukroz yoğunluk gradyanlarında sedimantasyon hızı temelinde sitoplazmik membrandan fiziksel olarak ayrılabilir (76). PMMO'nun yapısı ve mekanizması hakkında bir anlayış, enzim çözünürken aktivite kaybından dolayı sMMO için olana göre daha yavaş ortaya çıkmıştır. PMMO, genler pmoCAB tarafından kodlanan yaklaşık 49, 27 ve 22 kDa'lık üç polipeptitten oluşur (77). Metanotroflarda genellikle bu pmo genlerinin birden fazla kopyası vardır (78, 79). Son yıllardaki araştırmalar, doğal pMMO'nun, hidroksilamin oksidoredüktaz ve amonyak monooksigenaz redoks çiftleri (82, -85) için bulunana benzer şekilde, pMMO'ya elektronlar (80, 81) sağlayabilecek metanol dehidrojenazı (MeDH) ile kompleks oluşturduğunu göstermiştir ). Bazı metanotroflar, mesela M. Kapsülatus (Banyo) ve M. Trichosporium OB3b, her iki MMO formunu üretebilir. En bilinen metanotroflar yalnızca pMMO'ya sahiptir, örneğin Metilomonas metanika Metilomikrobiyum album BG8, Metilokistis parvus OBBP ve verrukomikrobik ve NC10 metanotroflar. Beijerinckiaceae ailesindeki, örneğin Metilasella silvestris ve Metiloferula stellata içindeki sadece birkaç metanotrofun sMMO'ya sahip olduğu, ancak pMMO'ya sahip olmadığı (21, 86) MMO tarafından üretilen metanol, bir kalsiyum veya nadir toprak bağımlı pirroloquinoline quinone (PQQ) içeren MeDH (87, -91) ile formaldehite oksitlenir. Formaldehit, metanotrofik metabolizmanın metabolizmasının önemli bir koludur ve bir karbon (C 1 ara ürününün enerji elde etmek için CO 2'ye oksitlenebildiği veya asimile edildiği noktayı temsil eder Biyokütleye dönüştürdü. Formaldehid toksik olduğundan, metanotroflar bu metabolik ara maddenin birikimine karşı kendilerini korumalıdırlar. Formaldehit metabolizması için çoklu yollar metanotroflarda bulunur (2, 26, 92, -96). Örneğin, formaldehitin oksidatif dissimilasyonu, boya bağlı membrana bağlı (93) yoluyla ya da NAD + yoluyla tetrahidrometanopterine (H 4) [97,98] konjügasyonuyla ortaya çıkabilir ] Bağımlı (95, 96, 99) formaldehit dehidrogenazlar. Formül, formaldehidin formaldehit dehidrogenazlar tarafından oksidasyonundan kaynaklanır ve daha sonra metan, biyosentetik reaksiyonlar ve enerjinin oksidasyonu için NADH üreten bir NAD + [bağımlıformatdihidrojenazilekarbondioksit'eoksitlenirHücreiçinesil(100-102)Metanotroflaraynızamandaalfaproteobakteriyelvegammaproteobakteriyelmetanotroflardaaktifolanformaldehitinbiyokütleyeserinveribulozmonofosfat(RuMP)döngülerinefiksasyonuiçinikiyolasahiptirMetanotroflardakikarbonfiksasyonyolaklarıkapsamlıolarakgözdengeçirildi(bkzÖrneğinreferans6) Metanotroflardaki "Bakır Anahtar" Metan karakterizasyonu için erken teşebbüsler MMO'nun hücresel konumu hakkında farklı raporlar vasıtasıyla oksidasyon karmaşıktı. MMO'lar, suşuna ve bazı suşlar için raporlama laboratuvarına bağlı olarak çözünebilir veya membran ile ilişkili olarak tanımlanmıştır. Çeşitli gruplar başlangıçta partikül veya zar fraksiyonunda aktivite bildirdiler (103, 104), buna karşılık diğer gruplar çözünür fraksiyonda aktivite saptamıştı (105, 106). Sonraki çalışmalar hücresel konumun ekim koşullarına göre değiştiğini gösterdi. Oksijen kısıtlamasının çözünür fraksiyonda metan oksidasyonunu indüklediği bildirildi M. Trikosporium OB3b (36, 107). Bununla birlikte, oksijenin düzenleyici faktör olmadığı ve membrana bağlı ve çözünen aktiviteler arasındaki geçişin biyokütle konsantrasyonuyla ilişkili olduğu gösterildi (108). Bu "geçiş" in keşfedilmesinde tanımlayıcı an, Dalton ve meslektaşlarının M büyümeye çalıştıkları zamandı. Parvus OBBP, kemostat kültüründe yüksek hücre yoğunluklarına. M. Parvus OBBP, nispeten düşük hücre yoğunluklarında metan, hava ve nitrat mineral tuzları (NMS) çözeltisiyle birlikte verildiğinde büyümeyi durdurdu. Bununla birlikte, ek eser element çözümü eklendiğinde, kültürler derhal büyümeye başladı. İz element solüsyonundaki "gizli içerik", bakır iyonlarına indirgenmiştir (108). Daha sonra, M. Parvus OBBP, yalnızca bakır iyonlarına yüksek gereksinim getiren pMMO içeriyordu ve M ile o sırada gözlenen aynı yüksek hücre yoğunluklarına ulaşmasına izin verecek bir sMMO içermiyordu. Kapsülatus Banyo ve M. Trichosporium OB3b, bakır sınırlaması altında. Aynı suşlarla karşı karşıya kalındığında, suşlar sMMO'nun ifadesine geçti ve büyümeyi sürdürdü (35, 109). İlginç bir şekilde, bakırın daha önce sMMO içermeyen metanotrof olan Methanomonas margaritae 'nın büyümesini arttırdığı gösterildi, ancak bu orijinal gözlemler hiçbir zaman daha fazla araştırılmadı (110) Dalton ve arkadaşları Gözlemlerini detaylı bir şekilde incelediler ve bu "bakır geçiş" in varlığını kurdular, yani, iki farklı MMO formunun, hem sMMO hem de sMMO'ya sahip olan metanotrof kültürlerinin bakır-to-biyokütle oranına yanıt olarak metanotroflardaki ifadesinin düzenlenmesi PMMO. Metanotrofların metal bağımlı büyümesi üzerine daha önceki gözlemlerin birçoğunu açıklamalarını sağladı. Örneğin, M. Kapsülatus Banyo, sMMO'nun ekspresyonu yalnızca ortamdaki bakır iyonları tükendiğinde yüksek hücre yoğunluklarında gözlemlenirken, fazla bakır iyonlarının ilavesi bu metanotrofun aktif pMMO'yu ifade etmesine izin vermiştir. Daha sonra, Murrell ve meslektaşları moleküler seviyede, düşük konsantrasyonlarda bakır iyonlarıyla büyümenin altında sMMO ifadesi, sMMO gen kümesinin yukarı akışında σ 54 promotöründe başlatıldığını gösterdi ( mmoXYBZDC ). Tersine, yüksek bakır büyüme koşulları altında, sMMO ekspresyonu bastırılmış ve pMMO kodlayan genlerin yüksek seviyelerde ekspresyonu ( pmoCAB ) her ikisine de izin vermiştir. Trichosporium OB3b ve M. Kapsülatus Banyo, pMMO (34, 111, -113) kullanılarak büyüyecektir. Daha ileri araştırmalar bakırın metanotrofik fizyolojiyi ve gen ifadesini daha geniş ölçüde etkilediğini ortaya koymuştur. Örneğin, metanotroflardaki intrasitoplazmik zar içeriğinin büyüme ortamında bakır arttıkça arttığı bulundu (66, 109, 114). Bununla birlikte, bu tamamen beklenmedik değildi: pMMO'nun intrasitoplazmik zarlarda lokalize olduğu göz önüne alındığında, pMMO'nun daha fazla ekspresyonu ve aktivitesi bu zarların mantıksal olarak daha fazlasını gerektirir. Bununla birlikte, daha şaşırtıcı bir şekilde, pMMO'nun ve mxa operon tarafından kodlanan PQQ'ya bağlı MeDH'nin, intrasitoplazmik membranlara sabitlenmiş bir süper kompleks oluşturduğunu ve elektronun, PQQ-bağlantılı MeDH'den pMMO'ya In vivo metan oksidasyonunu tetikleyebilir (80,81). Son bulguyu destekleyerek yakın zamanda, pmo genlerinin ekspresyonu arttıkça arttığını değil, mxa operonundaki genlerin çoğunun da arttığını bulduk ) Proteomik yöntemle, metanın karbondioksit ile oksitlenmesindeki ilave basamaklar, lipid, hücre duvarı ve membran sentezinde rol oynayan proteinler gibi bakır kullanımının artmasıyla aşırı eksprese edildiği de gösterilmiştir ( 66, 115). Tersine, metanotrofların karbonu metandan poli-3-hidroksibutirat'a yöneltme yeteneği, bakırın bulunabilirliğini azaltarak artar (66, 116), bu da metanotrofların enerji metabolizmasının bakır tarafından kontrol edildiğini düşündürmektedir. Böyle bir sonuca Dalton ve arkadaşları daha önce ulaşmıştı ki metanotroflardaki metanotroflardaki biyolojik kütle verimi ve karbon dönüşüm etkinliği, bakır arttıkça, yani metanotroflar sMMO ifade ederek pMMO'yu ifade etmeye geçtiğinde (117) arttığını gösteriyordu. Dış zarın dış yüzeyindeki "yüzeysel" veya proteinler, bazı metanotroflarda bakır bulunması ile de kontrol edilir. Bakır alımına dahil olduğuna inanılan çok sayıda çoklu sitokrom ve proteinin ifadesi de bakırın bulunabilirliği arttıkça değişir ve çoğu durumda azalır (118, -123). Metanotrofların bakırı nasıl tuttuğu üzerine ilave bilgiler, yeni bir bakır depolama proteini ailesinin Csps'in keşfedilmesiyle sağlandı . Trikosporyum OB3b (124). Bu metanotrof, üç Csp'ye sahiptir: Csp1 ve Csp2, ikiz arginin translokaz hedefleme sinyal peptidlerini öngörmüşlerdir ve bu nedenle katlanmanın ardından sitosolik Csp3'den sonra ihraç edildiği düşünülmektedir. Csp1, paketin çekirdeğini gösteren Cys kalıntıları vasıtasıyla 52 Cu 1+ iyonuna kadar bağlanabilen dört heliks demetinin bir tetramerini oluşturur. SMMO'ya geçiş, vahşi türe göre, Δ csp1 csp2 mutantında hızlandırılmış olup, bu proteinlerin pMMO için bakır depolamada rol oynadığını ve bakır sınırlandığında bir dahili bakır kaynağı temin ettiğini düşündürmektedir. Bu koşullar altında, tüm Cu 1+ 'i Cspl'den kolayca kaldırabilen ve dolayısıyla Csp1 bağlı bakırın kullanılmasına yardımcı olan bir rol oynayabilecek mb üretilmektedir. ] Bir bakıra özgü alım sistemi öneren kanıtlar Bakır özgül alım sistemi ve hücre dışı bir bakır bağlama ligandının üretilmesi için ilk kanıt, yapıcı sMMO mutantlarının (sMMO ) fenotipik karakterizasyonu sırasında ortaya çıktı. C ) M. Trikosporyum [1958016] OB3b (125, 126). Phelps ve ark. (126), beş sMMO C mutantını M kültürleyerek izole etti. Trikosporium diklorometan mevcudiyetinde OB3b, metan monooksigenaz ile formetil klorüre dönüşümü için kometabolik dönüşümü takiben bir mutajen olarak işlev görür. SMMO C fenotipine ek olarak, sMMO mutantları bakır alımında kusurluydı (125, 127, 128). Kültür ortamında çözünür olmayan bakır karşısında sert bir artış da gözlendi ve Fe'ye benzer bir ekstraselüler Cu 2+ kompleks yapıcı ajan (lar) üretimine ilişkin spekülasyonlar teşvik edildi Fe 3+ Komplike siderophores (127). Sonraki çalışmalar düşük molekül kütleli bir bakır bağlama ligandının varlığını ortaya çıkarmıştır, ancak bu bileşiğin kimliğini belirlememişti (125, 127). Methanobactin'in İlk Tanımlanması ve İzolasyonu (Bir Bakır Bağlayıcı Bileşik veya "Chalkophore") Biraz paradoksal olarak, "bakır bağlayıcı ligand" veya "bakır bağlayıcı bileşik" önce M'den izole edildi. Kapsülat pMMO'nun arıtılması sırasında ve dolayısıyla yüksek bakır konsantrasyonlarında (73) banyo. Bu bakır bağlayıcı bileşiğin pMMO'dan ayrılması, düşük molekül ağırlıklı bir sarı-flüoresan bakır ihtiva eden molekülü ortaya çıkarmıştır. Bu molekülün renk ve flüoresan özellikleri, düşük bakır ortamda kültürlenen hücrelerde görülen suda çözünebilen pigmentinkine benzerdi (73). Bu suda çözünür pigmentin karakterizasyonu, pMMO ile birleşmiş bakır bağlayıcı bileşik ile özdeş olduğu ortaya çıktı (73, 128). Methanotroflarla suda çözünen pigmentlerin üretimi, birçok tip suşun ilk izolasyonu sırasında 40 yıl önce kaydedildi ancak düşük demirli ortamda kültürlenen hücrelerle ilişkilendirildi (13). Bakır bağlayıcı bileşik, molekülün Gram pozitif bakterilere karşı antimikrobiyal etkinliğine dayanılarak sonuçta metanobaktin (mb) olarak adlandırıldı (129, 130). Tanımlandıktan sonra, bu bakır bağlama bileşiği, bir dizi farklı metanotrofda izole edildi veya tanımlandı; bunlara aşağıdakileri içeren metil bromür albumin BG8 (131), Metiloksisit soyu SB2 (132), Metiloksisit (133), (197) Methylocystis hirsuta Methylocystis M türü (133) CSC1 (133) ve (suş SV97). Mb'lerin kristal yapıları M. Trichosporium [1358.016] OB3b (134,135), M. Hirsuta CSC1 (133) ve Metiloksisit suşu M (133) saptanmıştır. Ayrıca, Methylocystis suşu SB2 (132) ve Mbr'lerin kimyasal yapıları. Rosea (133) çıkarıldı. Bu yorum farazi mbs sıralı genomları ile Methanotroph anlaşılabilir sağladı bu mbs üzerinde durulacak. Methanobactins olarak Chalkophores İşlevsel olarak, mbs siderofor benzer. Sideroforlarda olduğu gibi, düşük bakır koşullarında (125, 126, 128, 136, -138) bakteriler tarafından üretilen düşük moleküler kütleli (<1,200-Da) bileşiklerdir. Yunancadan demir taşıyan ya da demir taşıyan siderophores'in adlandırılmasından sonra, mbsler chalkophores (bakır taşıyan ya da bakır taşıyan) (134, 139). Mbs şu anda bu grubun bilinen tek temsilcisi. Bir bakır alım sisteminin hücre dışı bileşeni rolü ile tutarlı olarak, mbs bakır iyonları için bilinen en yüksek bağlanma afinitelerine sahiptir (2, 131, 135, 138, 140, 141) (19459000) mb'lerin metal bağlayıcı afiniteleri ( K ). [PubMed] TABLO 1 "başlık =" Tablo 1 "/> Trikosporium Metil sistein M türü Methylocystis hirsuta methylcystis CSC1, Metilkistis Methylocystis rosea ve Methylocystis streyn SB2 bir Her ne kadar chalkophores ve siderofor Bir dizi özellik paylaştığında, bu iki metal bağlayıcı bileşik grubu çeşitli şekillerde ayrılabilir. Fitoziderofor domoik asit (142) haricinde, sideroforlar demir sınırlaması altında eksprese edilirken, chalkophores bakır sınırlaması altında eksprese edilir. Birçok siderofor bakır bağlar ve chalkophores demir bağlayabilir (142, -148); Bununla birlikte, farklı metal bağlama sabitleri iki grubu karakterize eder ve bu farka göre ayırt etmek için kolorimetrik analizler geliştirilmiştir (138, 149, 150). Yapısal olarak chalkophores, tipik heterosiklik halkalar ve ilişkili tiyoamit grupları (ve) ile siderophores'den farklıdır. Farklı halka sistemleri, molekülün metal bağlama özelliklerini (131, 133, -136, 138, 148, 151) tanımlamak ve karakterize etmek için kullanılabilen karakteristik UV-görünür emiş, dairesel dikroizm (CD) ve floresan spektral özelliklere sahiptir , -153). Uyarılma enerjisi transferi, ışık toplama komplekslerinin (155, -157) kromoforları için gözlemlendiği gibi mb'deki (136, 154) iki halka arasında meydana gelir ve bu da mbs'nin floresan özelliklerine neden olur. Örneğin, mbs emisyon yoğunluğu halkalardan birinin seçici hidrolizi ile artmakta ve metal eklenmesinin ardından emisyon yoğunluğu sıklıkla artmaktadır (132, 136, -138, 141, 148, 154). Yine, bu özellik hem mbs tanımlamada hem de karakterizasyonu için kullanılabilir Tam uzunlukta mb-OB3b'nin (135 (133) (C), mb- (133) (D) ve mb-SB2 (132) (A), mb- (E). yıldızlarla hepsini olmasa da bazı örneklerde görülmektedir ile Amino asitler işaretlenmiş. ve Çekirdek özellikleri Mbs. AA, amino asit (ler). R grupları Arg, Ile, Met veya Pro olabilir Ancak, açıklanan özelliklerin tamamı mbs'leri tanımlamak için yeterli değildir. Örneğin, Clostridium cellulolyticum mbs'lere (158, -160) benzer bir molekül kütlesi olan bir bakır bağlayıcı sekonder metabolit olan klosthioamid üretir ve benzer mbs'ler, closthioamid tiyoamid gruplarına sahiptir, Cu 2 + ila Cu 1+ 2+ 1+ 1+ 1+ ). Closthioamine ayrıca mb üretimini taramak için kullanılan sıvı veya plaka bir analiz olan bakır-krom azural S (Cu-CAS) tahliliyle pozitif çıkacaktır (138, 149, 161). Bununla birlikte, klosthioamid spektroskopik olarak mbs'den ayırt edilebilir; Örneğin, klostihoamid, altı tiyoamit kısmı ile ayrılmış iki karakteristik fenolik grubundan kaynaklanan, 270 nm'de maksimum tek bir UV-görünür emme mukavemeti gösterir. Dahası, klostihoamit bir dinükleer Cu 1+ kompleksi oluşturabilmektedir. Ayrıca, mbs'lerin aksine, klostihoamid sentezi bakır tarafından düzenlenmez ve mbs'nin aksine, molekülün bir poliketit sintazı ile üretildiğine inanılır (aşağıya bakınız). Benzer şekilde, düşük bakır koşullarında , Paraküs denitrifikalılar aynı zamanda, bakır alımında rol alan düşük molekül ağırlıklı bir 716.18-Da porfirin, kopoporfirin III üretirler (162). Ne yazık ki, ilk yayında bakır bağlanma özellikleri bildirilmemiştir ve herhangi bir takip çalışmalarının farkında değiliz. Coproporphyrin III, tipik bir heme UV-görünür emilim spektrumuna sahiptir ve heme grubu tarafından koordine edilen metale bağlı olarak farklı γ, α ve β maksimumlarını gösterir ve bu mülke dayanan mbs'den ayırt edilmesini sağlar. METAL BAĞLAYICI ÖZELLİKLERİ Bağlama ve İlköğretim Metal indirgenmesi, Bakır mb bağlayan hem Cu 2+ ve Cu 1+ ve mb ile bağlanma pH'ya (135, 172) ve Cu 2+ / Cu'ya 1 + ila mb'ye 136, 141, 172) (). Aşağıda tartışıldığı gibi, mb Cu 1+ ve Cu 2+ 'in çözünür ve çözünmez formlarını kompleks yapabilir. Mb-OB3b ve mb-SB2'ye (136, 141) Cu 2+ ilavesi üzerine termodinamik, spektral ve kinetik çalışmalar yürütülmüştür. Bu çalışmalar (136, 141, 172) mb'nin hızla Cu 2+ 'i Cu 1+ ' e indirgemesi ile karmaşıktır. Cu 2+ 'in apo-mbs'ye eklendiği deneyler için yüksek bağlanma sabitinden sorumlu bakırın oksidasyon durumu bilinmediğinden, bu oksidasyon durumlarının bir karışımının, "Cu 2+ / Cu 1+ " Bu noktadan itibaren. Cu düşük oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b başlangıçta Cu 2+ / Cu 1+ [bağlar oligomer / tetramer olarak (136, 141). Kararlı halden önceki kinetik veriler, metalin ilk bağlanmasının yalnızca halkaların birinde ve buna bağlı tiyoamid üzerinde olduğunu göstermektedir. Mb-OB3b'de başlangıç ​​Cu 2+ / Cu 1+ koordinasyonu oksazolon A'ya ve ardından kısa (8 ila 10 ms) gecikme periyoduna ve daha sonra Oksazolon B (141). Cu yüksek oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b 2+ / Cu 1+ [19459008Cukoordinatları]Bir dimer olarak dimer olarak eklenir ve bunu takiben, mb-OB3b için 0.5 Cu'nin üzerinde 2+ / Cu 1+ ila-mb- OB3b. Mb-SB2, bakır-mb oranına bağlı olarak benzer bir tetramer-dimer-monomer bağlanma dizisini izlemektedir. Mb-SB2 için, Cu 2+ / Cu 1+ 'in ilk bağlanması imidazolon halkasına ve bunu takiben oksazolon halkasına (154) koordine edilir.

Mbs () için metal bağlanma afinite sabitlerini belirlemek için çeşitli yöntemler kullanılmıştır. Cu için afiniteler 1+ banyookuproin disülfonat gibi kromoforik ligand ile iyi kurulmuş bir yaklaşımı (173, -175) kullanarak rekabet çalışmaları ile belirlenebilir. Cu-mb'nin indirgeme potansiyeli ölçümü, daha sonra Cu 2+ afinitesinin hesaplanmasını sağlar. Bu yaklaşımı (133, 135) kullanarak analiz edilen tüm mbsler için Cu 1+ afinitesi ~ 10 M …

Devamını Oku »