25 Haziran 2017,Pazar
Anasayfa » Tag Archives: ortaya

Tag Archives: ortaya

Aşkın ilk fotoğrafı ortaya çıktı

                     2017-06-24 10:49:00                                                                      Beşiktaşlı futbolcu Oğuzhan Özyakup ile oyuncu Demet Özdemir tekne tatiline çıktı. Özdemir'in sevgilisini sırtından öptüğü romantik anlar objektiflere takıldı. Beşiktaş'ın yıldızı Oguzhan Özyakup ile Demet Özdemir aşkı belgelendi. Yaklaşık 1 yıldır birlikte olan ancak hiç yan yok görüntü vermeyen ikili, Bodrum'da çıktıkları mavi turda ilk kez yakalandı. Arkadaş grubuyla tekne yapan tatilli, çift, …

Devamını Oku »

Samsung Galaxy S8 Aktif teknik özellikleri ortaya çıktı!

Yeni amiral gemisi Galaxy S8 ile beraber radikal değişikliklere imza atan Samsung, anlaşılan o ki bu değişiklikleri gelecek nesil akıllı telefonlarında da sürdürmek istiyor. Galaxy S8 göre daha küçük bir akıllı telefon bunun en büyük örneği Küçük ekranlı Galaxy S8 göründü! GFXBench performans testinde ortaya çıkan yeni akıllı telefonun, çok geçmeden daha önce birçok farklı dedikoduda adı geçen meşhur Galaxy …

Devamını Oku »

Yenilenmiş Galaxy Note 7 için benchmark skorları ortaya çıktı!

Not 7R Not FE veya en temizi yenilenmiş Galaxy Note 7 bir kez daha ortaya çıktı. Geçtiğimiz yılın en talihsiz notaya 7 geri dönmeye hazırlanıyor. Yeni Not 7 kriter skorlarında göründü! Benchmark hazır gelen çıkan verilere göre, yeni Not 7, 1,6 GHz saat hızında çalışan işlemci kullanacak. İşlemci modeli olarak, Samsung'un kendi üretimi olan Exynos 8895 kullanılacak. Denklik olarak Snapdragon …

Devamını Oku »

Elon Musk, Mars koloni roketini ortaya çıkarıyor …

                                                   'İnsanları Çok Gezegenli Türler Yapma' planı, 1 milyon insanın Mars'a nasıl götürüleceğini ayrıntılarıyla anlatıyor                                               Elon Musk'un Mars planı"                                                                                                        Elon Musk, Mars'ta kendi kendine yeten bir şehir kurarak "İnsanları Çok Gezegensel Türler Hale Getirmek" konusundaki planını yayınladı.                  Musk, insanlığın yok oluş olayı başlamadan önce yeryüzünden çıkması gerektiğini ve …

Devamını Oku »

ZTE Blade A6 ortaya çıktı!

ZTE Blade A6 bugünün bir sızıntı ile ortaya çıktı. ZTE ' nin yeni akıllı telefonu Blade A6 yeni bilgiler gelmeye devam ediyor. ZTE Blade A6 ufukta göründü! Blade 6 olarak adlandırılan yeni akıllı telefon, WiFi sertifikasında göründü. Blade A6 kullanıcıların kıyısına Android 7.1.1 sürümünün kurulu olarak bugünkü yapılanması sızıntı ile birlikte ortaya çıktı. Henüz yeni cihaz hakkında daha fazla bilgi …

Devamını Oku »

Samsung Galaxy Tab A 8.0 (2017) ortaya çıktı!

Galaxy Tab serisi ürünleri ile tablet pazarında çocuk göstermekte Samsung farklı ihtiyaçlara göre cevap alınabilir, onun için geçen gün yeni bir modelle kullanıcıların karşısına çıkıyor. MWC 2017 etkinliğinde Galaxy Tab S3'ün duyurusunu gerçekleştiren Samsung'un, giriş seviyesi bir donanıma sahip yeni tablet modeli Galaxy Tab A 8.0 (2017) üzerinde çalıştığını ortaya çıkardı. Gelin, şimdi GFX Bench veritabanından elde edilen bilgilerle Galaxy …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Hyundai Kona Temelde Son Teaser Images'da Ortaya Çıktı »AutoGuide.com News

Hyundai'nin yeni geçidi, 12 Haziran'da resmen başlayacak, oysa bu teaser görüntüleri aslında hepsini uzak tutuyor. Hyundai, Kona için yeni oyunculardan ve Kore otomobil şirketine göre "Hyundai'nin yeni tasarım kimliğini sürdürüyor ve kompakt SUV segmentinde eşsiz bir öneri oluşturmak için ilerici bir karakter ve en yeni teknolojiler sunuyor" dedi. Ön uç cüretkar ve Jeep Cherokee'de bulunana benzer şekilde ince farlar içeriyor. …

Devamını Oku »

Oppo R11'in yeni görselleri ortaya çıktı!

Oppo'nun 10 Haziran tarihinde düzenleyeceği resmi etkinlikle tanıtmayı planladığı R11 ve R11 Plus modelleri hakkında sızıntılar tam durulmuştu ki, bugün cihazın arka yüzünü açık ve net Işe yaramayan yeni görseller ortaya çıktı. R11 ailesi nasıl olacak? Görsellerde cihazın üç farklı renk seçeneğiğiyle satışa sunulacağı anlaşılabiliyor. Görünüşe göre daha önce yaşanan sızıntıların en azından renk seçenekleri mevcut olan kısmı doğru. Yani …

Devamını Oku »

BMW M8 prototibi ortaya çıktı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                  BMW M8 kamuflaj – arka "title =" BMW M8 kamuflaj – arka "/> [19459301] BMW M8 kamuflaj – arka" title …

Devamını Oku »

BMW 8-Serisi lüks coupe konsept otomobil, takip etmek için üretim versiyonu ile ortaya

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Yolda yeni bir BMW 8 Serisi var – ve şimdi bunun nasıl olacağını biliyoruz. Resmen Konsept 8 Serisi olarak adlandırılan, burada gördüğünüz otomobil, menzilini tırmanan lüks tur operatörünün o kadar incelikli bir önizlemesidir. Bu haftasonu Concourso d'Eleganza Villa d'Este'de kapaklar çıkınca daha iyi bir görünüm elde edeceğiz, ancak …

Devamını Oku »

Far Cry 5 kötü karakterleri ortaya çıktı!

Far Cry 5 hakkında yeni bilgiler ortaya çıkmaya devam ediyor. Bildiğiniz üzere Ubisoft yarın Far Cry 5 kendi YouTube Hakkında kanalıyla, yeni detayları paylaşacağını açıkladı. Far Cry 5'in kötü karakterleri göründü! Bu sefer farklı bir tema ile karşımıza çıkacak olan Far Cry 5 hakkında yeni bilgiler Cuma günü öğreneceğiz. Ubisoft yeni oyunda bulunacak olan kötü karakterlerini gün yüzüne çıkarttı. Birinci …

Devamını Oku »

VW, yaz meraklısı etkinlik sezonu için kavramları ortaya koydu.

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Volkswagen meraklısı Avusturya, Worthersee'de buluşsa da, otomobil üreticilerinin Birleşik Devletler'deki etkinliklerinin çoğundan daha büyük. VW'nin Avrupa etkinliğine getirdiği gösteri arabaları hala ABD tekliflerinden çok farklı. VW fan kültürü halen VW fan kültürü, bu nedenle Atlantik'in her iki yakasında da klasik VW kampçılarının bir araya geldiği meraklılar. VW, ABD …

Devamını Oku »

JLR, Wimbledon Temasında Kamuflaj Yapan Jaguar XF Sportbrake'ı ortaya çıkarıyor

                         Geçen ay size, bu yılki Wimbledon serisi sırasında tanıtılacak Jaguar XF Sportbrake vagonu hakkında söyledik. Şirket, bu sezonun ana sponsorlarından biri. Resmi ilk çıkışının öncesinde, İngiliz otomobil üreticisi, promosyon kampanyasının bir parçası olarak benzersiz bir 'tenis topu baskısı' kamuflajı ile sarılı Jaguar XF Sportbrake'in görüntülerinin bir listesini yayınladı. Aslında, geçen ay otomobil üreticisi, Wimbledon merkez mahkemesinde işaretlenen otomobilin profilini …

Devamını Oku »

Yeni Skoda Karoq ortaya çıktı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                  Skoda Karoq – çizgi" title = "Skoda Karoq çizgisi"                                                Skoda Karoq – arka statik stüdyo …

Devamını Oku »

Volkswagen kalk! GTI ortaya çıkardı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                              Kaynak

Devamını Oku »

Cicadas dört yıl önce ortaya çıktığında bilim adamları kazandı …

                                     Cicadas, saat iğnesi gibi 17 yılda bir Atlantik ortasında ağaç dallarına aşırı yük bindiriyor. Ancak bazıları – iklim değişikliğinden şüpheleniliyorlar – çalar saatlerini dört yıl erken duyuyor olabilirler.                                                                                 Son günlerde kırmızı gözlü, kütük şeklindeki böcekler, Kuzey Virginia'dan Bel Air, MD'ye kadar olan ağaçların altında ezici olmayan büyük sayılarda taranan lekeler tespit edildi. Bu fenomen, bölgedeki feryat …

Devamını Oku »

Ayrılığın sebebi ortaya çıktı: Aşkın Nur Yengi

                     2017-05-16 11:06:00                                           Geçtiğimiz günlerde ayrılmış Haluk Bilginer ve Zerrin Tekindor'un ayrılık nedeni Tekindor'un oğlu Hira olduğu iddia, yeni bir ayrıntı ortaya çıktı. Haluk Bilginer'in şu sıralar 5 yıl önce boşandığı Aşkın Nur Yengi ile yeniden görüşmeye başladığı konuşuluyor. 2012 yılı boşanması Aşkın Nur Yengi-Haluk Bilginer çifti, Nazlı'nın ısrarına yeniden ısrarına dayanamıyor yeniden görüşmeye başladı.Sabah'ta yer alan habere …

Devamını Oku »

Araştırma ekipleri olağanüstü özelliklerini ortaya çıkarıyor …

                                                                                                          NUSNNI Direktörü Prof. T Venky Venkatesan liderliğindeki araştırmacılar, yarı iletken malzeme stronsiyum niobate'in olağanüstü özelliklerini ortaya çıkardı. Kredi: Singapur Ulusal Üniversitesi      Singapur Ulusal Üniversitesi'nden (NUS) araştırmacılar kısa süre önce hem metalik tip iletimi hem de fotokatalitik etkinliği gösteren benzersiz bir yarı iletken malzeme olan stronsiyum niobatın yeni özelliklerini ortaya çıkardılar. California Üniversitesi, Berkeley …

Devamını Oku »

Yeni 2017 BMW 2 Serisi facelift ortaya çıktı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                              Kaynak

Devamını Oku »

ADP-ribosiltransferazlar (ARTD1-16), NAD'nin majör aşağı akış efektörleri olarak ortaya çıkmıştır + Aile üyesi Spesifikasyonların Belirlenmesi …

hücrede sinyalizasyon. Çoğu ARTD (ARTD7-8, 10-12, 14-17) tek bir ADP-riboz birimi NAD + 'den mono-ADP-ribosilasyon olarak bilinen bir süreç olan hedef proteinlere transferini katalize eder (MARylation ). Marilasyonun hücresel işlevlerinin anlaşılmasında kaydedilen ilerleme, bireysel mono-ARTD'lerin doğrudan hedeflerini tanımlayamamasından dolayı kısıtlanmıştır. Burada, mono-ARTD'leri, vahşi tip ARTD'lere ortogonal olan bir NAD + analogu kullanmak üzere tasarladık. ARTD10 ve ARTD11'in MARylom'larını in vitro …

Devamını Oku »

Gelişmekte olan tamamlayıcı metal oksit yarı iletken (CMOS) tabanlı, yüksek yoğunluklu mikroelektrod dizisi (HD-MEA) Cihazlar, subselüler seviyede yüksek mekansal çözünürlük ve çok sayıda okuma kanalları sağlar. Bu cihazlar, çok sayıda elektron tarafından tespit edilen her nöronla çok sayıda nöronun ekstraselüler aktivitesinin aynı anda kaydedilmesine olanak tanır. Kaydedilen sinyalleri analiz etmek için, spike olayları, "sivri uçlu sıralama" olarak adlandırılan bir süreç olan bireysel nöronlara atanmalıdır. Bir dizi kaynak sinyalinin doğrusal bir karışımı olan gözlemlenen sinyaller grubu için bağımsız bileşen (IC) Analiz (ICA) verileri körü körüne demixlemek ve bireysel kaynak sinyallerini çıkarmak için kullanılabilir. Bu teknik, nöronal kaynakları ayırmak için denetlenmeyen bir yöntemi temsil ettiği için HD-MEA kayıtlarındaki başak sıralama sorununu hafifletmek için büyük bir potansiyel sunmaktadır. Ayrılan kaynaklar veya IC'ler, daha sonra, tek nöron sinyallerinin tahminlerini oluşturur ve IC'ler üzerindeki eşik algılama, sıralı başaklanma sürelerini verir. Bununla birlikte, ekstraselüler nöronal kayıtların ICA gerekliliklerini ne derece karşıladığı bilinmemektedir. Bu yazıda, ICA'nın HD-MEA kayıtlarının sivri olarak sınıflandırılmasına uygulanabilirliğini değerlendiriyoruz. Yüksek zaman-zamanlı çözünürlükte kaydedilen hücre dışı sinir sinyallerinin analizi, kaydedilen verilerin tamamen doğrusal bir karışım olarak modellenemediğini ortaya koymaktadır. Sonuç olarak, ICA nöronal sinyalleri tamamen ayıramaz ve HD-MEA kayıtlarında başakta sıralama için tek başına bir yöntem olarak kullanılamaz. Simüle veri kümeleri kullanarak ICA'nın demixleme performansını değerlendirdik ve performansın nöronal yoğunluk ve başak amplitüdüne kuvvetle bağlı olduğunu bulduk. Ayrıca, ICA'nın en ciddi sınırlılıklarının üstesinden gelmek için postprocessing tekniklerinin nasıl kullanılabileceğini gösteriyoruz. Anahtar Kelimeler: sivri ayırma, çoklu birleştirme, çoklu elektrod. Bu çoklu boyutlu nöronal kayıtların hızlı bir şekilde şiddetlenmesini kolaylaştırmak için bu ileri işlem teknikleriyle birlikte ICA, uygulanabilir bir yöntemdir.

nevrofizyoloji araştırması sinir aktivitesinin ekstraselüler kayıtları, hücrelerarası etkileşimi incelemek ve fizyolojiyi daha iyi anlamak için desenler atmak için önemli bir araç haline gelmiştir Ve nöronal ağların bilgi işlemesi. Çok birleşimli kayıtlarda elektrotlar, çok sayıda bireysel nöronun eşzamanlı aktivitelerini izler. Analiz için, bireysel nöronların başak eğrileri daha sonra kaydedilen veriden çıkarılmalıdır; bu süreç genellikle "başak toplama" olarak adlandırılır (Lewicki, 1998). Genellikle, …

Devamını Oku »

Lipoprotein ile ilişkili ve Apolipoprotein ile Ortaya Konan De …

Lipoprotein ile ilişkili veya apolipoprotein hedefli nanopartiküllerin farmasötik taşıyıcılar olarak entegrasyonu yeni terapötik açıdan Ve nanotıp alanındaki teşhis yolları. Konsept, insan dolaşımındaki apolar lipidlerin ve yağın doğal transpozitifi olarak lipoprotein parçacıklarının özsel özelliklerini kullanmaktır. Ayrık lipoprotein birleşimleri ve lipoprotein tabanlı biyomimetik, özel tıbbi uygulamalar için manipüle edilebilen ve ayarlanabilen çok yönlü bir nanoparçacık platformu sunmaktadır. Bu makale, ilaç yüklü, yeniden …

Devamını Oku »

2018 Ford Mustang Standart Özellikler Sızdırılan Broşürde Ortaya Çıktı »AutoGuide.com News

2018 Ford Mustangı şimdiden girdi, ancak Ford o dönemde detayları aydınlattı. Ancak, yeni Mustang için bir filo broşürü, Amerikan otomobil üreticisi tarafından resmen açıklanmayan ayrıntılar sunan internette bir görüntü oluşturdu. Yeni Mustang, bu sonbaharda ABD'de bayiliklere yöneliyor ancak standart özelliklerin ve paketlerin hangisinde olacağını görmek için o zamana kadar beklemek zorunda değilsiniz. Broşürüne göre, 2018 Ford Mustang 2.3 litrelik EcoBoost …

Devamını Oku »

Harman Kardon Involve sadece ortaya çıktı!

Uzun zamandır ortalıkta dolaşan iddiaların ardından, Harman Kardon Invoke tamamen gün yüzüne çıkmış durum . İşte Microsoft 'un dijital asistanı Cortana destekli akıllı ev hoparlörü nün özellikleri. Harman Kardon Invoke özellikleri Gözenekli silindirik yapısıyla Amazon Echo ile oldukça benzeşen Harman Kardon Invoke'un Sonbahar ayları içerisinde ve Windows Redstone 3 ile birlikte gelena karşılık verdi. Şirketin bir önizleme sayfası oluşturduğu ürün, …

Devamını Oku »

Intel'in yeni dizüstü işlemcisi ortaya çıktı!

tarafından tarafından Kaby Lake mimarisi üzerine kurulu dört çekirdekli ve ultra düşük voltajlı işlemciler yakın zamanda sunulmaya başlandı. Kabile Gölü hasfi ufukta gözükmüş durum . Intel Core i7-8650U yolda Kaby Lake sonrasi temsilcisi ile birlikte gelmeyecek, ancak sadece yüzde 15 daha fazla performans sunacak olması oldukça önemli. Öne gelmiş bir geliş olarak, ultra düşük voltajlı seriye dört çekirdekli işlemcilerin dahil …

Devamını Oku »

2017 SsangYong Korando facelift: fiyatlar ve spesifikasyonlar ortaya

SsangYong, Nissan Qashqai'ye firmanın katma değerli alternatifinin en yeni versiyonu olan yeni geliştirilmiş Korando'nun fiyatlarını ve şartnamelerini açıkladı. Şu anda satış yapan alıcılar, temel SE araçlarından ve daha donanımlı ve daha pahalı olan ELX modellerinden seçim yapabileceğiniz iki farklı düzeltme seçeneği sunuyor. İki tekerden çekişli SE seviyesindeki Korando, aynı arabaya 18 bin 500 sterlinlik bir dört tekerlekten çekiş sistemi takılı …

Devamını Oku »

HTC U 11 tasarımı tamamen ortaya çıktı!

HTC'nin 16 Mayısta tanıtmak yeni amiral gemisi modeli olan HTC U 11 'nin özellikleri ile ilgili bir çokoda sahibiz. Özelliklerine sonra yeni cihazın tasarımı yavaş yavaş ortaya çıkmaya başladı. Evan Blass HTC U 11'in tasarımını çıkıyor koyan bir video paylaştı. İşte kırmızı HTC U 11! 91mobiles hazırlanan video, fabrika çizimlerine ve Evan Blass'ın verdiği bilgilere dayalı olarak hazırlanmış 3D görsellerden …

Devamını Oku »

Bilim adamları, yeni ve geliştirilmiş genom dizisini ortaya koyuyor …

                                                                                                          Daphnia türlerinin endüstriyel kirleticiler, toksik alglerin açılması veya termal stres gibi toksik elementlere nasıl tepki verdiklerini anlamak suretiyle, bilim adamları tarıma ve yol akışına veya sıcaklığa neden olan sıcaklıklara ve iklim değişikliğine bağlı çevresel değişikliklerin göller, nehirler ve duran cisimlerdeki nüfusları nasıl etkilediğini inceleyebilir suyun. Kredi: Matt Cashore / Notre Dame Üniversitesi      Birçoğu …

Devamını Oku »

Yeni Volkswagen Golf Bluemotion 1.5 TSI ayrıntıları ortaya

Yeni Volkswagen Golf, VW kendisi Golf Mk7.5 olarak adlandırılan yedinci nesil VW ailesinin hatchback bir facelifted versiyonu başlatıldı. Küçük styling tweaks ve bir donanım artırması ile, freshened golf, ayrıca bu bölümdeki büyük haber olan 1.5 litre turbocharged 'TSI' benzinli motor, kaputun altındaki yeni motorlardan yararlanır. • Yeni 2017 Volkswagen Golf: tüm ayrıntılar Volkswagen, arabanın etkin ve ekonomik Bluemotion varyantı hakkında …

Devamını Oku »

Yeni araştırma, ol için hapsedilmenin etkilerini ortaya koyuyor …

                                     50 yaş ve üstü Amerikalılar, hayatlarının bir noktasında hapsedildiklerini bildiren 50 yaş ve üstü Amerikalıların, emekliliğin çeşitli yönleri hakkında kaygılarını dile getirme, yakın geçmişte işsizlik yaşama ve daha az gelir kaynağı olma olasılığı daha yüksektir. 50 yaş ve üzerindeki Amerikalılar için yeni bir ulusal ankete göre Associated Press-NORC Halkla İlişkiler Araştırmaları Merkezi'nden emekli olmamıştı. Anket, hapsedilmenin, yaşlı Amerikalıların çalışma …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

S-palmitoilasyon (S-asilasyon), sistein kalıntılarının ortaya çıkmış bir dinamik post-translasyonel modifikasyonudur. S-palmitoylation (S-acylation) Proteinler içinde. Protein S-palmitoilasyon için güncel tahliller, bir afinite kolu (asil-değişimi) ile daha sonra etiketlenebilen bir serbest sistein sülfhidril ortaya çıkarmak için S-palmitoil gruplarının in vivo etiketleme veya kimyasal bölünmesini içerir. Asil-değiştirme kimyası kullanılarak protein S-palmitoilasyon için tahliller, bu nedenle, spesifik olmayan bulgulamayı önlemek için tipik olarak N-etilmaleimid kullanan S-palmitoillenmiş sisteinlerin bloke edilmesini gerektirir. Bu, basamaklar arasındaki reaktifleri çıkarmak için birden fazla çökeltiye dayalı temizleme basamağını gerektirir; bu genellikle değişken örnek kaybına, sinyal veya protein agregasyonunda azalmaya yol açar. Bunlar, bu tahlillerin hassasiyetini, güvenilirliğini ve doğruluğunu azaltmak için bir araya getirilir ve ayrıca gerçekleştirilmesi önemli bir zaman gerektirir. Bu yağış adımlarını, sulu bir Diels-Alder 4 + 2 siklo-ilave reaksiyonunda 2,3-dimetil-l, 3-bütadien ile N-etilmaleimidin kimyasal olarak süpürmesi ile ikame ederek hassasiyeti ve doğruluğu arttırırken, S-asilasyon, palmitoilasyon, S-palmitoilasyon, asil biyotin değişimi, asil-RAC, biyotin anahtarı, maleimid , N-etilmaleimid, sistein, tiol, ABE, Diels-Alder

Devamını Oku »

Deneylerde ortaya çıkabilecek yeni bir mekanizma ortaya çıkıyor …

                                                                                                          Model, deprem sırasında bir itme hatasının asılı duvarının (sağda) ayak duvarından (solda) nasıl bükülebileceğini gösterir. Kredi: Harsha Bhat / ENS     Felaket filmlerinde yaygın bir ihbar: depremin patlak vermesi, insanların ve arabaların hepsinin açık bırakılmasına ve yutmasına yol açıyor. Çatlayan toprak sinematik drama yaratabilir, ancak deprem bilim adamları uzun sürmesinin gerçekleşmediğini savundu.                                                                                 …

Devamını Oku »

Yeni bir araştırmada ortaya çıkan otomobil sigortası dolandırıcılığı türleri

İngiltere'de otomobil sigortası dolandırıcılığının çeşitli türleri dolandırıcıların düşük hızlı çöküşleri tazminat talep etme olasılıklarının en yüksek olduğunu gösteren yeni bir araştırmada ortaya çıkmıştır . Churchill Insurance'a göre, tüm sigorta dolandırıcılığının üçte birini aşan düşük hızlı çökmelerle otomobil sigortası dolandırıcılığı artıyor (aşağıdaki tabloya bakınız). Ayrıca dolandırıcıların mevcut olmayan yolcular için giderek tazminat talebinde bulunduğu tespit edilen raporda. "Fantom Yolcular" için yapılan …

Devamını Oku »

IPhone 8 kılıfı ortaya çıktı!

iPhone 8 ' tasarım ve iç yapısını göster tasarım şemalarından sonra iPhone 8 kılıfı ortaya çıktı. Kılıf, beklendiği gibi Touch ID'nin cihazın arkasında olduğunu dikey çift kamerayı ve uzun güç tuşunu teyit ediyor. İşte iPhone 8 kılıfı iPhone 8 ile ilgili Benjamin Geskin ve KK Leaks tarafından yapılan tasarım paylaşımlarının ardından sonraki çok kaynaklarında yeni iPhone'un kılıfını gösteren bir görsel …

Devamını Oku »

Bir ribozom ortaya çıkan zincirin yapısal bir topluluğu …

Özet Ayrıntılı resimler ribozom yapılarının ortaya çıkmasına karşın, Atomik seviyede yapısal ve eş-translasyonel Yeni polipeptit zincirlerinin katlanma özellikleri. Burada kullandık Bir çözücü hal NMR spektroskopisi ile bir Ribozom ortaya çıkan zincir kompleksi (RNC), E'de biyosentez sırasında oluşmuştur. Coli burada bir çift immünoglobülin benzeri alan katlanmış N-terminal bölgesi (FLN5) ve düzensiz ama kompakt C-terminal bölgesi (FLN6). FLN5'in yerli yapısını nasıl bir …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

BMW M550d xDrive, dört turbo ile ortaya çıktı

BMW 5 Serisi serisi, bu yıl yeni bir dört turlu M550d xDrive varyantıyla genişleyecek. BMW, dünyanın en güçlü 6 silindirli dizel motor olduğunu ve 0,46 mph'den 4,4 saniyede sprint aldığını iddia ediyor. M550d, dört M Performanslı TwinPower turboslu, yeni bir 3.0 litrelik altı silindirli dizel motora sahip bir salon veya Touring mülkü olarak satışa sunulacak. BMW, M550d'nin 1,000 rpm'den 450Nm …

Devamını Oku »

BMW M550d xDrive ortaya çıktı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                              Kaynak

Devamını Oku »

Mitsubishi, yeni sınırlı sayıda L200 Barbarian SVP'yi ortaya çıkardı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                              Kaynak

Devamını Oku »

Yeni BMW M4 CS, 454 bhp ve 32 kilo zayıflama ile ortaya çıktı

BMW, Şanghay Motor Show'da daha güçlü, daha hafif ve daha hızlı bir M4 lanse etti. Yeni BMW M4 CS'nin üretimi iki yıl ile sınırlı ve satışlar bu yıl başlayacak 89,130 ​​£ olan fiyatlarla başlayacak. Alman markasına göre, CS'yi normal M4'den ayıran şey, motorsporundan ilham alan karakteridir. M4 GTS düzeyinde değil, normal M4 modelindeki gelişmeleri açıkça görüyoruz. • En iyi performanslı …

Devamını Oku »

Apple marka otonom araç planları ortaya çıktı

     Google'ın Über ve Tesla gibi başlıca büyük Teknoloji şirketleri kendi kusursuz otonom ( sürücüsüz ) aracını yapma uğraşı içindeler. in da bir Birleşmiş Milletler üzerinde çalıştığını doğruladı.                           Apple'ın otonom araç planları ortaya çıktı! Haber'de bulunan görsellerden anlaşılabileceği üzere Apple bir otonom araç prototipi yapmış safra. 7 aşamadan bu bir test planı hazırlamış. sır gibi saklanan bu otonom …

Devamını Oku »

Lotus ekstra downforce ile ortaya çıktı

Lotus, dünya çapında 60 ünite ile sınırlı olan ve şimdi sipariş kitapları açık olan İngiltere'de £ 83,000 fiyatla yeni bir önyargılı Exige ortaya koydu. Exige Cup 380 olarak anılan Exige Sport 380'un daha hardcore bir versiyonu, yine de kardeşiyle aynı supercharged 375bhp V6 motorunu çalıştırıyor. Güç altı ileri manuel şanzıman aracılığıyla arka tekerleklere iletilir. 0-60mph 3.4 saniyede, üst hız ise …

Devamını Oku »

Hücre bölünmesinde yeni bir mekanizmanın ortaya çıkarılması

                                                                                                          Kanser hücrelerinde, iki uçlu iğdeki kusurlar, hücre bölünmesi sırasında kromozomları çok yönlü olarak çekmeye yol açar. Kredi: Northwestern University      Kuzeybatı Tıbbı bilim adamları, hücre bölünmesinde önemli olan kromozomun bir centromere bölgesinde belirli bir proteinde oynayan amino terminal metilasyon rolünü ve bu proteinin düzenlenmesinin, gelişimini nasıl etkileyebileceğini ortaya çıkarmıştır Kanser hücrelerinin Amino asit yan …

Devamını Oku »

Araştırma, gelir eşitsizliğinin insanları ittiğini ortaya koyuyor …

                                                                                                          Kredi: CC0 Public Domain     Kuzey Carolina Üniversitesi ve diğeri Kentucky Üniversitesi ile ikisi arasında araştırmacılardan oluşan üçlü, iki tür deneme gerçekleştirdi: Sonuçlar, bir ülkedeki gelir eşitsizliğinin Toplum, konumlarını yükseltme umuduyla daha fazla risk almak için en alttaki kişilere yol gösterebilir. Keith Payne, Jason Hannay ve Jazmin Brown-Iannuzz Ulusal Bilimler Akademisi Bildiriler Kitabında yayınlanan deneysel …

Devamını Oku »

HECT-family E3 ligazlar, hemen hemen her ökaryotik süreci kontrol etmek için protein substratlarını ubikitinleştirir ve bunlarda yanlış regülasyona uğrarlar. HECT-ailesi E3 ligazları, protein desteğini hızla kontrol etmek için, protein substratlarını ubikitinleştirirler ve bu proteinlerin tümü ökaryotik prosesleri kontrol etmek üzere hatalardan düzelirler. Çok sayıda hastalık. Bununla birlikte, HECT E3'lerin anlaşılması, seçici ve güçlü modülatörlerin azlığı ile sınırlıdır. Bu zorluğun üstesinden gelmek için, sistematik olarak HECT E3'leri inhibe eden veya etkinleştiren ubiquitin varyantlarını (UbVs) geliştirdik. 6 HECT-UbV kompleksinin yapısal analizi, E2-bağlanma bölgesini kaçıran UbV inhibitörleri ve bir ubikitin-bağlayıcı ekzositi işgal eden aktivatörler ortaya koydu. Dahası, UbVs, NEDD4 alt ailedeki HEK'ler arasında farklı düzenleyici mekanizmalar ortaya çıkardı ve HECT E3'lerin hücrelerdeki ve barsak organoidlerindeki terapötik olarak ilgili hedeflerinin modüle edilmesi için yararlı olduğu kanıtlandı ve hücre migrasyonunun düzenlenmesinde NEDD4L için rol teşkil eden bir genetik ekranda keşfetti. Çalışmalarımız, bir E3 ailesi boyunca aktiviteyi modüle etmek için UbVs'ün çok yönlülüğünü gösterir, mekanizmaları tanımlar ve HECT E3'lerin problama işlevleri için bir araç seti sağlar ve sinyal proteinlerinin ailelerini hedefleyen modülatörlerin sistematik olarak geliştirilmesi için genel bir strateji oluşturur. E1-E2-E3 çok enzimli basamakların aracılık ettiği ubiquitination, sayısız protein fonksiyonlarını düzenleyen baskın bir mekanizma olarak fosforilasyona karşı gelmektedir (Cohen ve Tcherpakov, 2010; Nalepa ve ark., 2006, 1949).

GİRİŞ ). Tekrarlanan katalitik döngüler, protein işlevlerini çok çeşitli şekillerde değiştiren çeşitli poliubikitin zincirleri ile çoklu lizin üzerinde modifiye edilmiş substratlarla sonuçlanır. E3 ligazlar, substrat özgüllüğünü ve ubikitinasyon topolojisini kontrol ettiğinden terapötik müdahale için cazip hedefleri temsil etmektedir (Nalepa ve diğerleri, 2006; Petroski, 2008). Bununla birlikte, E3 ligazlarını düzenleyen mekanizmaların çeşitliliğini belirlemek ve manipülasyonu için araç üretmek, düzenlemenin şifresini çözmekte …

Devamını Oku »

Infiniti, New York Motor Show'da QX80 Monograf SUV konseptini ortaya çıkarıyor

Infiniti, New York Motor Show'da yeni bir amiral gemisi Range Rover rakibini yaratma niyetini önizleyen yeni QX80 Monograf konseptini açıkladı. Birleşik Krallık'ta sunulması pek mümkün değildir. • En iyi geçit ve küçük SUV'lar satışa çıktı Tek bir uzmanlık alanıyla ilgili detaylı bir çalışma anlamına gelen QX80 Monografının gelecek üretim versiyonu, başta ABD ve Çin gibi pazarlarda hedefleniyor. Infiniti'nin en yeni …

Devamını Oku »

AeroMobil Uçan Araba Bu Ay Monaco'da Ortaya Çıkıyor

                         Bir 'uçan araba' çoğu için rüya gibi görünüyor ve doğru şekilde, yolların ne kadar sıkışık olduğu göz önüne alındığında. Fikir şimdiye kadarki en uzun zamandır kavramsal bir aşamadayken, dünyanın ilk uçan otomobilinin neredeyse üretime hazır bir versiyonunu yakında görebiliriz. Slovak otomobil firması – AeroMobil, uçan otomobilin geleceğindeki potansiyeli gören ve her şeyin uçan otomobil konseptini 20 Nisan 2017'de Monako'daki …

Devamını Oku »

Infiniti QX80 Monografi ortaya çıktı – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                 Infiniti QX80 Monograf ön "/> Infiniti QX80 Monograf ön" title = "Infiniti QX80 Monograf ön" />                                               

Devamını Oku »

VW İD. Crozz SUV, Şanghay'ın ortaya çıkmasıyla alay etti

Volkswagen, bu yeni teaser atışlarıyla önizlenen yeni bir elektrikli coupe-SUV ortaya çıkararak bu ayın Şangay Motor Show'da Skoda'ya katılacak. VW, konseptin ne adlandırılacağını resmi olarak ilan etmemesine karşın, Alman üretici geçtiğimiz günlerde markaya I.D adı ile başvuruda bulundu. Crozz. Coupe-SUV, VW'nun tamamen elektrikli kimlik kartının üçüncü üyesi olacak. Aile, kimlik belgesini takiben Kapak ve kimliği Buzz mikrobüsü. Teaser görüntüleri daha …

Devamını Oku »

İçerde'de büyük sır meydana ortaya çıkıyor

                     2017-04-14 19:26:00                                           Show TV ekranlarında reyting rekorları kıran İçerde'nin oğlu yayınlanıyor fragmanında büyük sır ortaya çıkıyor. Show TV ekranlarının reyting rekortmeni dizisi 'İçerde'nin oğlu yayınlanan fragmanında heyecan tavan yapıyor. COŞKUN, BÜYÜK SIRRI MELEK'E AÇIKLADI Dizinin önceki haftasında yayınlanan bölümünde Celal Baba ağır yaralı olarak hastaneye kaldırılmıştı. Coşkun uzun zamandır saklamıştı büyük sırrı Melek'e ait. CELAL BABA'YA SÖYLÜYOR …

Devamını Oku »

2017 Kawasaki Z1000 Başlatma Ayrıntıları Ortaya Çıktı

                         Hindistan Kawasaki Motors, yeni 2017 Kawasaki Z1000 modelini 22 Nisan 2017'de piyasaya çıkacak. Yeni Z1000, genel görünümü aynı kalacak şekilde çok küçük tasarım güncellemeleri alacak, ancak muhtemelen yeni bir renk ve yeni gövde grafikleri ile. Motor, mevcut modeldeki sıvı soğutmalı, dört zamanlı, sıralı dört motorla aynıdır. Güç çıkışı da aynı – 10,000 rpm'de 140 bhp ve 7,300 rpm'de 111 …

Devamını Oku »

Araştırma, türlerin korunması için yaşamsal bilgileri ortaya çıkarıyor …

                                                                                                          Kambur balinalar, bilim insanlarının uzun mesafelerden geçerken bireyleri izlemek için kullandıkları belirgin kuyruk izlerine sahipler, ancak uydu izleme, aldığı güzergâhlar ve seyahat ettikleri hız hakkında daha eksiksiz bilgi sağlar. Kredi: Anne Gordon, Panama'yı İzleyen Balinalar      Her iki kutbun balinaları uzun mesafeleri tropik sularda üreterek geçirir. Ekvador'daki Salinas Balina Müzesindeki Smithsonian bilim adamı Hector …

Devamını Oku »

New York Motor Show'da ortaya çıkan Toyota FT-4X Konsepti – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                                                                                    Devamını Okuyun                         …

Devamını Oku »

Aracı, bilgisayar mimarilerini denetler, kusurları ortaya çıkarır …

                                                                                                          Profesör Margaret Martonosi (merkez) ve lisansüstü öğrencileri Yatin Manerkar ve Caroline Trippel dahil araştırmacılar, bilgisayar işlemcisi tasarımlarını hafıza sorunları açısından kontrol ederek böcekleri ortadan kaldıran bir araç geliştirdiler. Araç, büyük bir açık kaynaklı yonga projesinde iyileştirmelere yol açıyor. Kredi: David Kelly Crow      En büyük teknoloji şirketlerinden bazılarının desteğiyle, RISC-V adı verilen büyük bir …

Devamını Oku »

2018 Jeep Grand Cherokee Trackhawk süper şarjlı 707 beygir gücü SUV ortaya çıktı

     Paylaşın      Facebook          Tweet          Pinterest          E-posta ile             2018 Jeep Grand Cherokee Trackhawk gerçekten ne zaman bir meseleydi, değilse: Sadece 707 beygir gücünde bir V8 yapmazsanız ve daha sonra değil bunu araçlarınızın mümkün olduğunca çoğuna koyarsınız , Özellikle de gaz ucuz olduğunda. Asla rahat bir SUV'un yerel sürükleme şeridine gitmeyi düşündüğümüz ilk şey olmadığını aklınızda …

Devamını Oku »

ABD Spesiyifi 2018 Volkswagen Golf New York'tan Öncesinde Ortaya Çıktı

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Skoda Vision E konsept iç mekanı Şangay'ın başlangıcından önce ortaya çıktı

Skoda Vision E konseptinin iç görüntüleri, otomobilin 2017 Şanghay Otomobil Fuarı'nda piyasaya sürülmesinin öncesinde piyasaya çıktı ve kabinin nasıl görüneceğini ortaya koydu. Ilk kez. Büyük cam yüzeyi, 20 dereceye kadar döndürülebilen heykel kabuklarından yararlanacak olan yolculara bol miktarda doğal ışığın ulaşmasını sağlar. Ve Vision E'nin sakinleri için konforlu bir alan sağlanmasının yanı sıra, Skoda, teknoloji sisteminin çizilmeye hazır olduğundan emin …

Devamını Oku »

BMW exec, şirketin ilk tamamen özerk otomobili için zorlukları ortaya koyuyor

OTOMOTİV HABERLERİ AVRUPA AYLIK DERGİ BMW iNext kendinden tahrikli araba 2021'de gelecektir. BMW, 2021 yılına kadar kendi kendine çalışan bir otomobil kurmayı hedefliyor ancak İnsan müdahalesine az müdahale gerektiren Seviye 4 ve Seviye 5 otomasyonuna ulaşmanın yolunda hala engeller var. BMW marka satış şefi Ian Robertson, otomobilin tamamen özerk sürüş sağlamadaki çözümlerine yakından baktı. Automotive News Europe Associate Publisher ve …

Devamını Oku »

Dodge, yeni Demon'u ortaya çıkarmaya hazırlandığı için Hellcat ateşi hafifletiyor olabilir

Top, Dodge Demon için bir teaser fotoğrafı arabanın hava barajını gösterir. Yukarıda, bir 2016 Dodge Hellcat Şarj Cihazı. Fotoğraf kredi: OTOMOTİV HABER GÖSTERİMİ        Dodge, bu hafta New York otomobil fuarında kas otomobil tarihinin en kötü korunan sırrını açıklayacak. Bu gösteri, markanın yeni performans halosu olması hedeflenen sürükleme şeridi için ağır modifiye bir Dodge Challenger olan Demon'ı tanıtıyor. Hangi iyi, …

Devamını Oku »

Aslışah Alkoçlar'ın yeni aşkı ortaya çıktı!

                     2017-04-08 12:16:00                                           Hakan Sabancı ile olan ilişkisini yakın bir zamanda tamamen Aslışah Alkoçlar'ın yeni sevgilisi ortaya çıktı. İşte sosyetik güzelin yeni aşkı … Hakan Sabancı ile birlikte yollarını ayıran Aslışah Alkoçlar, gönlünü bir başkasına kaptırdı. Sosyetik güzelin bir süredir tanıma aşamasında olduğu gönlündeki iseniz ikilinin yakın dostları. Hakan Sabancı'yla 1 yıllık aşkı Ekim 2016'da biten Aslışah Alkoçlar'ın …

Devamını Oku »

Yeni çalışma, bazı tavukların nasıl çizgileri çizdiğini ortaya koyuyor …

                                                                                                          Coucou de Rennes, karakteristik cinsiyet bağlantılı kısıtlama fenotipine sahip bir Fransız cinsidir. Kredi: Hervé Ronné, Ecomusée du pays de Rennes      Kuşlar plumage renginde ve modellemede şaşırtıcı bir çeşitlilik sergiler. Peki bu kalıpları yaratan genetik mekanizmalar nelerdir? Bugün PLOS Genetics'te yayınlanan yeni bir araştırmada, İsveçli ve Fransız araştırmacılar, tavukta cinsiyete bağlı kısıtlama kalıbının gelişimini …

Devamını Oku »

Lotus, klasik F1 ilham verici Evora Sport 410 GP Edition'ı ortaya çıkarıyor Lotus, başka bir özel baskı Evora Sport 410'u ortaya çıkardı ve markanın diğer özel sürümleri gibi, müşterilerin firmanın 'Exclusive 'Bitirme programı ve şirketin zengin geçmişi. • En iyi spor araba satışı 2017 Evora Sport 410 GP Edition olarak adlandırılan bu, Lotus'nun en başarılı Formula 1 otomobillerinden bazılarını hatırlatan bir renk şemasına sahip Kuzey Amerika pazarında yeni özel bir baskı otomobilidir. Altın kapaklı klasik siyah kaplama, 1972'den 1986'ya kadar Formula 1'de Team Lotus'un kullandığı renk şemasıydı. Dövme alüminyum jantlar altın renkli özelliklere sahipken, kabin içinde altın kontrast dikiş siyah Deri.      Başka yerde, araba değişmedi. Evora Sport 410, firmanın en güçlü otomobili ve 410 bhp'lik bir süper yüklü 3.5 litrelik V6 kullanıyor. Bol miktarda karbon fiber parça ve ağırlık azaltma tekniği sayesinde 1.370kg kuru ağırlık ile birleştirildiğinde, dört saniyede 0-62mph ve 190mph'lik en üst hızda iyi olur. Evora Sport 410, üretim sayıları bakımından sınırlıdır – Lotus, global sürüm için yılda 150 kere yapar. ABD'de standart araba fiyatı 104.200 $ 'dan (83.700 £), siyah ve altın renkli GP baskısı ise 110.000 ABD Dolarından (£ 88.500) fiyatlandırılacak.      Bu yılın başlarında, Lotus bir kezlik bir Evora Sport 410'u, The Lovely Me olan The Spy'de James Bond'un yönlendirdiği Esprit S1'e verdiklerini açıkladı. GP Edition'ın gelişiyle, Lotus'un esin kaynağı olan Evoras'ın gelecekte gelebileceği anlamına gelebilir.

GP Edition Evora Sport 410'u Esprit S1'den esinlenerek tercih ediyor musunuz? Yorumları bize bildirin! Kaynak

Devamını Oku »

2018 Volvo XC60 motorları, New York'tan önce ortaya çıktı

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Volvo'nun doğum günü 90'ıncı doğum günü New York otomobil fuarı ayına denk gelmekte ve açılıştan sadece birkaç gün sonra İsveçli marque, yeni XC60'yı Kuzey Amerika'ya tanıtmak için gösteriyi, Cenevre motor fuarında daha önce piyasaya sürüldükten sonra kullanacak Tamamen yeniden tasarlanan XC60, yaz aylarında ABD'de satışa sunulacak ve New …

Devamını Oku »

Kerimcan Durmaz'ın çocukluk fotoğrafı ortaya çıktı çıktı

                     2017-04-06 11:04:00                                           Sosyal medya fenomeni Kerimcan Durmaz'ın çocukluk fotoğraf ortaya çıktı. Aylık kazancı ve dudak ile sosyal medya fenomeni Kerimcan Durmaz'ın 7 yıl önce çekilen estetiksiz görüntülü yayın çıkmış; Çılgına dönen Durmaz "Bunları kötü niyetli, Kazancımı, popülerliğimi kıskanıyorlara açıklamasını yapmıştı. Estetiksiz fotoğrafların yankıları artık Kerimcan Durmaz'ın çocukluk fotoğrafı internete düştü. Beyaz gömleği, laciver yeleği ve papyonu ile …

Devamını Oku »

Bilişsel işlev bozukluğu, madde bağımlılığının önemli bir özelliği olarak ortaya çıkmış ve bağımlılık kontrolü üzerinde uzlaşmaya varan katkılar sağlamıştır

Davranışlar. Mevcut araştırmada, sağlıklı kontrollere (n = 13) ve hatta kokain kullanım bozukluğu (n = 14) olan bireylere kıyasla, aktif kokain kullanımı bozukluğu (n = 8) olan bireylerin, temel biliş üstü tanıma açık tanımlar gösterdiklerini belirledik Görsel algısal doğruluk görevinde objektif performans ve kendini bildiren performans güven arasındaki zayıf bir bağlantı olarak. Bu üst bilişsel açığa gri maddenin hacim azalması …

Devamını Oku »