25 Kasım 2017,Cumartesi
Anasayfa » Tag Archives: önceki

Tag Archives: önceki

İşgünü Yükselen Avrupa: Önceki Bir Noktadan Yapılan En İpuçları …

Avrupa İşgünü Yükseltmesi köşede. Ve daha önce hiç şovda bulunmadıysanız ya da bu ilk kez olsanız da, etkinlikten size mümkün olan en fazla değeri elde etmenize yardımcı olmak istiyoruz. Bu nedenle Barselona'daki bu yılki konferanstan en iyi şekilde yararlanmak için Ramboll'daki global İK ve istihdam operasyon müdürü Sussie Hrouda-Rasmussen'e sorduk. Daha önce Workday Rising'e gittiniz. En çok ne bekliyorsunuz?

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

İletişim Soruşturması: Bir Önceki …

Tüberküloz (TB) küresel sağlığa, üretkenliğe ve sosyoekonomik gelişim için en büyük tehditlerden biridir (1). 2014'te TB, 1, 3 milyon insan HIV bulaşmıştı ve şu anda dünya çapında enfeksiyöz hastalığın önde gelen ölüm nedenidir (2). TBC ile ilişkili kalıcı insan acısını gidermek için, Dünya Sağlık Örgütü, 2035 yılına kadar TB salgınını sona erdirmek için oldukça iddialı, çok sektörlü bir strateji önermişti …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

Ebru Şallı 18 yıl önceki halini paylaştı

                     2017-03-23 ​​21:22:00                                           Ebru Şallı, Azra Akın ile fotoğraflarını çeken fotoğrafçıları izledi. Ebru Şallı fotoğrafın altına "Ne çekmişiz biz canım Azra yaa! Bitmemiş valla … Tbt'ın hası yıl 1999 … benim yanaklar yine tosun tombalak maşallah .. 18 yıl önceye gidelim bakalım …" notunu düştü. Ebru Şallı Instagram hesabından zaman zaman önceki yıllara ait fotoğraflarını paylaşıyor.                                        …

Devamını Oku »

Antarktik penguen sayıları önceki tahminin iki katını …

                                                                                                          Adelie penguenleri, kaygan ve verimli yüzücüler, Antarktik kıtasında ve çevresindeki birçok küçük ada üzerinde yaşar      Bilim adamları Çarşamba günü koruma için sonuçları bulunan bulgularla, yaklaşık altı milyon Adelie pengueni Doğu Antartika'da yaşıyor ve daha önce düşündüğünden iki kat daha fazla yaşıyor.                                                                                 Avustralyalı, Fransız ve Japon bir ekibin araştırması, havadan ve …

Devamını Oku »

Okulu Asana Sıkı Takip Millî Eğitim Bakanlığı, milletvekilleri için milletvekili müdürlüklerine genelge göndererek okula gitmeyen öğrenciler konusunda tedbir Alınmasını istedi. MİLLİ Eğitim Bakanlığı'nın (MEB) önceki gün yayınlanan 2016 Faaliyet Raporu ' Bmd liselilerin yaklaşık yüzde 30'unun devamsızlık meydana çıktı çıkmıştı. Bakanlık mesleki ve teknik liselerde bunun azaltılması için okulları uyardı. MEB Müsteşarı Yusuf Tekin'e gönderdiğiniz genelgede, yapılan araştırmalara değinilerek devamsızlığın okul başarısı, terki, suç işleme ve zararlı madde kullanımı gibi bir çok konuyla ilgili hatırlatıldı. YASAL YAPTIRIM Devamsızlığı alışkanlık haline getirenler ile bir, Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreterliği'ni imzaladı. Okulda konuşmak ya da derslere hiç gitmeyen öğrencilerin okula devam etmesi için gerekli tedbir alınacak. Öğrenci ve velilerin bu konularda bilinçlendirilmesinde Aile ve Sosyal Politikalar İl Müdürlükleri'yle uzman desteği için şifa yapılacaktır. Öğrenci ve velilerin bu konularda bilgi ve beceri kazandırmak. . – Sorun çözümleri için Rehberlik Araştırma Merkezleri'nce yönetici ve öğretmenlere rehberlik çalışması yürütülecek. – Pansiyonlardaki öğrencilerin sosyo-kültürel faaliyetlerle okula bağlılıkları artırılacak. – Ekonomik çalışma için hazır okullarda aile birlikleri ve yerel yönetimlerle, maddi destek imkânları oluşturulacak. Öğrencinin 'Şartlı Nakit Desteği'ne, Ev ve Sosyal Politikalar Bakanlığına veya Belediyelerin Verdiği Sosyal Yardımlara, 10 ve 11'inci sınıfta yazın İŞKUR'ca uygulanan iş başı eğitme yönlendirilmesi ve 12'nci sınıfta işletmemede beceri eğitimine gönderilerek ailesine maddi destek olması sağlanacak. – Okul yönetimi, okul ve sınıf rehber öğretmeninden üretilmiş ekip kurularak nedenler araştırılacak. – Devamsızlık bir saat dahi olsa e-Okul'a işlenerek veliye e-posta veya SMS ile bildirilir. – Yapılan tüm çalışmalara rağmen okula devam saðlamamayan öğrenci MESLEK LİSLERİNDE FAZLA Bu arada MEB '2017 Performans Programında devamsızlık oranının en fazla mesleki ve teknik liselerinin değeri ile ilgili bilgi ve belge Yer almıştı. 20 gün ve üzeri devamsızlık yapan öğrenci oranı genel ortaöğretimde 2015'te yüzde 42.36 iken, 2016'da yüzde 28.74'e geriledi. Meslek liselerinde devsızlık oranı 2015'te yüzde 46.25, 2016'da yüzde 42.93 olarak tespit edilmişti. Anadolu imam hatip liselerinde, 2015'te 41.17, 2016'da 35.87 olarak raporda yer almıştı.

Kaynak

Devamını Oku »

PD1'in kristal yapısı, Haemophilus yüzey fibrili (Hsf) olağandışı büyük bir üçlü ototransporterdir En öldürücü soylar H tarafından eksprese edilen yapışkan (TAA). Influenzae . Hsf'nin patojen ve konukçu arasındaki yapışmaya aracılık ettiği bilinmektedir ve epiglotit, menenjit ve pnömoni gibi potansiyel olarak ölümcül hastalıkların kurulmasına izin verir. Yakın tarihli araştırmalar bu TAA'nın yeni bir 'saç tokası benzeri' bir mimari oluşturabileceğini önermekle birlikte, yüksek özünürlüklü yapısal veriler bulunmayan Hsf'nin karakterizasyonu silico modelleme ve elektron mikrograflarında ile sınırlı olmuştur. Burada, Hsf varsayımsal alan 1 (PD1) 'in kristal yapısı 3.3 Â çözünürlükte bildirilmektedir. Yapı, beklenmedik bir N-terminal TrpRing alanının mevcudiyetini açığa vurarak önceki alan açıklamasını düzeltir. PD1, çözülecek olan ilk Hsf alanını temsil eder ve böylece 'saç tokası benzeri' hipotez üzerine daha fazla araştırma yapılmasını sağlar. Anahtar Kelimeler: Hsf varsayımsal alan adı 1, trimerik ototransporter, Haemophilus influenzae adezin, hücre adhezyonu, Haemophilus yüzey fibril 1. Giriş Haemophilus influenzae üst solunum yolu enfeksiyonlarına, pnömoniye ve akut menenjit (Danovaro-Holliday ve ark. 2008 ; Murphy'ye bağlı enfeksiyonlara neden olan Gram negatif fakültatif anaerobik bir bakteridir ve diğerleri 2009 ). Farklı suşları H. Influenzae ya a-f serotiplerine, ikincisine de tipik olmayan olarak tanımlanan (Barenkamp ve St Geme, 1996 ) alt bölümlere ayrılmış şekilde kapsüllenmiş ya da kapsül içine alınmamıştır. H. Influenzae enfeksiyon, birçok pilus ve nonpilus yapışkan faktörlerin aracılık ettiği bir süreçte patojenin konak epitel hücresi astarlarına ve çeşitli ekstraselüler matriks (ECM) proteinlerine ( örneğin vitronektin) yapışmasıyla kurulur (Cotter ve diğerleri 2005 Virkola ve diğerleri 2000 ; Hallström ve diğerleri 2006 ). Yapışma, bakterinin konakçı tarafından temizlenmesini önlemesine izin verir ve sayısız virulans mekanizmaları yoluyla derin yerleşimli bir enfeksiyonun kurulmasını kolaylaştırır . Tüm suşları H. Influenzae patojeniktir, 1990'lı yıllarda etkili bir aşı kullanımına başlamadan önce hastanın morbidite ve mortalitesinin en yüksek oranlarından sorumlu olan virülan tip b (Hib) 'dir. Hib tarafından kullanılan böyle bir virülans faktörü, daha iyi karakterize edilmiş bir başka H ile önemli homoloji paylaşan bir trimerik ototransporter adhesin (TAA) proteini olan Haemophilus yüzey sarmalı (Hsf) dir. Influenzae ve diğerleri ve diğerleri 2015 (19459019). TAA'lar olarak bilinen HIA (Cotter ve ark. Salgılanan proteinlerin tip V ailesinin bir parçası olan, doğrusal bir fibril 'lollipop' yapısında düzenlenmiş üç ana alan türüne sahiptir. Baş ve küre alanları, hücre dışı bölgede N-terminüsünden serpiştirilir. YadA benzeri (YIhead) alanlar (Nummelin ve ark. 2004 gibi) ya çapraz mimarilere sahip β-tabakalardan oluşan ön alanlar ya da Triptofan halkası (TrpRing) alanları (Szczesny ve diğerleri 2008 (19459019)), tipik olarak proteinlerin yapışkan aktivitesine aracılık etmektedir. Sap, süper sargının derecesine ve yönüne (Hernandez Alvarez ve ark. 2010 ) bağlı olarak hepartan'tan pentadecad'a değişen periyodik üçlü üç boyutlu sargılı bir yapı oluşturur. Son olarak, C-terminal translokatör alanı, her bir altbirim bir amfipatik alfa-helis artı dört β-tabakaya katkıda bulunan bir trimerik β-namludur (Meng ve ark. 2008 ). Bu alan, proteinin geri kalan kısmının zar yoluyla translokasyonundan sorumludur ve tüm TAA'larda bulunur (Lehr ve diğerleri 2010 ). Son zamanlarda yapılan araştırmalar, Hsf'nin EM görüntülerine dayanan görünüşte yeni bir 'saç tokası benzeri' yapıya sahip olduğunu öne sürdü ( Singh ve diğerleri 2015 ). Paylaşılan bölgelerinde, Hia ve Hsf'nin% 72 sekans özdeşliği vardır (Hia161-1098 ve Hsf1484-2413, Ek Şekil S1), ancak tam uzunlukta trimerik Hsf (~ 750 kDa), Hia'nın (~ 340) iki katından daha büyüktür KDa). Hia'nın iki bağlayıcı alanı (HiaBD1 ve HiaBD2) de Hsf'de tanımlanmıştır (Laarmann ve diğerleri 2002 ); Bununla birlikte, Hia'nın aksine, Hsf'nin ek bir bağlanma alanı (HsfBD3) ve üç varsayımsal alanı vardır, yapısı ve fonksiyonu bilinmemektedir. Dahası, Hsf'nin alanlarını modellemeye yönelik sınırlı bir in silico yaklaşımı, ~ 200 nm'lik doğrusal bir TAA olmasının muhtemel olduğunu ortaya koymuştur (Singh ve diğerleri 2015 ). Buna rağmen, Hsf'nin elektron mikrografları H'de ifade edildi. Influenzae RM804 Hsf'yi doğrusal bir TAA olarak değil çift katlı bir saç tokası halkası yapısı olarak göstermiş görünüyor. Alan dizilişinin haritalanması, Hsf'nin N-ucunun zarın yakınında bulunması ve 'kıl tokası benzeri' hipotez ile tutarlı olmasını önerdi. Yapışkan işlevine ek olarak, Hsf'nin bağlandığı gösterildi. Kompleman inhibitörü vitronektin (Vn): etkileşim, HsfBD2 ve C-terminali Vn kalıntıları 352-374 ile eşleştirilmiştir (Hallström ve diğerleri 2006 ; Singh ve ark. 2014 ). Hem serumda hem de ECM'de bulunan bu glikoproteinin kazanılması, H'yi sağlar. Influenzae kompleman sisteminden kaçınmak ve epitelyal yüzeye daha iyi yapışmak suretiyle bakteri virülansını arttırmaktır. Bu kısmen Hia'nın aksine Hsf'nin en öldürücü, tiplendirilebilir H suşlarında ifade edildiğini açıklayabilir. Influenzae . Burada, bir Hsf varsayımsal alanının (PD1) kristal yapısını bildiriyoruz. Bu yapı, PD1, N-TrpRing: KG: TrpRing-C için yeni bir alan düzenlemesi ortaya çıkarır ve bu nedenle daha önce silico dizi analizi ile tanımlanan alan mimarisinin yerini alır. Bu çalışma, bu TAA'nın varsayımsallaştırılmış yeni 'saç tokası benzeri' yapıyı (Singh ve ark. 2015 kabul ettiği) belirlemek için Hsf'nin tam uzunluklu yapısını belirlemek için sürekli bir çaba oluşturmaktadır. 2. Gereçler ve yöntemler 2.1. Makromolekül üretimi 2.1.1. PD1-GCN4 Hsf alanı PD1, iki GCN4 bağlantı proteini arasında klonlandı. GCN4, doğal haliyle sargı bobini dimerini oluşturan iyi tanımlanmış bir maya transkripsiyon faktörüdür. Bununla birlikte, hidrofobik çekirdeğindeki spesifik kalıntıların mutajenezi GCN4'ün çeşitli oligomerik durumları benimsemesine olanak tanır. Bu nedenle, kararlı oligomerizasyonu kolaylaştırmak için füzyon proteinleri için ortak olarak GCN4 varyasyonları sıklıkla kullanılır. Bu durumda, fikir, HsfPD1'in dengeli trimerleşmesini kolaylaştırmak için hem N- hem de C-terminusuna iyi karakterize edilmiş trimer oluşturan bir GCN4 varyantı eklemek olmuştur (Hernandez Alvarez ve diğerleri 2008 (Hartmann ve diğerleri 2012 Koiwai ve diğerleri 2016 ) Lupas grubunun başarıyla kullandığı gibi. Bu füzyon proteini, PD1-GCN4, restriksiyonsuz (RF) klonlama kullanılarak üretilen bir pIBA-PD1-GCN4tri-His 6 plazmidinden eksprese edildi. PD1 geni, bir pET-16b- hsf polimeraz zincir reaksiyonu ile, 1-2414 plazmid. Primerler, hedef vektör olan pIBA-GCN4tri-His 6 (19459034) (Tamamlayıcı Tablo S1) tamamlayıcı çıkıntıları olan PD1 genini içeren bir 'megaprimer' üretmek üzere tasarlandı. 6 XhoI (New England Biolabs) ile restriksiyon sindirimi ile lineer hale getirildi ve PD1 genini (bunun içinde bulunan PIBA-GCN4tri-His 'Megaprimer') plasmid içine sokun. PD1-GCN4 ekspresyonu, 4 saat süreyle 8.6 μl M nihai konsantrasyona bir anhidrotetrasiklin hidroklorürün eklenmesiyle 0.6 OD 600 de indüklendi. Hücreler 193 K'de gece boyunca saklanan santrifüjleme (2000 g ile 10 dakika süreyle 277 K'de) ile toplanmış ve 50 m M 'den oluşan tampon [NaH 4 500 m NaCl, pH 8.0, 500 m . Hücreler sonikasyon ile parçalanmış ve süpernatanlar santrifüjleme (1600 g ile 10 dakika 277 K'de) ile toplanmıştır. Protein, immobilize metal iyon-afinite kromatografisi (IMAC) ile saflaştırıldı. PD1-GCN4 ihtiva eden temizlenen süpernatant, daha önce tampon A (2 x 6 ml; üç kolon hacmi) ile dengelenen bir Ni-NTA agaroz sütunu (GE Healthcare) üzerine tatbik edildi ve ajitasyon ile 1 saat süreyle bağlanmasına izin verildi. Proteinler, 50 m

NaH [500.04] NaCl'den oluşan tampon B ,% 10 gliserol, 300 m imidazol pH 8.0. Saflaştırılmış proteinin kalitesi, çok açılı bir lazer ışığı saçan (SEC-MALLS) aparatına (Şekil 1) bağlanan boyut uzaklaştırma kromatografisiyle değerlendirildi a ). SEC-MALLS, 50 m'lik Tris, 500 mM'lik NaCl, 50 mM Tris, 1 mM NaCl ve 1 mM NaCl'den oluşan tampon C ile dengelenmiş bir Superdex 200 5/150 …

Devamını Oku »