18 Aralık 2017,Pazartesi
Anasayfa » Tag Archives: önce

Tag Archives: önce

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

İlk iPhone, 10 yıl önce olanlarla buluştu!

Bundan 10 yıl önce San Francisco 'da düzenlenen Macworld Expo 2007 etkinliğinde sahneye çıkardı Steve Jobs, ilk iPhone modelinin duyurusunu gerçekleştirdi. Steve Jobs 'un' Dokunmatik kontrollere sahip geniş ekranlı bir iPod, devrim niteliğinde bir cep telefonu ve devrim niteliğinde bir internet iletişim cihazı. Bunların tamamı tek bir cihaz haline geldi. 'Ifadeleri şüphesiz telefon sektöründe büyük bir hareketlenmenin başlangıcını sağladı. 29 …

Devamını Oku »

Şeyh Said 92 yıl önce bugün idam edilmişti | Tarihten olaylar |

     Dünya Bülteni / Tarih Servisi Şeyh Said 92 yıl önce bugün idam edilmişti. Yakın tarihin en muğlak olaylarından biri Şeyh Said isyanı olarak gösterilen isyan ve sonuçları hakkında İstiklal mahkeme tutanakları açık açıklandı. Hükümet, Cumhuriyet idaresi için bir ayaklanma olduğu halde, isyana milliyetçi bir ayaklanma izlemini vererek, İngilizlerin kışkırtmalarıyla patlak verdiğini öne sürüyor. Dönemin başbakanı İsmet İnönü, İslami İslami …

Devamını Oku »

Bu basit kan testi kanseri yıllar önce öngörebilir

Yeni uç bir noninvazif kanser testi, basit kan testiyle birlikte kanser teşhisi yapabileceğimiz bir geleceğe giden yolda, fizibilite çalışmalarının ilk aşamasında umut verici sonuçlar ortaya koydu. " Sıvı biyopsi " de denen teknoloji, tümörlerden kopmuş DNA parçaları kanı için tarıyor. Şu anda kanseri tespit etmek için en iyi yöntem biyopsi yapmak, yani laboratuvar analizleri için tümör dokusundan küçük bir parça …

Devamını Oku »

Saçılar boyamadan önce bilmeniz gereken şey 5 şey

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağın yok yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Not 8 beklenenden önce gelebilir!

Galaxy S8 Galaxy S8 Galaxy S8 Galaxy S8 Galaxy S8 ile ilgili açıklamalar da belli olmaya başlamış . Hollandalı Galaxy Kulübü sitesinde yayınlanan yeni bir rapora göre Not 8, Android 7.1.1 ile test ediliyor. Not 8 Android 7.1.1 ile gelecek! Samsung, Galaxy Note 8 'i sürpriz bir şekilde Android O yerine 7.1.1 ile test ediyor. Bu da cihazın beklenenden çok …

Devamını Oku »

Dünya 300 milyon yıl önce böyleydi … Türkiye bir …

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

Önce kilo verdi sonra fenomen oldu!

                     2017-05-28 11:48:00                                                                      Avusturalya'da yaşayan Kate Yazar spor ve diyetle tam 55 kilo verdi. Bu makerasını sosyal medyada paylaşan Yazar fenomen haline geldi. Avustralya'da yaşayan Kate Yazar bildi bileli kilolarıyla başı dertteydi. Genç kadın 25 yaşına geldiğinde 120 kiloya kadar ulaşmıştı. Tam bu dönemlerde Nick Jones ile tanıştı ve nişanlandı. Çevresi sağlığı için kilo vermesi gerekenleri …

Devamını Oku »

Yeni seçmeden önce yapılacak birkaç karar …

                                     Yazımız hemen üzerimize geldiğinde, kulaklık sezonu tam güçtedir. Yeni bir alışveriş yapmak üzeresiniz, fantezi pazarlama, renkli kutular veya aşırı dolandırıcılıkla aldanmayın. Bunun yerine, alışveriş yaparken (önem derecesi size bağlı) bu özellikleri düşünün: kablosuz vs kablolu, kulakiçi kulaklık vs kulak, maliyet ve ses kalitesi (benim için 1 numara olacaktı).                                                                                 Kullanıcı yorumları da kritik, ancak bir yönden tamamen …

Devamını Oku »

Balinalar kısa süre önce yeni devler haline geldi …

                                                                                                          Hayat tarihinde şimdiye kadar yapılmış en büyük omurgalı hayvanı olan mavi bir balina, California kıyılarındaki krili engelliyor. Hugh Pearson ve David Reichert'in izniyle BBC programı 'The Hunt' için National Marine Fisheries Service izni # 16111 uyarınca fotoğraf çekildi. Kredi: Copyright Silverback Films / BBC.      Kaynak

Devamını Oku »

Ford'dan önce Hackett, Mich ofis mobilyası şirketinde

Eski Steelcase CEO'su Jim Hackett (61 yaşında) Ford'un yönetim kuruluna 2013'te katıldı. Geçen yıl, Mart 2016'da yönetim kuruluna adım atarak Ford Smart Mobility LLC'nin başkanlığına geçti. Mark Fields'ü Ford Motor Company'nin CEO'luğunun yerine geçirmeyi planladığı Jim Hackett, Fields'ın kendisini yönlendirmesi için kariyerinin çoğunu bir Michigan mobilya üreticisi olarak geçiren automaker'taki eski yönetim kurul üyesidir Yeni taşınabilirlik biçimlerine Ford'un yatırımları. Otomobil …

Devamını Oku »

Biz bu olaydan üç hafta önce ayrılmıştık

                     2017-05-21 10:51:00                                           Yakın zamanda evlenecekleri bekledi Murat Boz ve Aslı Enerjinin olay biçimi ayrıldı.Magazin gündemine bomba gibi düşen olay Murat Boz, Eser Yenenler'in programında bulunan Bahar ve Nihal Candan çiftiyle yakalantı. Yakışıklı şarkıcı, Antalya'da verildi konser sonrası şaşırtan bir itirafta bulundu. Ünlü şarkıcı Murat Boz, 19 Mayıs Gençlik ve Spor Bayramı'nda Antalya'nın Efsaneler Diyarı Legends'de Bir Konser …

Devamını Oku »

12 Erkekler Önce Fiziksel Olmayan Bir Şey Olarak Paylaşın …

freestocks.org 1. "Masanın sonundaki her hangi bir köşede olduğu ya da bulunduğu odanın köşesi her zaman olması en eğlenceli yerdi. O gerçekten eğlenceli ve aptalca ve bulaşıcı. " -Travis, 24 2. "Bir hikayeyi anlattığı her seferinde, denemeden bütün odasının dikkatini çekti. Asla gösterişsizdi, o sadece çok komikti ve eklemli. " -Steven, 28 3. "Baştan beri çok haklı olduğunu hemen söyleyebilirim. …

Devamını Oku »

Cicadas dört yıl önce ortaya çıktığında bilim adamları kazandı …

                                     Cicadas, saat iğnesi gibi 17 yılda bir Atlantik ortasında ağaç dallarına aşırı yük bindiriyor. Ancak bazıları – iklim değişikliğinden şüpheleniliyorlar – çalar saatlerini dört yıl erken duyuyor olabilirler.                                                                                 Son günlerde kırmızı gözlü, kütük şeklindeki böcekler, Kuzey Virginia'dan Bel Air, MD'ye kadar olan ağaçların altında ezici olmayan büyük sayılarda taranan lekeler tespit edildi. Bu fenomen, bölgedeki feryat …

Devamını Oku »

Esra Erol 10 yıl önce yaptı did aynı işlemi tekrar yapıyor

                     2017-05-03 16:28:00                                                              Malum o ki uzun süreden beri "Evlilik programları kaldırılıyor mu?" Sorusuyla haşır neşiriz. KHK ile zirve yaptı ve bütün hafta son bölüm sosyal medyada bu sorunun cevabı arandı. Hepinizin öğrenmiş olduklarını söyledi. *** Gelelim asıl konumuza … Yazımın başında da belirtildiği gibi son aylarda evlilik programlarıyla ilgili çeşitli iddialar sürekli gündeme getiriliyor. "Haa kaldırıldı, …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

PI3Kδ ve primer immün yetmezlikler – Avrupa PMC … Özet Birincil immün yetmezlikler, immün sistemin kalıtsal bozuklukları, Genellikle lenfosit gelişimi için gerekli genlerin mutasyonu ve Aktivasyon. Son zamanlarda, çeşitli çalışmalar, fonksiyon kazanım mutasyonları tespit etmiştir Fosfoinositid 3-kinaz (PI3K) genlerinde PIK3CD (ki P1106'yı kodlar) ve PIK3R1 (p85α'yı kodlar) Aktif olarak adlandırılan kombine bir immün yetmezlik sendromuna neden olan PI3Kδ sendromu (APDS) veya p1108-aktive edici mutasyona neden olan Yaşlı T hücreleri, lenfadenopati ve immün yetmezlik (PASLI). Paradoksal, Hem fonksiyon kaybı hem de bu genleri etkileyen fonksiyon kazanım mutasyonları Farklı mekanizmalar yoluyla olsa da, immünosüpresyona neden olur. Burada, Adaptif bağışıklıkta PI3Kδ'nın rolleri, klinik bulguları tanımlar Ve APDS'deki hastalık mekanizmalarını incelemek ve PI3Kδ'ya yeni bakış açıları vurgulamak Bu hastalardan elde edilen bulguların yanı sıra Klinik tedavi. Giriş Aktif PI3Kδ sendromu (APDS; PASLI olarak da bilinir), Içinde yeni tanımlanmış primer immün yetmezlik (PID) sendromlarının giderek artan sayısı Nedensel mutasyonlar, yeni nesil dizileme ile tanımlanmıştır. The APDS'nin klinik bulguları çeşitlidir ve heterojendir (Kutu 1), ancak hastaların çoğunluğu Tekrarlayan solunum yolu enfeksiyonlarıyla, sıklıkla hava yolu skarlasması ile birlikte görülen (Bronşektazi) ve kulak ve sinüs hasarı, ki bu antikorun (B hücresi) eksiklik. Herpes aile virüsleri ile şiddetli, tekrarlayan veya devam eden enfeksiyonlar, Kusurlu T hücre fonksiyonunu gösteren, bu durumda da sık görülür ve Bazı etkilenen bireylerde erken ölüm neden olur. Birçok hasta benign gelişir Hepatosplenomegali ile sıklıkla ilişkili olan lenfadenopati ve APDS ile ilişkili B hücre lenfoma riski önemli ölçüde artmıştır (Kutu 1). Viral duyarlılık artışı Enfeksiyon ve hafıza T hücrelerinin zayıf geri çağırma tepkileri APDS'yi ayırt eder İzole edilmiş hipogammaglobulinemi 1 – 4 dolayısıyla APDS kombine edilmiş olarak düşünülmelidir Bağışıklık yetersizliği 5 . 100'den fazla hasta APDS ile bugüne kadar bildirilmiştir, ancak kesin insidans henüz bulunmamaktadır. . Kutu 1 APDS'nin klinik özellikleri 6 APDS'li hastalar hem bağışıklık yetersizliği hem de bağışıklık özellikleri sergilerler Disregülasyon: Nükseden akciğer, kulak ve sinüs enfeksiyonları (kapsüllenmiş bakterilerle Olarak Haemophilus influenzae ve Streptokoklar Etkili olabilmek için opsonizasyona ihtiyaç duyan pneumoniae Öldürme) yakın evrenseldir ve yüksek bir insidans ile ilişkilidir Işitme bozukluğu ve bronşektaziyi içeren organ hasarı Havayolu korkutması) 1 4 . Herpes aile virüsü ile şiddetli, tekrarlayan veya kalıcı enfeksiyonlar Yaygın, özellikle kronik EBV veya CMV viremi ve HSV ve VZV Enfeksiyonlar 1 3 – 7 . Bazı solunum yolu virüslerinin sık izolatları 1 Fırsatçı enfeksiyonlar seyrek olmakla birlikte, birkaç hastada (örn., Adenovirüs ve echovirus) Tekrarlayan viral siğiller veya molluskum kontagiosum deneyimli Enfeksiyonlar 49 . Apse oluşumu, lenfadenit ve selülit insidansında artış Gram pozitif bakterilerle (çoğunlukla Staphylococcus Aureus ) ve mikobakterilerin hatalı öldürülmesi APDS'li bir hastadan izole edilen makrofajlar, Doğal bağışıklık 64 . Benign lenfoproliferasyon (lenfadenopati, hepatosplenomegali ve fokal Nodüler lenfoid hiperplazi) tüm hastalarda ortak özelliktir Bugüne kadar incelenmiş olan APDS Etkilenmiş hastalardaki lenfoid dokunun histopatolojik analizi Manto zayıflaması ile atipik folliküler hiperplaziyi gösterir APDS1'deki bölgeler ve APDS2'deki küçük B hücreli folliküller. Germinal merkezler Her ikisinde de T hücrelerini infiltre ederek (çoğunlukla PD1 pozitif) bozuldu APDS1 ve APDS2 APDS ile bağlantılı yüksek oranda bir lenfoma var ve bunları kapsıyor Geniş bir histopatolojik şekil yelpazesi 1 2 7 67 İmmün sitopenias (trombositopeni, hemolitik anemi ve nötropeni) Ve otoimmün benzeri katı organ koşulları (juvenil artrit, Glomerulonefrit, tiroidit ve sklerozan kolanjit) de var 7 66 ,% 34'lük bir frekansta APDS1'li 53 hastanın kohortu 7 Hafif gelişimsel gecikmeler hem APDS1 hem de APDS2'de görüldü. APDS2 olan 36 hastadan oluşan bir kohortta 7 Büyüme (Büyüme) Retardasyon APDS2 olan hastalarda yaygındır 6 73 74 ancak görünmemektedir Özelliği, APDS1'in heterozigot SHORT sendromlu (kısa boylu, boy kısalığı, Eklemlerin hiperekstansibilitesi, fıtı, oküler depresyon, Rieger anomali Ve diş çıkarma gecikmesi) 88 91 APDS heterozigot kazançtan kaynaklanır (GOF) mutasyonları Hiperaktivasyona neden olan PIK3CD veya PIK3R1 Sırasıyla protein ürünleri p1108 veya p85a, 1 – 4 . P85a düzenleyici altbirim ve p110δ katalitik altbirimi Birlikte heterodimerik lipid kinazı PI3Kδ oluşturur; B hücresi reseptörü de dahil olmak üzere bağışıklık sistemindeki hücrelerdeki çoklu reseptörler (BCR) ve T hücre reseptörü (TCR) yanı sıra sitokin ve kostimülatör Reseptörler. Bu aynı altbirimlerde homozigot işlev kaybı (LOF) mutasyonları neden olur İnsanlarda immün yetmezlikten oluşan belirgin ve daha seyrek bir şekil 8 – 10 ve bu belirgin ikiye bölünme, birlikte Etkilenen hasta gruplarının klinik özellikleri, anlayışımızı bildirmiştir. Bu derlemede, PI3Kδ hakkında bilineni özetleyeceğiz, odaklanacağız. Uyarlamalı bağışıklık tepkileri düzenlemesi üzerine. Bu bilginin büyük kısmı Gen hedefli fareler kullanarak yapılan çalışmalar. Ardından, şüphelenilen iki olguyu özetleyeceğiz Insanlarda PI3Kδ eksikliği bildirildi, daha önce tanımlanmadan önce APDS'nin klinik ve immünolojik belirtilerini ayrıntılı olarak açıklar. Sınıf I PI3K'lara genel bakış Sınıf IA PI3K'ler, Pı10a, pı10p veya pı108 katalitik altbirimi oluşturucu olarak Bir p85 düzenleyici altbirimi ile ilişkilidir; IB PI3K sınıfı, Bir p101 veya p84 düzenleyici alt-birim ile etkileşen p110γ katalitik altbirimi (). Pı10a ve pı10p Büyük ölçüde ifade edilirken, p110γ ve pl108 baskın olarak Lökositler tarafından ifade edilir. Fazlalık için önemli bir potansiyel olsa da Katalitik altbirimler arasında, her bireysel p110 izoformu için benzersiz roller var Farklı ifade şekillerini yansıtan ve aynı zamanda Kendi reseptörleri tarafından angaje edilirler 8 , 11 . Örneğin, p110a, Insülin benzeri reseptörler tarafından aktive edilir ve büyümeyi, metabolizmayı ve Angiogenesis 11 oysa p110β Metabolik sinyallemeye katkıda bulunur ve Fare nötrofilleri bağışıklık komplekslerine 12 , 13 . P110γ, Miyeloid hücreler ve kemotaktik tepkilere katkıda bulunur, ayrıca reaktif oksijen Nötrofillerdeki tür (ROS) üretimi 14 . P110δ ile birlikte, p110γ, pre-T hücresi sırasında da önemlidir Timusta gelişim 15 . P1106, Bu derlemenin odak noktası olan hemodiyaliz, hem lenfositlerde hem de Miyeloid hücrelerdir ve antijen reseptörleri, ko-uyarıcı reseptörler, Sitokin reseptörleri ve büyüme faktörü reseptörleri 8 PI3K altbirimleri ve APDS mutasyonları Sınıf Sınıf I PI3K'ler, PtdIns (4,5) P 2'nin fosforilasyonunu katalize eder. ila Bir membran görevi gören PtdIns (3,4,5) P 3 (PIP 3 ) üretirler Pleckstrin homolojisi (PH) alanları olan hücre sinyal proteinleri için ip. Göze çarpan Bunların arasında PDK1 ve AKT, bunlar gibi substratları fosforile edecek şekilde hareket ederler FOXO transkripsiyon faktörleri (inaktive hale gelir) ve regülatörleri MTOR kompleksi 1 (aktive olur). Bu nedenle, sınıf I PI3K'lerin aktivasyonu FOXO transkripsiyon faktörlerinin inaktivasyonu ile sonuçlanır. Lenfositlerde BTK ve İTK PIP 3 – Aktifleştirmeye katkıda bulunan tepki veren tirozin kinazlardır. Fosfolipaz C-gamma (PLCγ) ve diğer indirgeyici sinyal proteinleri (,). Lipid fosfataz PTEN, PIP 3 'i PtdIns'e (4,5) P 2 8'e dönüştürür. Sınıf IA PI3K düzenleyici altbirimler üç farklı gen tarafından kodlanır ( PIK3R1 PIK3R2 ve PIK3R3 ) (). PIK3R1 P85α, p55α ve p50α'yı kodlar (her biri bir alternatiften Transkripsiyon başlangıç ​​sitesi), PIK3R2 p85β'yı kodlar ve PIK3R3 p55γ 16 kodlar. Bu düzenleyici altbirimlerin SH2 etki alanları vardır ve bu bağlar Hücre yüzeyi reseptörlerinin fosforile YXXM motifleri ve membrana bağlı Proteinler. P85α, p55α, p50a ve p85β her yerde bulunur Ifade ederken, p55γ esas olarak beyinde ve testislerde 16 ifade edilir. Sınıf IA PI3K düzenleyici herhangi biri Altbirimler belirgin olmadan p110α, p110β ve p1108'e bağlanabilir seçicilik. PI3Kδ'nın, en iyisi, p85α'yı P1108, ancak p110δ ile diğer sınıf IA PI3K düzenleyici altbirimler de mümkündür. Ayrıca şunu da bilmek önemlidir: P85α birçok p110δ'dan bağımsız işlevlere sahiptir, çünkü aynı zamanda bağlayabilir P110α ve p110β 16 . Sınıf IA PI3K düzenleyici altbirimleri p110 katalitik altbirimlerini etkiler Üç şekilde 17 : proteolitik P110'un bozunması; P110 katalitik aktivitesini inhibe eder; Ve p110'u işe alıyorlar Altbiriminden plazma zarındaki tirozin fosforile proteinlere dönüştürülür. P85α'nın SH2 domenleri fosfotirozinler tarafından tutulduktan sonra, P110 ile inhibitör kontaklar hafifletilir 17 . Böylece, PIK3R1 genindeki mutasyonlar, PI3K aktivitesini, P110δ'nın parçalanmasına veya işe alımının azaltılmasına izin vererek Reseptörler ( PIK3R1 null veya LOF mutasyonları durumunda) veya tarafından P85α'nın p1108 üzerindeki inhibe edici etkisinin serbest bırakılması (durumda PIK3R1 GOF mutasyonları). Düzenleyici alt birimlere ek olarak, P110α ve p110δ RAS'ı bağlayabilir ve p110β, RAC'yi veya CDC42'yi bağlar. Bu küçük GTPazlar p110 altbiriminin membrana bağlanmasına yardımcı olur 17 18 . PI3Kδ ve bağışıklık: fareden alınan dersler APDS tanımından önce, rolü hakkındaki bilgilerin çoğunun Bağışıklık ve enfeksiyonda PI3Kδ, genetik ve farmakolojik Fare modelleri kullanılarak yapılan çalışmalar. APDS'ye neden olan GOF mutasyonları geçtiğimiz günlerde Artmış bazal ve uyarılmış PIP 3 seviyelerine ve PIP 3 – hastadan türeyen bağımlı sinyal iletim dizileri Lenfositler 1 – 4 ve bu hastaların incelenmesi bize yeni bilgiler verebilir PI3Kδ aktivitesinin dengesi bağışıklık hücresi işlevlerini nasıl düzenler. İşte, biz Farelerdeki bu çalışmaların bize ne öğrettiğini özetleyin, önce Mutasyon geçiren insan hastaların immünolojik fenotipleri PIK3R1 Veya PIK3CD

Fare B hücrelerinde PI3Kδ fonksiyon kaybı Farelerde, kemik iliğinde erken B hücresi gelişimi sadece hafiftir 19 – 23 p85α veya p1108'in kaybından etkilenir. Buna karşın p110α ve p110δ kombine kaybı, Pro-B hücresi safhasında 24 yakınlarında yakın komple geliştirme bloğu . Bununla birlikte, p85α veya p1108'den yoksun fareler Altbirimlerin foliküler B hücreleri daha az, marjinal bölge (MZ) B hücrelerinden yoksun ve …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Yeni Hyundai Kona SUV, Yaz başlangıcından önce altüst edildi

Hyundai, Kona'yı yeni bir crossover ile buluşturmak üzere Nissan Juke ile savaşmak için hazırlanıyor ve bu yaz bu yaz metalde tam başlayacak ve Yıl sonundan önce İngiltere showroomlarında olmak. Otomobilin ortaya çıkmasından önce Hyundai, arabanın yüzünün gölgeli bir resmi ile bize altüst etti ve Kore firması için ultra ince farlar kullanan cesur bir yeni tasarım yönü ortaya koydu. Teaser görüntüsü, …

Devamını Oku »

Skoda Vision E konsepti, Şanghay Otomobil Fuarı'ndan önce açıklandı

Skoda, 2017 Şangay Motor Show'undan önce özel bir etkinlikte yeni Vision E konseptini ortaya çıkardı. Elektrikli, dört tekerden çekişli bu makine, markanın gelecekteki üretim araçlarını etkileyecek teknoloji ve tasarım ayrıntılarını ortaya koyuyor. CEO'su Bernhard Maier, Auto Express'e, Vision E'nin üretim versiyonunu 2020 yılına kadar satışa çıkacağını doğrulamıştır. Skoda Vision E konseptinin görüntüleri, 2017 Şanghay Otomobil Fuarı'ndaki otomobilin başlangıcından önce piyasaya …

Devamını Oku »

'Dizel daha önce hiç olmadığı gibi saldırı altındadır – arabalarını çalıştıranlar da olduğu gibi'

Yeter artık yeter. Dizel otomobiller ve sürücüleri günlük olarak gayretle şeytanca ediliyor. Derv ile ilgili kıyamet ve kasvet artık umutsuzca daha önce tanık olmadığı bir kısırdöngü ile teslim edildi. Son zamanlarda iyi niyetle dizel araçlarına yatırım yapan bazı akılcı aileler şimdi "katil" otomobillerinin egzoz borularından gelen emisyonlarla vatandaşlarının yaşamlarını sona erdiriyor. Sadiq Han, Londra Belediye Başkanı ve İşçi Partisi'nin potansiyel …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

Skoda Vision E konsept iç mekanı Şangay'ın başlangıcından önce ortaya çıktı

Skoda Vision E konseptinin iç görüntüleri, otomobilin 2017 Şanghay Otomobil Fuarı'nda piyasaya sürülmesinin öncesinde piyasaya çıktı ve kabinin nasıl görüneceğini ortaya koydu. Ilk kez. Büyük cam yüzeyi, 20 dereceye kadar döndürülebilen heykel kabuklarından yararlanacak olan yolculara bol miktarda doğal ışığın ulaşmasını sağlar. Ve Vision E'nin sakinleri için konforlu bir alan sağlanmasının yanı sıra, Skoda, teknoloji sisteminin çizilmeye hazır olduğundan emin …

Devamını Oku »

PSA'nın lüks markası DS ilk önce kendi kendini sürüş teknolojisine kavuşuyor

PSA, DS 7 Crossback ile Seviye 2 otomasyon sunacak. Peter Sigal Otomotiv Haberleri Avrupa 9 Nisan 2017 06:01 CET PARIS – PSA Group, yeni DS 7 Çapraz Arkası SUV / DSV'de mevcut olan kendine park etme dahil olmak üzere, gelecek yılın başlarında başlayarak, otonom sürüşle ilgili zaman çizelgesinin ayrıntılarını sundu. Geçiş Üstün DS serisi, özerk ve diğer yüksek teknoloji özellikleri …

Devamını Oku »

YouTube kanalları kazanmadan önce izleyicileri kazanmalıdır …

                                                                                                          Google'ın sahip olduğu YouTube, eşleme reklamlarını uygunsuz içerikle azaltmayı amaçladığı için bazı kanallarda reklam yayınlamayı durduruyor      Kaynak

Devamını Oku »

2018 Volvo XC60 motorları, New York'tan önce ortaya çıktı

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Volvo'nun doğum günü 90'ıncı doğum günü New York otomobil fuarı ayına denk gelmekte ve açılıştan sadece birkaç gün sonra İsveçli marque, yeni XC60'yı Kuzey Amerika'ya tanıtmak için gösteriyi, Cenevre motor fuarında daha önce piyasaya sürüldükten sonra kullanacak Tamamen yeniden tasarlanan XC60, yaz aylarında ABD'de satışa sunulacak ve New …

Devamını Oku »

ALLAH'IN TÜM YARDIMI 1400 SENE ÖNCE GELMİŞTİR – ku …

ALLAH'IN TÜM YARDIMI 1400 SENE ÖNCE GELMİŞTİR – kuraninkaybolanyorumlari – Blogcu.com ] <! – ->                                                                                                                                                             ';                                                                         For (veri içindeki var i) {                                                                             Html + = "http://kuraninkaybolanyorumlari.blogcu.com/";                                                                             Html + = "http://kuraninkaybolanyorumlari.blogcu.com/";                                                                         }                                                                         Html + = "http://kuraninkaybolanyorumlari.blogcu.com/";                                                                     }                                                                     $ ("# Özellikli kutu"). Before (html);                                                                 }                                                             );                                                             }                                                             Var keyNone …

Devamını Oku »

“Önce Kitap Okuyalım Sonra Çık disariya Oynayalım”

Çankırı Belediyesi, Uçak Kütüphane alanını Geleneksel çocuk oyunları ile Donatti. Belediye, okul Kütüphanelerin bulundugu Alanları, Çocukların oyun Alanları Haline çeviriyor. Çankırı Belediyesi Çocuk Meclisi aktivite de Sonra ettik gerçekleştirilebilecekleri Fiziksel Temalı şimdi bahçelerinden Eğitim Projeleri Birimi, geleneksel ve yerel oyunlar okul bahçelerinin sonrasında uçak kütüphane alanına taşıdı. Uçak Kütüphane'ye giden pistte mektup, yağ satarım bal satarım, kaleli yakar top, tombik, …

Devamını Oku »

Yeni Gen Maruti Suzuki Swift Dzire Başlamadan Önce Kamuflaj Yapılmadan Beneklendi

                         Sana yeni nesil Maruti Suzuki Swift Dzire'nin bu yıl Hindistan'da satışa çıkacağını söyledik ve fırlatma beklenenden daha yakın olduğuna inanıyoruz. Yeni jenerasyon Swift Dzire'ın üretim hazır bir versiyonu Hindistan'da sans kamuflajı olarak görüldü ve arabanın giden modelden çok daha fazla premium olduğu görüşündeyiz. Aslında, otomobil geçen ay sızdırılan kaplamalara çok benziyor. Kozmetik eklemeler ve bu yeni kahverengi renk seçeneği …

Devamını Oku »

Çalışma daha önce bilinmeyen önbellekleme davranışını gözlemliyor

                                                                                                          Ocak 2016'da Utah'daki Grassy Dağları'nda buzağı karkası gömme porsuk kamerasından görüntü. Kredi: Evan Buechley.      Utah Üniversitesi, Utah'daki Great Basin Desert'de çöpçü davranışı incelendiğinde, Amerikalı bir piscin, daha önce başka bir bilim insanının belgelediği bir şeyi yapmadığını gözlemledi: Bütün bir baldır karkasını kendi başına gömmüş.                                                                                 Porsuk ve akrabalarının yiyecek mağazalarını önbelleğe …

Devamını Oku »

Porsche 911 GT3 RS facelift 2018'den önce spiee çıktı

Porsche yakın zamanda çekilmiş ve değiştirilmiş 911 GT3 modelini benzer güç yükseltmeleri ile takip edecek ve daha da fazla parkur odaklı kardeşi olan 911 GT3 RS'yi ve Casus fotoğrafçımız, yükseltilen aşırı 911 testini çimdikledi. Otomobil, Porsche'un en zor 911'i için akılda tuttuğu tasarım revizyonlarında büyük bir belirti görerek ince bir gizlilik giyiyor. Ön tarafta GT3'ün yeni önlüğünü taklit eden yeni …

Devamını Oku »

RNA helikazları, RNA yapılarını modüle etmek ve RNA-protein (RNP) kompleks montajını kolaylaştırmada temel roller oynamaktadır ] In vivo . Daha önceleri, laboratuarımızda S'de DEAD-box RNA helikaz Dbp2 gösterildi. Cerevisiae ko-transkripsiyonel olarak ilişkili mRNA'ya bağlanan protein Yra1, Nab2 ve Mex67'nin poli (A) + RNA üzerine etkili bir şekilde birleştirilmesini teşvik etmek için gereklidir. Ayrıca, Yra1'in doğrudan Dbp2 ile ilişkili olduğunu ve Dbp2'nin çözülme ve inhibisyon döngüsünü düşündüren Dbp2'ye bağlı dupleks çözme inhibitörü olarak işlev gördüğünü bulduk. Bunu test etmek için birlikte transkripsiyonel mRNP montajında ​​Dbp2 olaylarının sırasını aydınlatmak için bir dizi deney yaptık. Şimdi, Dbp2'nin RNA yoluyla kromatin içine alındığını ve Yra1 ve Mex67 ile geniş, RNA'ya bağlı bir kompleks oluşturduğunu gösteriyoruz. Dahası, tek moleküllü (smFRET) ve toplu biyokimyasal analizler, Yra1'in Dbp2'nin tek sarmallı RNA ile ilişkisini engelleyerek konsantrasyona bağlı bir tarzda çözmeyi engellediğini göstermektedir. Bu inhibisyon, Dbp2'nin mRNA üzerinde aşırı birikmesini ve RNA Pol II transkriptlerinin bir alt grubunun stabilize edilmesini önler. Yra1'in, mRNA'nın bir araya getirme işlemini Dbp2 ile sonlandırdığı bir model öneriyoruz. Anahtar kelimeler: DEAD-box, helicase, RNA-Protein kompleksi, kromatin, RNA [Giriş Gen ifadesi sayısız, koreografi yapılan basamakları içeren son derece karmaşık bir süreçtir . Giriş Ökaryotlarda transkripsiyon sırasında, yeni sentezlenmiş haberci RNA'ya (mRNA), nükleer ihracat ve çeviriden önce 5 'kapak, ekleme ve 3' son oluşumu da dahil olmak üzere çeşitli birbirine yakından bağlantılı işleme olaylarına rastlanır [1–3]. Bu adımların her biri boyunca, mRNA, her olgunlaşma evresinde kompozisyonu sürekli değişen haberci ribonükleoprotein kompleksleri (mRNP) oluşturmak için RNA-bağlayıcı proteinlerle bağlanır [4]. Uygun mRNP oluşumu gen ekspresyonu için kritiktir ve uygun biyolojik zaman noktasında doğru yapılandırılmış mRNA gerektirir [2,5]. Fiziksel özelliklerine bakıldığında, RNA molekülleri, uzun ömürlü ve alternatif konformasyonları açıp tekrar konrol etmek için büyük miktarda enerjiye ihtiyaç duyan kararlı ikincil yapılar oluşturma eğilimindedir [6,7]. Bu, hücrelerdeki RNA yapısal dönüşümlerini hızlandıran proteinlere ihtiyaç duyar. Tomurcuklanan mayada S. Cerevisiae mRNA, anormal yapıların oluşumunu önlemek için aktif mekanizmaların dahil edilmesini düşündüren, termodinamik tahminlerden farklı olarak in vivo olarak . Sürekli olarak, mayalanma maymundaki ATP tükenmesi, mRNA'da artmış sekonder yapıya neden olur [2]. Dahası, mRNA sekonder yapısının son genom analizleri, yapısal sapmaların gen regülasyonunu değiştirebileceğini gösteren düzenleyici bölgelerdeki tek nükleotid polimorfizmleri ile değiştirilmiş RNA yapısı (yani, miRNA-bağlanma alanları) arasında çarpıcı bir korelasyon bulmuştur Hücresel mRNA'ların yapısal yeniden düzenlenmesi için olası adaylar, RNA çözen veya RNA-protein (RNP) yeniden şekillendirme enzimleri olarak işlev gören ATP'ye bağımlı RNA helikazlarıdır [10,11]. DEAD-box proteinleri insan hücrelerinde yaklaşık 40 üyeyle (mayada 25) RNA helikaz familyasındaki en büyük enzim sınıfını oluştururlar. Bu sınıfın üyeleri, yaşamın tüm alanlarında bakterilerden memelilere kadar her yerde bulunur ve pre-mRNP meclisi [12] dahil olmak üzere RNA metabolizmasının her alanında yer alırlar. Örneğin, insan Tau proteinini kodlayan pre-mRNA'nın alternatif bağlanması, ekzon 10'un 5 'ek yeri [13]' in aşağısındaki bir kök-ilmek yapısıyla düzenlenir. U1 snRNP'nin tau ekzonunun 5 'ekleme sitesine erişebilmesi için, bu kök-döngünün DEAD-proteini DDX5 [13] tarafından çözülmesi gerekir. tau genindeki eklemenin yanlış düzenlenmesi, demans ile ilişkilidir ve doğru gen ifadesi için yeniden modellemenin önemini vurgulamaktadır [14,15]. Bununla birlikte, pre-mRNA / mRNA yeniden şekillendirme biyokimyasal mekanizması (lar) ımız konusundaki anlayışımız, birlikte transkripsiyonel süreçlerin karmaşık ve oldukça birbirine bağımlı doğası nedeniyle engellenmiştir. Dahası, bireysel DEAD-kutusu protein ailesi üyeleri, düzenleyici yardımcı proteinlerin verdiği biyolojik fonksiyonların çeşitlendirilmesiyle birlikte RNA tavlama, nükleotid algılama ve RNP yeniden biçimlendirme dahil olmak üzere geniş biyokimyasal farklı aktiviteler sergilemektedir S. DDX5'in cerevisiae ortologu Dbp2 [19] 'dır. Laboratuvarımız daha önce, Dbp2'nin kromatin kopyalama ile ilişkili olan aktif bir ATPaz ve RNA helikazının olduğunu tespit etmiştir [17,20]. Üstelik mRNA'ya bağlanan protein Yra1 ve Nab2'nin yanı sıra mRNA ihracat reseptörü Mex67'nin mRNA üzerine birleştirilmesi için Dbp2 gereklidir [17]. İlginç olarak, Yra1 doğrudan Dbp2 ile etkileşime girer ve bu etkileşim, Yra1'in Dbp2'nin çözülmesini kısıtladığını gösteren çoklu döngü, toplu analizlerde Dbp2'nin çözülmesini engeller [17]. Bununla birlikte, Yra1'e bağlı inhibisyonun mekanizması ve biyolojik rolü anlaşılamamıştır. Biyokimyasal, moleküler biyoloji ve biyofiziksel yöntemlerin bir kombinasyonunu kullanarak, şimdi Yra1'in Dbp2'nin aktivitesini -transkripsiyonel mRNP montaj adımları. Bu inhibisyon, transkript seviyelerinin bakımı için önemlidir in vivo . Tek moleküllü (sm) FRET ve floresan anizotropi çalışmaları, Yra1'in Dbp2'nin RNA ile ilişkisini önleyerek Dbp2'nin çözülmesini engellediğini göstermektedir. Sürekli olarak, maya hücrelerindeki Yra1-Dbp2 etkileşiminin kaybı, mRNA üzerinde Dbp2'nin transkripsiyon sonrası birikmesine neden olur. Birlikte ele alındığında, bu, Yra1'in in vivo olarak Dbp2'ye bağımlı mRNP birleşiminin bir döngüsünü sonlandırdığını düşündürmektedir

Sonuçlar Dbp2 işe alındı DEAD-box RNA helikaz Dbp2 ağırlıklı olarak aktif olarak transkripsiyona uğramış genler ile çekirdekte lokalizedir [20–23]. Dbp2'nin başlangıçtaki RNA aracılığıyla kromatin ile işe alınıp alınmadığını belirlemek için, RNaz ile veya olmadan RNase ile kromatin immünopresipitasyon (ChIP) analizleri yaptık [24]. Kısaca, endojen DBP2 kodlama bölgesinin 3 'ucuna kaynaşmış bir 3XFLAG epitop etiketi barındıran maya hücreleri, bilinen gen olan …

Devamını Oku »

Neden guillemot civcivleri yuvadan önce sıçrayacak …

                                                                                                          İki guillemot, onun soyundan bir erkek. Piliç yüzüyor ve dalış yapıyor ama henüz kendi yiyeceklerini yakalayamıyor Kredi: Lars Maltha Rasmussen      Kaynak

Devamını Oku »

ÖNCE YAŞAM

                                                                                13 Takipçi | 2 Takip                                                                                                                                                                                                                      2017-03-23 ​​01:02:00                                                              Önce Yaşam dergi                                           0                      0                      0                                                                                                                                                                                                                                                                        Kaynak

Devamını Oku »

BMW Mini'nin uzun süredir ABD'li reklam ajansı incelemeden önce hesabından istifa etti

Mini'nin ABD satışları, 2016 yılında% 11,1 düşüşle 52.030 araç oldu. Butler Shine Stern & Partners, BMW'nin Mini markası için ABD reklam ajansı olarak istifa etti, otomobilin yaklaşmakta olan yaratıcı incelemesinin öncesinde bir hareket. Son incelemeye katılan ve şirketi elinde tutan BSSP, ajansın geçen haftaki bir bildiriye göre, bir başka öngörülen inceleme öncesinde "sözleşmesinde fesih şartını başlattı" dedi. 2012'deki en son …

Devamını Oku »

Metanobaktiğin ve Bakır ile Bactanın Bağlantısı … Özet Methanobactins (mbs), düşük molekül ağırlıklı (<1,200 Da) bakır- Birçok metan oksitleyici bakteri (metanotrof) tarafından üretilen bağlayıcı peptidler veya chalkophores. Bu moleküller belirli demir bağlama sideroforlarına benzerlikler gösterir, ancak bakır sınırlamasına yanıt olarak eksprese edilir ve salgılanır. Yapısal olarak, mbs, bakır koordinasyon bölgesini oluşturan ilişkili tiyoamit gruplarına sahip bir çift heterosiklik halkayla karakterize edilir. Halkalardan biri her zaman bir oksazolondur ve ikinci halka bir oksazolon, bir imidazolon veya bir pirazindion parçasıdır. Mb molekülü, (i) halka oluşumu, (ii) bir lider peptid dizisinin bölünmesi ve (iii) bazı durumlarda bir sülfat grubunun eklenmesi de dahil olmak üzere bir dizi posttranslasyonel modifikasyona uğramış bir peptid öncüsünden kaynaklanmaktadır. İşlevsel olarak, mbs bakır alım sisteminin hücre dışı bileşenini temsil eder. Bakır alımındaki bu rolü ile tutarlı olarak, mbs bakır iyonları için yüksek afiniteye sahiptir. Bağlandıktan sonra, mbs hızla Cu 2+ 'i Cu 1+ e indirir. Bağlayıcı bağlamaya ek olarak, mbs çoğu geçiş metalini ve geçiş metaline yakın bağlar ve ana metanotrof yanı sıra diğer bakterileri toksik metallerden korur. Mbslere, başta redoks ve metal bağlayıcı özelliklerine dayanan diğer birçok fizyolojik fonksiyonlar atanmıştır. Bu derlemede, bu yeni metal bağlayıcı peptit tipinin mevcut durumunu inceliyoruz. Potansiyel uygulamalarını, mbslerin çoklu metallerin biyoyararlanımını nasıl değiştirebildiğini ve mbs'lerin metanotrofların fizyolojisinde nasıl oynayabileceğini de keşfediyoruz. GİRİŞ Methanobactins (mbs) ilk önce aerobik metan oksitleyici bakterilerde (metanotroflar) tanımlandı. Bu göze çarpan bakteri grubu, karbon ve enerjinin tek kaynağı olarak metan kullanarak büyüyebilir. Oksijen ve metanın bulunduğu ortamlarda bulunurlar ve biyosferde üretilen metanların çoğunun tüketilmesinde önemli bir rol oynarlar ve böylece küresel ısınmaya olan etkilerini azaltıyorlar (1, -4). Metanogenezis (5) yoluyla üretilen, ucuz, kolay bulunabilen ve yenilenebilir karbon kaynağı ile üretildikleri takdirde, metanotrofların toplu ve ince kimyasalların üretimi için ve çevre kirleticilerin biyolojik olarak temizlenmesinde önemli bir potansiyeli vardır (2, 6 , -8). Metan üzerinde yetişen bir bakterinin ilk raporu, 1906'da Hollanda'da Delft'te bulunan Beijerinck'in laboratuvarında çalışan Söhngen tarafından yapıldı; bu gaz, 1906'da Bacillus metanicus'un izolasyonunu Su bitkileri ve gölet suyu (9). 50 yıl sonra bu mikropun yeniden izole edildiği ve adı değiştirildi Pseudomonas metanica (10, 11). İkinci metanotrof, Metilokokus kapsülatus (Texas türü), 1966'da izole edildi (12). Methanotrof biyolojisindeki bir dönüm noktası, Whittenbury ve meslektaşları tarafından çeşitli karasal ve tatlı su ortamlarından izole edildiğinde ve metan üzerinde büyüyen 100 yeni aerobik metanotrofu anlatan 1970'de geldi (13). Daha sonra bu metanotrofların metan üzerinde yetişebilme yeteneği, karbon asimilasyonunun yolakları, istirahat evreleri (kistler ve sporlar) oluşumu, morfoloji, kompleks intrasitoplazmik zarın bulunduğuna dayanarak tip II'ye karşı tip II sınıflandırması geliştirdiler. Düzenlemeler ve DNA'ların mol yüzdeleri G + C içeriği. Daha sonra, Bowman ve meslektaşları çeşitli ortamlardan benzer sayıda metanotrof izole etti ve bunları Whittenbury ve meslektaşlarının programına ve 16S rRNA filogenezine (14, 15) göre sınıflandırdılar. O sırada hiçbir DNA sıralamasının yapılmamış olmasına rağmen, Whittenbury ve arkadaşlarının genel sınıflandırma şeması bugün metanotrofların gruplandırılmasında sağlam ve kullanışlı bir yöntem olmaya devam etmektedir. Buna göre şu anda 15 jenerat metanotrof bulunmaktadır Gammaproteobakteri sınıfının Methylococcaceae ve 3'ünde Methylothermaceae ailesi bulunmaktadır. Metilobakter Metilokaldum Metilokokus Metilogea Metiloglobulus Metilomagnum ] Metilomarinat Metilpomfurus Metilfosfamid Metilfosfat, Metilpomkarboksilik Asit Metanol, Metilokarboksilik Asit Metilpomkarboksilik Asit Metilpomkarboksilik Asit Metanol (19459016, Metilosarkin (19459016) ve Metilovüum ailesi metanotroflarıdır ve Metilohalobius Metilomarinovum , Ve Metiltermermus Metiltothermaceae familyasındaki metanotroflardır (16, -21, 227). Methylocystaceae familyasında ve Metilocella familyasında Alphaproteobacteria cins Methylosinus ve Methylocystis , Metiloferula ve Metilokapsa 'nın ailesi Beijerinkiaceae'de . Son 15 yılda, çoğul bileşiklerini büyüme için kullanabilen Metilokolella Metilokapsa ve Metilokistis cinslerinde fakültatif metanotroflara ilişkin raporlar artmaktadır Metan (22, -26). Günümüzde ayrıca, Crenothrix ve Clonothrix gibi diğer cinslerden filamentli metanotroflar ve yüksek sıcaklıklarda büyüyen ve düşük sıcaklıklarda yetişen cins Methylacidiphilum'un nonproteobakteriyel (verrucomicrobial) metanotrofları PH da yakınlarda keşfedilmiştir (27). Son olarak NC10 filumunun bir üyesi olan "Candidatus Metilomirabilis oksifizasyonu" zorunlu anaerob olmasına rağmen metan oksidasyonu için dioksijen ürettiğini gösterdi (28,29). Birlikte ele alındığında, bu veriler gezegenimizin birçok ekosisteminde metanotrofik bakterilerin yaygın doğasını açık bir şekilde göstermektedir. Metanotrofların fizyolojisi ve biyokimyası Metanotroflar metan'ı bir enerji kaynağı olarak kullanabilir ve ayrıca (6, 30, 31) için karbon sağlamaktır. Metanın metanole ilk oksidasyonu metan monooksigenaz enzim (MMO) tarafından katalize edilir. Aynı moleküler metan oksidasyon problemine (32, -37) evrimsel olarak bağımsız çözümler üreten MMO, membrana bağlı veya partikülat MMO (pMMO) ve sitoplazmik veya çözünür MMO (sMMO) olmak üzere iki yapısal ve biyokimyasal açıdan farklı formlar vardır . SMMO, aynı zamanda sınıf I ribonükleotid R2 alt-birimi için homolog olan çözünebilir di-demir monooksigenazlar (SDIMOs) (38) olarak bilinen geniş bir bakteri hidrokarbon oksijenaz grubuna ait olan üç komponentli bir bin nuclear demir aktif merkez monooksigenazdır Redüktaz. Methylococcus capsulatus (Bath) (39, -43) ve Methylosinus trichosporium OB3b (44, -47) 'den elde edilen iki çok benzer sMMO sistemi ayrıntılı olarak incelenmiştir. SMMO altı genli bir operon, mmoXYBZDC tarafından kodlanır ve üç bileşene sahiptir: (i) bir α-hidroksilazokinaz ile bir 250-kDa hidroksilaz (19459022) α alt birimlerinin (MmoX) substrat oksijenasyonunun meydana geldiği yerde çift çekirdekli demir aktif merkezini içerdiği yapı, (ii) flavin adenin dinükleotidli 39-kDa NAD (P) H bağımlı redüktaz (MmoC) FAD) ve Fe (19459022) 2 2 protez grupları ve (iii) protein B olarak bilinen bir 16-kDa bileşenini (MmoB) veya protez grupları içermeyen kuplaj / geçitlendirme proteini veya Metal iyonları (39, 48). Protein B için (39, 53, 54) hidroksilaz bileşeni (49, -52), nükleer manyetik rezonans (NMR) -tabutulan yapılar için X-ışını kristal yapıları vardır ve bu bileşiğin flavin alanı için bir NMR türetilmiş yapı vardır Redüktaz (55). Üç bileşen tarafından oluşturulan kompleks, küçük açı X-ışını saçılım analizi ve biyofiziksel olarak elektron paramanyetik rezonans spektroskopi, ultra-santrifüjleme ve kalorimetrik analiz ile yapısal olarak incelenmiştir (56, 57). SMMO'nun katalitik döngüsü kapsamlı bir şekilde incelenmiş ve çift-çekirdekli demir merkezindeki oksijen ve hidrokarbon aktivasyon mekanizmasının anlaşılmasına yönelik mükemmel ilerlemeler yapılmıştır (45) (45, 58, -62). Bununla birlikte, pMMO, bakır ve muhtemelen demir içeren membrana bağlı enzimdir (6, 37, 47, 63, 64). Tip I metanotroflardaki veziküler disklerin şeklini alan sıradışı intrasitoplazmik membranlar ve tip II organizmalarda eşleştirilmiş periferik tabakalar ile ilişkilidir (65, -75). İntrasitoplazmik membranlar pMMO'da zenginleştirilir ve sukroz yoğunluk gradyanlarında sedimantasyon hızı temelinde sitoplazmik membrandan fiziksel olarak ayrılabilir (76). PMMO'nun yapısı ve mekanizması hakkında bir anlayış, enzim çözünürken aktivite kaybından dolayı sMMO için olana göre daha yavaş ortaya çıkmıştır. PMMO, genler pmoCAB tarafından kodlanan yaklaşık 49, 27 ve 22 kDa'lık üç polipeptitten oluşur (77). Metanotroflarda genellikle bu pmo genlerinin birden fazla kopyası vardır (78, 79). Son yıllardaki araştırmalar, doğal pMMO'nun, hidroksilamin oksidoredüktaz ve amonyak monooksigenaz redoks çiftleri (82, -85) için bulunana benzer şekilde, pMMO'ya elektronlar (80, 81) sağlayabilecek metanol dehidrojenazı (MeDH) ile kompleks oluşturduğunu göstermiştir ). Bazı metanotroflar, mesela M. Kapsülatus (Banyo) ve M. Trichosporium OB3b, her iki MMO formunu üretebilir. En bilinen metanotroflar yalnızca pMMO'ya sahiptir, örneğin Metilomonas metanika Metilomikrobiyum album BG8, Metilokistis parvus OBBP ve verrukomikrobik ve NC10 metanotroflar. Beijerinckiaceae ailesindeki, örneğin Metilasella silvestris ve Metiloferula stellata içindeki sadece birkaç metanotrofun sMMO'ya sahip olduğu, ancak pMMO'ya sahip olmadığı (21, 86) MMO tarafından üretilen metanol, bir kalsiyum veya nadir toprak bağımlı pirroloquinoline quinone (PQQ) içeren MeDH (87, -91) ile formaldehite oksitlenir. Formaldehit, metanotrofik metabolizmanın metabolizmasının önemli bir koludur ve bir karbon (C 1 ara ürününün enerji elde etmek için CO 2'ye oksitlenebildiği veya asimile edildiği noktayı temsil eder Biyokütleye dönüştürdü. Formaldehid toksik olduğundan, metanotroflar bu metabolik ara maddenin birikimine karşı kendilerini korumalıdırlar. Formaldehit metabolizması için çoklu yollar metanotroflarda bulunur (2, 26, 92, -96). Örneğin, formaldehitin oksidatif dissimilasyonu, boya bağlı membrana bağlı (93) yoluyla ya da NAD + yoluyla tetrahidrometanopterine (H 4) [97,98] konjügasyonuyla ortaya çıkabilir ] Bağımlı (95, 96, 99) formaldehit dehidrogenazlar. Formül, formaldehidin formaldehit dehidrogenazlar tarafından oksidasyonundan kaynaklanır ve daha sonra metan, biyosentetik reaksiyonlar ve enerjinin oksidasyonu için NADH üreten bir NAD + [bağımlıformatdihidrojenazilekarbondioksit'eoksitlenirHücreiçinesil(100-102)Metanotroflaraynızamandaalfaproteobakteriyelvegammaproteobakteriyelmetanotroflardaaktifolanformaldehitinbiyokütleyeserinveribulozmonofosfat(RuMP)döngülerinefiksasyonuiçinikiyolasahiptirMetanotroflardakikarbonfiksasyonyolaklarıkapsamlıolarakgözdengeçirildi(bkzÖrneğinreferans6) Metanotroflardaki "Bakır Anahtar" Metan karakterizasyonu için erken teşebbüsler MMO'nun hücresel konumu hakkında farklı raporlar vasıtasıyla oksidasyon karmaşıktı. MMO'lar, suşuna ve bazı suşlar için raporlama laboratuvarına bağlı olarak çözünebilir veya membran ile ilişkili olarak tanımlanmıştır. Çeşitli gruplar başlangıçta partikül veya zar fraksiyonunda aktivite bildirdiler (103, 104), buna karşılık diğer gruplar çözünür fraksiyonda aktivite saptamıştı (105, 106). Sonraki çalışmalar hücresel konumun ekim koşullarına göre değiştiğini gösterdi. Oksijen kısıtlamasının çözünür fraksiyonda metan oksidasyonunu indüklediği bildirildi M. Trikosporium OB3b (36, 107). Bununla birlikte, oksijenin düzenleyici faktör olmadığı ve membrana bağlı ve çözünen aktiviteler arasındaki geçişin biyokütle konsantrasyonuyla ilişkili olduğu gösterildi (108). Bu "geçiş" in keşfedilmesinde tanımlayıcı an, Dalton ve meslektaşlarının M büyümeye çalıştıkları zamandı. Parvus OBBP, kemostat kültüründe yüksek hücre yoğunluklarına. M. Parvus OBBP, nispeten düşük hücre yoğunluklarında metan, hava ve nitrat mineral tuzları (NMS) çözeltisiyle birlikte verildiğinde büyümeyi durdurdu. Bununla birlikte, ek eser element çözümü eklendiğinde, kültürler derhal büyümeye başladı. İz element solüsyonundaki "gizli içerik", bakır iyonlarına indirgenmiştir (108). Daha sonra, M. Parvus OBBP, yalnızca bakır iyonlarına yüksek gereksinim getiren pMMO içeriyordu ve M ile o sırada gözlenen aynı yüksek hücre yoğunluklarına ulaşmasına izin verecek bir sMMO içermiyordu. Kapsülatus Banyo ve M. Trichosporium OB3b, bakır sınırlaması altında. Aynı suşlarla karşı karşıya kalındığında, suşlar sMMO'nun ifadesine geçti ve büyümeyi sürdürdü (35, 109). İlginç bir şekilde, bakırın daha önce sMMO içermeyen metanotrof olan Methanomonas margaritae 'nın büyümesini arttırdığı gösterildi, ancak bu orijinal gözlemler hiçbir zaman daha fazla araştırılmadı (110) Dalton ve arkadaşları Gözlemlerini detaylı bir şekilde incelediler ve bu "bakır geçiş" in varlığını kurdular, yani, iki farklı MMO formunun, hem sMMO hem de sMMO'ya sahip olan metanotrof kültürlerinin bakır-to-biyokütle oranına yanıt olarak metanotroflardaki ifadesinin düzenlenmesi PMMO. Metanotrofların metal bağımlı büyümesi üzerine daha önceki gözlemlerin birçoğunu açıklamalarını sağladı. Örneğin, M. Kapsülatus Banyo, sMMO'nun ekspresyonu yalnızca ortamdaki bakır iyonları tükendiğinde yüksek hücre yoğunluklarında gözlemlenirken, fazla bakır iyonlarının ilavesi bu metanotrofun aktif pMMO'yu ifade etmesine izin vermiştir. Daha sonra, Murrell ve meslektaşları moleküler seviyede, düşük konsantrasyonlarda bakır iyonlarıyla büyümenin altında sMMO ifadesi, sMMO gen kümesinin yukarı akışında σ 54 promotöründe başlatıldığını gösterdi ( mmoXYBZDC ). Tersine, yüksek bakır büyüme koşulları altında, sMMO ekspresyonu bastırılmış ve pMMO kodlayan genlerin yüksek seviyelerde ekspresyonu ( pmoCAB ) her ikisine de izin vermiştir. Trichosporium OB3b ve M. Kapsülatus Banyo, pMMO (34, 111, -113) kullanılarak büyüyecektir. Daha ileri araştırmalar bakırın metanotrofik fizyolojiyi ve gen ifadesini daha geniş ölçüde etkilediğini ortaya koymuştur. Örneğin, metanotroflardaki intrasitoplazmik zar içeriğinin büyüme ortamında bakır arttıkça arttığı bulundu (66, 109, 114). Bununla birlikte, bu tamamen beklenmedik değildi: pMMO'nun intrasitoplazmik zarlarda lokalize olduğu göz önüne alındığında, pMMO'nun daha fazla ekspresyonu ve aktivitesi bu zarların mantıksal olarak daha fazlasını gerektirir. Bununla birlikte, daha şaşırtıcı bir şekilde, pMMO'nun ve mxa operon tarafından kodlanan PQQ'ya bağlı MeDH'nin, intrasitoplazmik membranlara sabitlenmiş bir süper kompleks oluşturduğunu ve elektronun, PQQ-bağlantılı MeDH'den pMMO'ya In vivo metan oksidasyonunu tetikleyebilir (80,81). Son bulguyu destekleyerek yakın zamanda, pmo genlerinin ekspresyonu arttıkça arttığını değil, mxa operonundaki genlerin çoğunun da arttığını bulduk ) Proteomik yöntemle, metanın karbondioksit ile oksitlenmesindeki ilave basamaklar, lipid, hücre duvarı ve membran sentezinde rol oynayan proteinler gibi bakır kullanımının artmasıyla aşırı eksprese edildiği de gösterilmiştir ( 66, 115). Tersine, metanotrofların karbonu metandan poli-3-hidroksibutirat'a yöneltme yeteneği, bakırın bulunabilirliğini azaltarak artar (66, 116), bu da metanotrofların enerji metabolizmasının bakır tarafından kontrol edildiğini düşündürmektedir. Böyle bir sonuca Dalton ve arkadaşları daha önce ulaşmıştı ki metanotroflardaki metanotroflardaki biyolojik kütle verimi ve karbon dönüşüm etkinliği, bakır arttıkça, yani metanotroflar sMMO ifade ederek pMMO'yu ifade etmeye geçtiğinde (117) arttığını gösteriyordu. Dış zarın dış yüzeyindeki "yüzeysel" veya proteinler, bazı metanotroflarda bakır bulunması ile de kontrol edilir. Bakır alımına dahil olduğuna inanılan çok sayıda çoklu sitokrom ve proteinin ifadesi de bakırın bulunabilirliği arttıkça değişir ve çoğu durumda azalır (118, -123). Metanotrofların bakırı nasıl tuttuğu üzerine ilave bilgiler, yeni bir bakır depolama proteini ailesinin Csps'in keşfedilmesiyle sağlandı . Trikosporyum OB3b (124). Bu metanotrof, üç Csp'ye sahiptir: Csp1 ve Csp2, ikiz arginin translokaz hedefleme sinyal peptidlerini öngörmüşlerdir ve bu nedenle katlanmanın ardından sitosolik Csp3'den sonra ihraç edildiği düşünülmektedir. Csp1, paketin çekirdeğini gösteren Cys kalıntıları vasıtasıyla 52 Cu 1+ iyonuna kadar bağlanabilen dört heliks demetinin bir tetramerini oluşturur. SMMO'ya geçiş, vahşi türe göre, Δ csp1 csp2 mutantında hızlandırılmış olup, bu proteinlerin pMMO için bakır depolamada rol oynadığını ve bakır sınırlandığında bir dahili bakır kaynağı temin ettiğini düşündürmektedir. Bu koşullar altında, tüm Cu 1+ 'i Cspl'den kolayca kaldırabilen ve dolayısıyla Csp1 bağlı bakırın kullanılmasına yardımcı olan bir rol oynayabilecek mb üretilmektedir. ] Bir bakıra özgü alım sistemi öneren kanıtlar Bakır özgül alım sistemi ve hücre dışı bir bakır bağlama ligandının üretilmesi için ilk kanıt, yapıcı sMMO mutantlarının (sMMO ) fenotipik karakterizasyonu sırasında ortaya çıktı. C ) M. Trikosporyum [1958016] OB3b (125, 126). Phelps ve ark. (126), beş sMMO C mutantını M kültürleyerek izole etti. Trikosporium diklorometan mevcudiyetinde OB3b, metan monooksigenaz ile formetil klorüre dönüşümü için kometabolik dönüşümü takiben bir mutajen olarak işlev görür. SMMO C fenotipine ek olarak, sMMO mutantları bakır alımında kusurluydı (125, 127, 128). Kültür ortamında çözünür olmayan bakır karşısında sert bir artış da gözlendi ve Fe'ye benzer bir ekstraselüler Cu 2+ kompleks yapıcı ajan (lar) üretimine ilişkin spekülasyonlar teşvik edildi Fe 3+ Komplike siderophores (127). Sonraki çalışmalar düşük molekül kütleli bir bakır bağlama ligandının varlığını ortaya çıkarmıştır, ancak bu bileşiğin kimliğini belirlememişti (125, 127). Methanobactin'in İlk Tanımlanması ve İzolasyonu (Bir Bakır Bağlayıcı Bileşik veya "Chalkophore") Biraz paradoksal olarak, "bakır bağlayıcı ligand" veya "bakır bağlayıcı bileşik" önce M'den izole edildi. Kapsülat pMMO'nun arıtılması sırasında ve dolayısıyla yüksek bakır konsantrasyonlarında (73) banyo. Bu bakır bağlayıcı bileşiğin pMMO'dan ayrılması, düşük molekül ağırlıklı bir sarı-flüoresan bakır ihtiva eden molekülü ortaya çıkarmıştır. Bu molekülün renk ve flüoresan özellikleri, düşük bakır ortamda kültürlenen hücrelerde görülen suda çözünebilen pigmentinkine benzerdi (73). Bu suda çözünür pigmentin karakterizasyonu, pMMO ile birleşmiş bakır bağlayıcı bileşik ile özdeş olduğu ortaya çıktı (73, 128). Methanotroflarla suda çözünen pigmentlerin üretimi, birçok tip suşun ilk izolasyonu sırasında 40 yıl önce kaydedildi ancak düşük demirli ortamda kültürlenen hücrelerle ilişkilendirildi (13). Bakır bağlayıcı bileşik, molekülün Gram pozitif bakterilere karşı antimikrobiyal etkinliğine dayanılarak sonuçta metanobaktin (mb) olarak adlandırıldı (129, 130). Tanımlandıktan sonra, bu bakır bağlama bileşiği, bir dizi farklı metanotrofda izole edildi veya tanımlandı; bunlara aşağıdakileri içeren metil bromür albumin BG8 (131), Metiloksisit soyu SB2 (132), Metiloksisit (133), (197) Methylocystis hirsuta Methylocystis M türü (133) CSC1 (133) ve (suş SV97). Mb'lerin kristal yapıları M. Trichosporium [1358.016] OB3b (134,135), M. Hirsuta CSC1 (133) ve Metiloksisit suşu M (133) saptanmıştır. Ayrıca, Methylocystis suşu SB2 (132) ve Mbr'lerin kimyasal yapıları. Rosea (133) çıkarıldı. Bu yorum farazi mbs sıralı genomları ile Methanotroph anlaşılabilir sağladı bu mbs üzerinde durulacak. Methanobactins olarak Chalkophores İşlevsel olarak, mbs siderofor benzer. Sideroforlarda olduğu gibi, düşük bakır koşullarında (125, 126, 128, 136, -138) bakteriler tarafından üretilen düşük moleküler kütleli (<1,200-Da) bileşiklerdir. Yunancadan demir taşıyan ya da demir taşıyan siderophores'in adlandırılmasından sonra, mbsler chalkophores (bakır taşıyan ya da bakır taşıyan) (134, 139). Mbs şu anda bu grubun bilinen tek temsilcisi. Bir bakır alım sisteminin hücre dışı bileşeni rolü ile tutarlı olarak, mbs bakır iyonları için bilinen en yüksek bağlanma afinitelerine sahiptir (2, 131, 135, 138, 140, 141) (19459000) mb'lerin metal bağlayıcı afiniteleri ( K ). [PubMed] TABLO 1 "başlık =" Tablo 1 "/> Trikosporium Metil sistein M türü Methylocystis hirsuta methylcystis CSC1, Metilkistis Methylocystis rosea ve Methylocystis streyn SB2 bir Her ne kadar chalkophores ve siderofor Bir dizi özellik paylaştığında, bu iki metal bağlayıcı bileşik grubu çeşitli şekillerde ayrılabilir. Fitoziderofor domoik asit (142) haricinde, sideroforlar demir sınırlaması altında eksprese edilirken, chalkophores bakır sınırlaması altında eksprese edilir. Birçok siderofor bakır bağlar ve chalkophores demir bağlayabilir (142, -148); Bununla birlikte, farklı metal bağlama sabitleri iki grubu karakterize eder ve bu farka göre ayırt etmek için kolorimetrik analizler geliştirilmiştir (138, 149, 150). Yapısal olarak chalkophores, tipik heterosiklik halkalar ve ilişkili tiyoamit grupları (ve) ile siderophores'den farklıdır. Farklı halka sistemleri, molekülün metal bağlama özelliklerini (131, 133, -136, 138, 148, 151) tanımlamak ve karakterize etmek için kullanılabilen karakteristik UV-görünür emiş, dairesel dikroizm (CD) ve floresan spektral özelliklere sahiptir , -153). Uyarılma enerjisi transferi, ışık toplama komplekslerinin (155, -157) kromoforları için gözlemlendiği gibi mb'deki (136, 154) iki halka arasında meydana gelir ve bu da mbs'nin floresan özelliklerine neden olur. Örneğin, mbs emisyon yoğunluğu halkalardan birinin seçici hidrolizi ile artmakta ve metal eklenmesinin ardından emisyon yoğunluğu sıklıkla artmaktadır (132, 136, -138, 141, 148, 154). Yine, bu özellik hem mbs tanımlamada hem de karakterizasyonu için kullanılabilir Tam uzunlukta mb-OB3b'nin (135 (133) (C), mb- (133) (D) ve mb-SB2 (132) (A), mb- (E). yıldızlarla hepsini olmasa da bazı örneklerde görülmektedir ile Amino asitler işaretlenmiş. ve Çekirdek özellikleri Mbs. AA, amino asit (ler). R grupları Arg, Ile, Met veya Pro olabilir Ancak, açıklanan özelliklerin tamamı mbs'leri tanımlamak için yeterli değildir. Örneğin, Clostridium cellulolyticum mbs'lere (158, -160) benzer bir molekül kütlesi olan bir bakır bağlayıcı sekonder metabolit olan klosthioamid üretir ve benzer mbs'ler, closthioamid tiyoamid gruplarına sahiptir, Cu 2 + ila Cu 1+ 2+ 1+ 1+ 1+ ). Closthioamine ayrıca mb üretimini taramak için kullanılan sıvı veya plaka bir analiz olan bakır-krom azural S (Cu-CAS) tahliliyle pozitif çıkacaktır (138, 149, 161). Bununla birlikte, klosthioamid spektroskopik olarak mbs'den ayırt edilebilir; Örneğin, klostihoamid, altı tiyoamit kısmı ile ayrılmış iki karakteristik fenolik grubundan kaynaklanan, 270 nm'de maksimum tek bir UV-görünür emme mukavemeti gösterir. Dahası, klostihoamit bir dinükleer Cu 1+ kompleksi oluşturabilmektedir. Ayrıca, mbs'lerin aksine, klostihoamid sentezi bakır tarafından düzenlenmez ve mbs'nin aksine, molekülün bir poliketit sintazı ile üretildiğine inanılır (aşağıya bakınız). Benzer şekilde, düşük bakır koşullarında , Paraküs denitrifikalılar aynı zamanda, bakır alımında rol alan düşük molekül ağırlıklı bir 716.18-Da porfirin, kopoporfirin III üretirler (162). Ne yazık ki, ilk yayında bakır bağlanma özellikleri bildirilmemiştir ve herhangi bir takip çalışmalarının farkında değiliz. Coproporphyrin III, tipik bir heme UV-görünür emilim spektrumuna sahiptir ve heme grubu tarafından koordine edilen metale bağlı olarak farklı γ, α ve β maksimumlarını gösterir ve bu mülke dayanan mbs'den ayırt edilmesini sağlar. METAL BAĞLAYICI ÖZELLİKLERİ Bağlama ve İlköğretim Metal indirgenmesi, Bakır mb bağlayan hem Cu 2+ ve Cu 1+ ve mb ile bağlanma pH'ya (135, 172) ve Cu 2+ / Cu'ya 1 + ila mb'ye 136, 141, 172) (). Aşağıda tartışıldığı gibi, mb Cu 1+ ve Cu 2+ 'in çözünür ve çözünmez formlarını kompleks yapabilir. Mb-OB3b ve mb-SB2'ye (136, 141) Cu 2+ ilavesi üzerine termodinamik, spektral ve kinetik çalışmalar yürütülmüştür. Bu çalışmalar (136, 141, 172) mb'nin hızla Cu 2+ 'i Cu 1+ ' e indirgemesi ile karmaşıktır. Cu 2+ 'in apo-mbs'ye eklendiği deneyler için yüksek bağlanma sabitinden sorumlu bakırın oksidasyon durumu bilinmediğinden, bu oksidasyon durumlarının bir karışımının, "Cu 2+ / Cu 1+ " Bu noktadan itibaren. Cu düşük oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b başlangıçta Cu 2+ / Cu 1+ [bağlar oligomer / tetramer olarak (136, 141). Kararlı halden önceki kinetik veriler, metalin ilk bağlanmasının yalnızca halkaların birinde ve buna bağlı tiyoamid üzerinde olduğunu göstermektedir. Mb-OB3b'de başlangıç ​​Cu 2+ / Cu 1+ koordinasyonu oksazolon A'ya ve ardından kısa (8 ila 10 ms) gecikme periyoduna ve daha sonra Oksazolon B (141). Cu yüksek oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b 2+ / Cu 1+ [19459008Cukoordinatları]Bir dimer olarak dimer olarak eklenir ve bunu takiben, mb-OB3b için 0.5 Cu'nin üzerinde 2+ / Cu 1+ ila-mb- OB3b. Mb-SB2, bakır-mb oranına bağlı olarak benzer bir tetramer-dimer-monomer bağlanma dizisini izlemektedir. Mb-SB2 için, Cu 2+ / Cu 1+ 'in ilk bağlanması imidazolon halkasına ve bunu takiben oksazolon halkasına (154) koordine edilir.

Mbs () için metal bağlanma afinite sabitlerini belirlemek için çeşitli yöntemler kullanılmıştır. Cu için afiniteler 1+ banyookuproin disülfonat gibi kromoforik ligand ile iyi kurulmuş bir yaklaşımı (173, -175) kullanarak rekabet çalışmaları ile belirlenebilir. Cu-mb'nin indirgeme potansiyeli ölçümü, daha sonra Cu 2+ afinitesinin hesaplanmasını sağlar. Bu yaklaşımı (133, 135) kullanarak analiz edilen tüm mbsler için Cu 1+ afinitesi ~ 10 M …

Devamını Oku »

Engelleri Teknoloji İle Aşıyorlar Esra ÜLKAR Elif Nur Sevim'i oynadı reklam filmiyle tanıdık. Görme engelliler için tasarlanmış sınıfta, doğum günü yaklaşan annesine bilgisayar yardımıyla yaptığı resmini hediye ediyordu. 2015'te MEB ile Turkcell (TMB) ile Turkcell'in ortaklaşa yürüttüğü bir eğitim programıdır. Iki yıl için imzalanan protokolle 45 ildeki 80 okulda teknoloji sınıfları ve meslek atölyeleri kurulması hedeflendi. Şimdiye kadar 47 okulda bu gerçekleştirildi. Sınıflar görme engelli ve az gören öğrenciler için özel teknoloji ve yazılımlarla donatıldı. Bir öğrenci bir öğrenci, öğretmenin tahtaya yazdıklarını bilgisayarında görebileceği şekle getirerek okuyabiliyor. Görme engelliler, özel yazılımla rahatça bilgisayar kullanabiliyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif halinden memnun. Başka yerlerdeki arkadaşlarının da bu imkânlardan faydalanabilmesi için sınıfların sayısının arttırabileceğini söylüyor. Sekiz öğrenciden oluşan sınıfının özellikleri şöyle anlatıyor: "Ankara'da birinci sınıfta gittim. Başta sınıf normaldi. Beşte s ninfta okumaya başladım. Sınıflar işimizi kolaylaştırıyor. İnterneti daha rahat kullanıyoruz. İstediğimiz bilgiyi bulabiliyoruz. Kitabın fotoğrafını çekip okutabiliyoruz, sesli olarak duyuyoruz. Kamera da çok kullanışlı. Bir şeyin fotoğrafını çekip bilgisayarla okutabiliriz. Bazı derslerin öğretmen anlatıyor, bazılarında konuları bilgisayarla işliyoruz. En sevdiğim dersler, bilgisayar. " Reklamda oynadığı için mutlu olduklarını söyleyen Elif," Önce okulda çekim yapıldı. Sonra beş kişi seçildi. Onların tercihi. İstanbul'a gittim. Filmde oynuyorum için mutluyum. Gelecekle ilgili aklımda bir sürü meslek var ama sunucu olmak istiyorum, spiker gibi "diyor. Hedef 80 okul Programla 2015'te 11, 2016'da ise 36 olmak üzere 47 okul tamamlandı. Nisana kadar 80'e ulaşılması hedefleniyor. MEB ile protokol sınırı belirlenmiş. Iller ihtiyaç önceliğine göre seçildi. Türkiye'de 16 görme engelli okulu var ve tamamına teknoloji sınıfı kuruldu. 20 işitme engelli meslek okulunun hepsine bilişim teknolojileri sınıfları yapıldı.

MEB tarafından gerekli önceliğine göre belirlenen 45 hafif zihinsel engelli özel eğitim mesleki eğitim okuluna ise meslek atölyeleri açıldı. Kaynak

Devamını Oku »

50 Awesome Truths Ablam Dyin'den Önce Yazdı …

1996'da liseden mezun olduktan kısa süre sonra ablam Celine, arkadaşlarının her birine kendi el yazısıyla hazırladığı bir kitapçık verdi. 18 yaşına kadar öğrenildi. Bu tür bir DIY mezuniyet hediyesi oldu. Kızkardeşler olarak çok şey paylaştık ama bu kitapçık, Céline'ın 30 yaşındayken 2009 yılının ilkbaharında ölümünün oluşumunun farkında değildim. Cenaze töreninde Celine'in en yakın arkadaşlarından biri bana nazik bir surette bir …

Devamını Oku »

Zenvo, Cenevre Motor Show'undan önce TS1 GT'yi duyurdu – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                  Zenvo TS1 GT "title =" Zenvo TS1 GT " Zenvo                                                                    Devamını …

Devamını Oku »

Eylül ayında Yeni Nissan Yaprak Başlıyor, Yıl Sonundan Önce Varıyor

Yeni nesil otomobil Bolt'a rakip aralık verebilir Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz …

Devamını Oku »

Yok Olmadan Önce Mutlaka Görmeniz Gereken 20 Yer

Dünya, inanılmaz derecede güzel yerlere sahiptir. Ancak iklim değişikliği ve insanların dikkatsizliği nedeniyle bunlardan bazıları 100 yıl – belki de daha kısa bir zamanlama yok yok olma tehlikesi ile karşı karşıya. Kaynak : İş Dünyası İçeriği (sonsuza dek ortadan kaybolmadan önce ziyaret etmeniz gereken 26 yer) 1. Şeyseller

Devamını Oku »

Guillemot civcivler neden önce yuvadan sıçrıyor …

                                                                                                          Baba ve onun yavruları, Saunders, Grönland'daki yüksek kayalıklardan sıçramayı düşünüyorlardı. Kredi: Knud Falk      Gerçekten uçmalarına izin vermek için kanatları olmadıklarında, genç guillemotlar (aynen murör olarak da bilinir) yükselen uçurumlardan yüzlerce metre sıçrayarak, babalarına rehberlik ederek denize doğru fırlarlar. Bilim adamları uzun süredir, bu minik civcivlerin, bir tür için olası bir hayatta kalma stratejisi …

Devamını Oku »

Yeni Volvo XC60 2017 Cenevre'de tanıtıldı Yeni Volvo XC60 2017 modeli, 9 yıl önce piyasaya sunuldu ve 1 milyon adet satışa sunuldu çok satan orta boy SUV'u unvanına sahip XC60 ' Yerine geçecek. Volvo XC60 2017 modeli son derece iddialı. Yeni Volvo XC60 2017 modeliyle son derece iddialı. 2017 Cenevre Otomobil Fuarı'nda dünya tanıtımı gerçekleştirilen yeni Volvo XC60 2017 modeli, tamamen yeni teknolojilerle donatılmış durumda. Volvo Otomobil Grubu Başkanı ve CEO'su Håkan Samuelsson, "En son teknolojiyi sunmak, SUIL'lar ve dinamik olmak için güçlü bir mirasa sahibiz. Yeni durum Volvo XC60 2017 modeli için geçerlidir. " Yeni teknolojiler Tamamen Yeni teknolojilerle donatılan yeni XC60, bugüne kadar üretilmiş en güvenli otomobillerden biri olacak. Otomobilin yeni dönem teknolojileri arasında yer alan ve çığır açan Şehir Güvenliği sistemine, direksiyon yardımına (Steer Assist) sahip olma eklendi. Volvo'nun Kör Nokta Uyarı Sistemi (BLIS) şerit değiştirme için kaynaklı çarpışma risini azaltmak, yeni eklenen güvenlik sistemi Karşı Şeritten Gelen Araçtan Kaçınma, kafa kafaya çarpışmaları engellemek için direksiyon yardım (Steer Assist) özelliğini kullanıyor.

Yeni Volvo XC60 2017" Genişlik = "600" yükseklik = "346" /> Modern kokpit XC60 bir yandan da sağlıklı bir kabin sunuyor. Yeni CleanZone Volvo Cars'ın sürücü bilgilendirme, eğlenceleştirme ve bağlantılı hizmetler sistemi Sensus'un kullanılabilirlik arttırmak için grafik yüzleri de güncellendi. 90 Serisi otomobillerde bulunduğu CarPlay ve Android Siparişler 3'üncü çeyrekte Volvo Car Group Tasarımdan Sorumlu Kıdemli Başkan Yardımcısı Thomas Ingenlath, …

Devamını Oku »