18 Aralık 2017,Pazartesi
Anasayfa » Tag Archives: kültür

Tag Archives: kültür

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Budapeşte'de Nerede Yemek Yenir? Restoran Öneriler … Otel ihtiyaçlarına göre rezervasyon yaptırmak için

Macaristan yemek kültürü olarak bize yeter yakın bir ülke. Balkan ülkesi için sebebi ve bir çok tatlarımız ortak. Bazı yemeklerin Macar Osmanlı sentezi sonucu çıktığı saf dezenir. Avrupalılara Macar yemekleri yağ ve baharat fazla dikkat edilmemiş ağır gelse de Türklerin rahatlıkla yiyebilecekleri yemekleri var. Budapeşte restoran önerilerini yerli halktan öğrendiğim ve kendi deneyimlerimden yola çıkarak vermeye çalışacağım amaındale Macaristan'da yemek …

Devamını Oku »

Zagreb'te Yapılacak Şeyler | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Hırvatistan 'ın hem başkenti hem de dinamosu Olan Zagreb 'in tarihi 1064 yılına Kaptol ve Gradec ' e uzanıyor. Ancak Zagreb ismi tarihlerde ilk kez 1557 yılında geçiyor. 1949 yılında endüstri bölgesi, 1962 yılında ise havaalanı yapılıyor. Otel rezervasyonunuzu "En iyi fiyat güvencesi" ve "ücretsiz iptal seçeneği" ile ilgili diğer …

Devamını Oku »

Sidney İş Fırsatları | Gezipgordum.com

Size göre dünyanın öbür ucu neresi diye sorsak eminim farklı cevaplar önermektedir. Kimine göre Çin kimine göre Amerika kimine göre Avustralya ya da bambaşka yerler. Sidney, Sidney hakkında bilgi vereyim. Sidney gezilecek yerler rotası için en ilginç deneyimlerden biri olabilir. Sidney 'e yola çıkmadan önce kaldığı yer otel sahibi olduğunuz bilgi sahibi siz misiniz? olabilirsiniz. Sidney'de güvenle kalabileceğiniz ve bazı …

Devamını Oku »

Verona'da Nerede Yemek Yenir? Restoran Önerileri ]

Verona şehir çok küçük olsa da onu İtalyan gibi özel olarak harika tatları tadabileceğiniz onu Klasik İtalyan tatları, pizza, makarna, tiramisu gibi çeşitlerin yanı sıra dünya mutfaklarından çeşit çeşitleri bulacaksınız. Veneto bölgesi en bilindik olan Verona Venedik ve Padova ] Şehirleri giriyor ve yine Veneto'ya şarapları damış ünlüdür. Tatmanızı tavsiye ederim. Verona da bir restorana gidecekseniz'deninde rezervasyon yapmalısınız. Ne yazık …

Devamını Oku »

Kiev'de nerede kalınır | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Vizesiz, hafta sonu 2 günlüğüne safra gidebileceğiniz [Için Kiev uçsuz bucaksız Ormanlarında yeşilin tadını sonuna kadar çıkartabileceğiniz muhteşem bir Doğu Avrupa şehri. Tarihi 5. yüzyıla dayanan Ukrayna 'nın başkenti parklarına ve ormanların diğerlerine renk bir gece hayatını, zengin mutfak kültürünü, özgün ürünleri bulabileceğiniz alışveriş seçeneklerini ve birçok tarihi yapıyı barındırıyor. …

Devamını Oku »

2 Günde Ekonomik Paris Gezisi Nasıl Yapılır?

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Hayaller kenti Paris Kültür ve Sanat Modanın ettik Başkentlerinden biri. 2 günde hayaller kenti Paris'te nasıl gezilir? Hem de en ekonomik şekilde. Bu yazıda moda, romantizm, kültür, tarih, sinema müzik ve deyince akla ilk gelen dünya başkentlerinden biri olan Paris'i 2 günde Ekonomik sekilde nasıl gezeceğinizi anlatacağım. Pek çok insan …

Devamını Oku »

Verona'da Nerede Kalınır? Otel Tavsiyeleri Otel ihtiyaçları ve rezervasyon yaptırmak için ]

Veneto bölgesinin Venedik 'ten sonra en çok Ziyaretçi çeken şehri Verona . Shakespeare'in Verona ve Juliet 'in ünlü şehri Verona esere de yakışacak şekilde romantik bir şehir. Milano ya da Venedik 'e gelmişseniz kesinlikle arada es geçmemeniz bir şehir. Kendi içinde İtalya Eğer Bologna İtalya 'in diğer ilçelerinde daha küçük, sakin ve büyük şehirlerin koşuşturmacası yoksa hollywood bir başka yerde …

Devamını Oku »

Dünyadaki 10 Film Temalı Otel Otel tarafından inceleme ve rezervasyon yaptırmak için

Sinemanın endüstriyelleşmesiyle birlikte filmi kahramanlarının oyuncakları ve eşyalarının satılması bir yana, artık film Temalı otel odaları da yapılmaya başlandı. Film temalı otel odalarıyla birlikte; Insanların hayran sahipleri film karakterlerinin hayatını daha da yakından tecrübe etlerini amaçlanıyor. Ya da insanlar filmi izlerken kendilerinin yerine koydukları karakter gibi hissetmek için bu özenerek yapılmış otel odalarında istedi. Öyleyse okuma bakalım, otel odalarının içlerinde …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Hangzhou İş Merkezleri | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Çin 'de Zhejiang Eyaleti ' nin De başkenti olan Hangzhou aynı zamanda bir tatil beldesi. 9 milyon nüfuslu şehrin en önemli değeri etrafında çeşitli aktivitelerin yapılmadığı, büyüleyici güzelliği ile Batı Gölü adındaki göl. Hangzhou Yeni Yerler yazısında bu şehirdeki görülmez gereken önemli yerleri anlatarak, seyahatinizin enumerasyonuyla uğraşmak Ve keyifli şekilde …

Devamını Oku »

Münih'te Yapılacak Şeyler | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Almanya 'nin en önemli Diğer şehirlerinden Münih ; Hem tarihi yapı, hem Bavyera 'nın başkenti oluşu, Avrupa Birliği'nin büyük şehirlerinden bir olması sebebiyle yapılacak faaliyet çok olan bir şehir. Peki Münih'te yapılacak şeyler neler? Münih'te neler yapılır? Dershaneyi sizin için seçtiğim en renk seçenekler şöyle: Münih'te neler yapılır? Münih şimdi …

Devamını Oku »

Şangay Gezi Rehberi | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Çin iş finans başkenti de diyebileceğimiz Sangay ziyaretinde içinde ' Batı ve Uzakdoğu'da aynı zamanda yaşayabileceğiniz, kozmopolit, son derece canlı ve evet biraz da zengin bir şehir. Tapınak, müze kolonyal dönemden kalma mahallelerde tarihi yaşayabileceğiniz gibi nehrin doğu ziyaretinde batısına yayılmış Olan merkezde ışıl ışıl gökdelenler, Geniş caddeler ziyaretinde alış …

Devamını Oku »

Ziyarete Açık 7 Ünlü Hapishane Otel tarafından inceleme ve rezervasyon yaptırmak için

Hapishaneler hepsi zaman birçok zorluğun yaşandığı karanlık yerler olarak bilinir. Bu yapılar, diğer tarihi yerler gibi bir ülkenin siyasi tarihi, suç ve cezaya bakışı ve özgürlük ile insan hakları ile ilgili yasaları tasvir eden bir pencere gibidir. Teksas Hapishane Müzesi 'nın deri parçaları olan tahta bir sandalye sergilenir. Neo klasik döneme ait bir eşya gibi görünse de bu şekildeede inciler …

Devamını Oku »

Roma'nın En Ünlü 5 Parkı

Bir şehre gelmiş deşa şehrin ulaştığı seçenekler, mimari eserler, Sosyal imkanlara izin vermek. Siz yakın bir tarihte Roma seyahat planınız varsa park, bahçe konusunda bol seçenekleriniz olacak. Roma sadece sanat, mimari, tarih, dini, gastronomik açıdan değil şehir dört bir köşesinde yer alan güzel yeşil alanlarıyla da ünlüdür. En Önemli Roma Parkları Villa Borghese Şehrin en popüler yeşil alanlarından Villa Borghese …

Devamını Oku »

Pokhara İş Rehberleri | gezipgordum.com

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . 415.000 Nüfusu ile Nepal 'in Ikinci en büyük, 464 kilometrekarelik yüz Ölçümü ve de en geniş şehri Pokhara yoga, meditasyon, dağcılık ve trekking aktivitelerinin de başkenti. Sakin ve huzur dolu yapıyorsun Nepal'deki diğer şehirlerden çok daha farklı. Pokhara'dan Yeni Zelanda'dan Deniz seviyesinden 700 metre yükseklikteki Pokhara'da bu yazıda bahsettiğim yerlerin …

Devamını Oku »

Brüksel'de nerede kalınır | gezipgordum.com

" Bataklığın yerleşim yeri " gelen gelen Belçika 'nın başkenti Brüksel gerekli siyasi gerekse Avrupa'nın en önemli şehirlerinden. Bu olurca milyonlarca insan ziyaret etti. Eğer bir Brüksel gezisi planlıyorsanız aklınıza takılacak ilk soru doğal olarak " Brüksel'de nerede kalınır? " sorusu olacaktır. Hele şehre ilk kez gidiyorsanız siz de yapabileceğiniz en önemli bölgeler hakkında bilgiler ve otel tavsiyeleri çok değerli …

Devamını Oku »

5. Ufka Yolculuk Kur'an-ı Kerim Bilgi Ve Kültür Ya …

Uşak Çevre Eğitim Kültürü ve Görselliği Kulübü Derneği'nin (ÇEVKA) proje ortağı ve Türkiye'de genelinde ve çevrimiçi olarak Kur'an-ı Kerim Meali konulu Ufka Yolculuk 5. Bilgi ve Kültür Yarışması ödül töreni yapıldı. Gecede İlgiyi Karahallı Karbasan İlkokulu 3.Sınıf Öğrencileri Ayşe Naz Çelik, Abdullah Sırıklıgil, A Kategorisi Uşak 1. Ayşe Naz Çelik ve Uşak 2. Abdullah Sırıklıgil 'in ödülleri İslami'den esinlenerek yazdıklarını …

Devamını Oku »

Madrid'de nerede kalınır | Gezipgordum.com

'nın başkenti ve en büyük şehirlerinden Madrid ' e yakın bir zaman seyahat etmeyi planlıyorsanız üstelik turlarla değil de kendi seyahatinizi kendiniz organize ederek gidecekseniz aklınıza gelebilecek ilk sorulardan biri doğal olarak " Madrid'de nerede kalınır? 'olur. Eğer çok daha güzel bir yere geldiyseniz, biraz daha fazla yere gidecekseniz biraz tavsiyeye ihtiyacınız olabilir. Madrid'de Madrid 'e gidecekler için bölgeler hakkında …

Devamını Oku »

Hafta sonunda Safranbolu Gezisi | Gezipgordum.com

Ankara 'da yaşayın hafta sonu civarda gidebileceğiniz yerlerden biri Karabük ' e bağlı Safranbolu 'dur. Ankara'da yaklaşık 230 kilometre Safranbolu'ya Nisan'ın ilk haftası süresince verdik gitmeye karar verilmiştir. Safranbolu'da yereşindeki çok fazla kalacak. Bu yerlerde geleneksel Safranbolu ev ve konakları veya modern otel seçenekleri olarak ikiye ayırabilirsiniz. Bu tür bir yer, bir kez daha güvenli bir yere. Safranbolu atmosferini daha …

Devamını Oku »

Krakow'da Görülmesi Gereken 10 Yer

Kraków bazı tarihçilere göre, bugünkü Polonya topraklarında hayatın ilk başlangıç ​​bölgesi. Polonya'nın eski başkenti olması. Önemli ölçüde ve görkemli yapılara sahip. Aynı zamanda II. Dünya savaşı yıllarında Nazilerin karargahı olması sebebiyle, bombardımandan etkilenmediği için, Varşova 'nın aksine, şehirdeki tüm tarihi yapılar orijinal. Bütün köklü şehirlerde olduğu gibi, eskiden hayatın merkezi olduğu eski şehir ( Stare Miasto Otel rezervasyonunuzu "En iyi …

Devamını Oku »