15 Aralık 2017,Cuma
Anasayfa » Tag Archives: kısa

Tag Archives: kısa

Kısa Kıvırcık Saçlar İçin Etkili Stiller | Kısa Saç Stilleri 2016 – 2017

Kıvırcık saçlarınızı tekrar sevecek parlak saç kesimleri ve stil fikirleri var, bayanlar! Bazen kıvırcık saçların işlenmesi gerçekten zordur ve sonra bunları kısa süre kesersiniz … Ve sonra kıvırcık kısa saçlarınıza tarz verme konusunda endişeleniyorsunuz ve bu durumda biz yardımcı olacağız. kısa kıvrılmış saç modellerinizin en iyi yollarını bulacaksınız! Kafanızın üzerinde kıvrıldığınızda, kısa saç kesimlerinde ne kadar sevimli ve şık görüneceğinizi …

Devamını Oku »

2017 Yaz Sezonunda 35+ Yeni Kısa Saç Kesimi | Kısa Saç Stilleri 2016 – 2017

Bu yaz için yeni ve yeni bir saç kesimi almak ister misiniz? kısa saç kesimi ile tamamen yenilenmiş ve muhteşem hissedeceksiniz, tek yapmanız gereken galerimize göz atmak ve saç türünüze, yüz şeklinize ve arzularınıza uyan en sevdiğiniz saç kesimini seçmek. 1. Yeni Kısa Saç Kesimi Ombre renklendirme görünüşünüz için yeni bir başlangıç ​​olur, katmanlı bu dalgalı uzun bob saç stilinde …

Devamını Oku »

Çekici Bir Stil İçin Süper Asimetrik Saç Kesme Fikirleri | Kısa Saç Stilleri 2016 – 2017

Kişisel gözlemlere göre, asimetrik saç kesimine sahip kadınlar gerçekten ilginç, yaratıcı ve özel. Saç kesimlerinin bu tarzı o kadar havalı saç kesimleridir ki ilginç. Her saç türü için uygun asimetrik kesme, genç kadınlar arasında özellikle tercih edilir. Yüz özelliklerini gevşeterek en az bir asimetrik saç kesimi vardır. 1. Süper Asimetrik Saç Kesimi Düz saçlarınız varsa, asimetrik uzun bob sizin için …

Devamını Oku »

Kısa Saç Yapımı

İnsanların büyük bölümleri daha iyi görünüyorken daha mutlu hisseder. Bu insanların saçlarına bakmayı ve saçlarını yapmayı bilmesi gerekmektedir. Kadınlar bu konularda becerikli olsalar da iş kısa saçması tökezleyebilirler. Uzun saçla beraber yapılabilir onlarca model saatı model yapılamaz diye düşünülebilir ancak bununla birlikte büyük bir yanılgıdır. Kısa saçların kesimleri daha belirgin olduğu için açık kullanın daha mantıklıdır. Uzun saçlarda saç tipi …

Devamını Oku »

Kısa Süreliğine Ücretsiz İOS Uygulamaları – 8 Temmuz

Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Ücretsiz İOS Uygulamaları Kısa Süreliğine! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar ücretli olma ihtimali var. Şunu hatırlatmadan geçmeyelim, zira bu yazıya okurken dahi listede bulunan işa Tekrar Bu nedenle indirmek için uygulama …

Devamını Oku »

Blondies için 35+ Çarpıcı Kısa Saç Fikirleri | Kısa Saç Stilleri 2016 – 2017

Sarışın saç her yerde! Hafif, masum, kadınlar için genç ve kadınsı bir görünümü sembolize eder. Bu galeride, sarışın kadınlar için sarışın saç rengi tonlarıyla gerçekten cazip kısa saç fikirleri göstermek istedik. Şık ve kusursuz bob saç kesimi serin ve modern pixie kesikleri sarışın saçlı kadınlarda en iyi saç stil seçeneklerini bulacaksınız. 1. Yeni Kısa Sarı Saçlar Saç rengi ve katmanları, …

Devamını Oku »

Son Bobları Dahil Zihin Üfleme Kısa Saç Modeli Fikirleri | Kısa Saç Stilleri 2016 – 2017

Kısa saç, her yaştan kadınlar için en popüler saç stilidir. Onlar cesur, şık ve zahmetsizce modern. Günümüz galerisi, kısa saçlı saç fırçaları için akıl karıştırıcı fikirleri görmek isteyen kadınlara ayrılmıştır, lütfen bu resimlere bir göz atın ve saç stilistinize en sevdiğiniz şeyi göstermeyi unutmayın! 1. Sarışın Kısa Bob Saç Stilleri Körelmiş, parlak sarışın bob saç stili kalın saçlı kadınlar için …

Devamını Oku »

Kısa Saçlar İçin Örgü Modelleri

  4 (80%) 1 oy     Kısa saç rahatlığa teslim olmaktır, hafif ve özgür hissettirir. Hatta diğerlerine özgüvenin dışavurumu olarak düşünenlerin sayısı azımsanmayacak kadar çoktur! Hele ki sıcaklarda şıp diye kurur. Bir oğlanla bir kez gelir ki ah keşke uzun olsa der, iç geçirirsiniz. Muhtemelen uzun mu uzun bir saçta ki örgüye takılmıştır gözleriniz. Ama üzülmeyin! Havacılık için küçük …

Devamını Oku »

35+ En İyi Kısa Sarışın Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Sarışın saçlar belki de kadınlar için en göze çarpan ve tercih edilen saç rengidir. Farklı sarışın renk tonları vardır her kadının en az bir gölge benimsemesine izin verir. 1. En Kısa Kısa Saç Modeli Işık sarısı bebek ışıkları ile mavi göz rengi ve açık tonlardaki l kadınlar için mükemmel bir stildir. Kaynak 2. Kısa Sarışın Saç Stilleri İşte muhteşem küllü …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları – 1 Temmuz

     için olan ancak kısa bir süreliğine biründe bir için ] Ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listemizde hangi uygulamalar var?                           Kısa süreliğine ücretsiz Android uygulamaları! Birçok farklı uygulama ve oyunun bulunduğu listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama …

Devamını Oku »

Summertime için Kısa Kıvırcık Saç Fikirleri Alluring | Kısa Saç Stilleri 2016 – 2017

Bana sorarsan, yaz mevsimini yükseltip yeni bir yenilenen kısa saç kesimi almanın en iyi zamanı. Eğer doğal olarak kıvırcık saçlarınız varsa veya kıvrılmış saç stilleri istiyorsanız, yaz sezonu ile harika olacak güzel kıvırcık saç modellerimiz var! 1. Güzel Rosey Pembe Kısa Kıvırcık Saçlar Rosey sarışın saç boyama bu doğal kıvırcık kısa saç kesimi üzerinde harika görünüyor, bu renk buklelere güzel …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması – 29 Haziran

Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar ücretli olma ihtimali var. Şunu hatırlatmadan geçmeyelim, zira bu yazıya okurken dahi listede bulunan işa Tekrar Bu nedenle indirmek için …

Devamını Oku »

30+ Süper Kısa Katmanlı Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Katman, güzel bir şekilde tasarlanmış saç kesiminin anahtarıdır, bu nedenle saç tipinize uymalı ve yüz özelliklerini daha da düzleştirmelidir. Katmanlar, kısa saç kesimlerinin tüm görünümünü değiştirir; ince veya ince saçlarınız varsa, kopmuş katmanlarla bobunuza gerçekten hoş doku ekleyebilirsiniz. pixie saç kesimi ve bob saç stilleri benzersiz tabakalaşma stiliyle eşsiz görünürdü. 1. Süper Soğuk Kısa Katmanlı Saç Stilleri Aşınmış saç rengi …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-27 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları! Birçok farklı uygulama ve oyunun bulunduğu listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolayısıyla indirmek için uygulama için acele etseniz …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-24 Haziran

Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar ücretli olma ihtimali var. Şunu hatırlatmadan geçmeyelim, zira bu yazıya okurken dahi listede bulunan işa Tekrar Bu nedenle indirmek için …

Devamını Oku »

Yaz Trend Stili: Kıvırcık ve Dalgalı Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Son zamanlarda saç stilleri yumuşak kıvrımlı ve güzel dalgalar, son zamanlarda kadınlar arasında çok popüler. Farklı saç türleri ve yüz şekilleri için çok çeşitli kıvırcık ve dalgalı stiller ve saç ipuçları vardır. Önce, doğru saç kesimini seçmeniz gerekir, o zaman istediğiniz zaman güzel dalgalara ve virajlara sahip olabilirsiniz! 1. Kısa Kısa Kıvırcık Saçlar İşte bal güzel sarışın vurguları ve muhteşem …

Devamını Oku »

Kısa Gelin Saçı Modelleri | Saçlarım ve Ben

Yaz düğünleri tüm hızla devam ederken kısa saçlar için gelin başı modellerine bir göz atmak istedik. Tüm saç modelleri topuz olacak diye bir şey yok değil mi? Bu klasiğin biraz dışına çıkmak fena olmaz. Eskiden kırılmış, yıpranmış saçları safan ameliyattan önce kestirilmez, uzun saçtan daha şık gelin başı olur denilirdi. Sanki gelin saçının boyu güzelliği ile doğru orantılıymış gibi … …

Devamını Oku »

Kısa Saçlar için 30+ Güzel Saç Örgüleri | Kısa Saç Stilleri 2016 – 2017

Kısa saçlarınız olduğunda farklı saç stilleri ve örgü sporları yapabilirsiniz? Aslında, özellikle bob saç stiliniz varsa farklı vesileler için uygulayabileceğiniz, şirin, romantik ve şık örgülü saç stilleri var. 1. Bob Saç için Güzel Örgü Şeftali, mor saç rengi ve güzel örgülü taç gerçekten çok güzel görünüyor ve katılacağınız her etkinlik için mükemmeldir. Kaynak 2. Kısa Saçlar İçin Örgülü Yarım Updo …

Devamını Oku »

35+ Soğuk Kısa Saç Stilleri Bu Yazı Kaybedeceksiniz | Kısa Saç Stilleri 2016 – 2017

Yaz geldi ve hepimiz sıcak yaz günlerinde yeni bir görünüm istiyoruz. Farklı serin ve şık kısa saç kesimleri var, çünkü kadınlar arasında mükemmel bir saç stili seçebiliyorlar. 1. Soğuk Blonde Kısa Bob Saç Stilleri Bu kısa bob saç platin sarışın balayaj ile renklendirilmiştir ve gerçekten modern ve şık görünüyor Kaynak 2. Uzun Bob Saç Stilleri Uzun bob saç stilleri çok …

Devamını Oku »

En Modern Kısa Saç Modelleri

Bazıları için vakit yokluğundan veya da saçtan fazla uğraşmak istenmediğinden başvurulan bir model olsa da bazı şeyler için farklı bir stildir kısa saç … Modern, özgür, biraz asi bir hava veren, özellikle kendine güvenen kadınlar için tercih edilenleri söylenebilir. Aslında işin özü kısa saçlı cesaret ister desek de, tüm dikkatleri üzerine çekeceği kesin. Uzun saçlı kadınsı ve dişiliği temsillediğini düşünmüş …

Devamını Oku »

Kısa Saç Şekillendirme

Her ne kadar kısa saç şekillendirme bayan kuaförlerinde en iyi halini aldırıyor da, esasen evde de yapılabilecek çok kolay. Hatta uzun saç şekillendirmekten daha kolay. Kısa saç şekillendirme teknikleri arasında minik tokalardan, saç şekillendirici jölelerden ve köpüklerden yardım almak, saç çok daha güzel bir görünüme ulaşmasına yardımcı olmaktadır. Kısa saç şekillendirme yöntemleri aşağıdak gibidir, Kulak arkası boy saçları, ıslak görünüm …

Devamını Oku »

Kısa Saçlar İçin Modelleyici

Kısa saçlı kadınlar, uzun saçlı kadınlara göre daha daha şanslı hem de daha şansızlardır. Şanslı oldukları yönü her gün saç modeli ile uğraşmayacağıdır. Saç modellerinin de az oluşu şansız yönüdür. Kısa saçlı bir kadın daha kolay ve daha rahat bir şekilde bunları yapacak model modelleme yüzü saç tarzı hep aynı kalmaktadır. Fakat kısa saçında bir çok model bulunur. Kısa saçlar …

Devamını Oku »

Yüz Şekline Göre Bayan Kısa Saç Modelleri

Saçlar, bir kadın için en önemli öğelerden biridir. Saça bakan, saçı düzenli olarak aralıklarla kestirmek gibi işlemler saçıttın kusursuz sağlayacaktır. Saçın belli aralıklarıyla kasıttırmak saça güç kullanma. Fakat saç kesilirken göz uydularını giyin. Yüz şekline göre kısa saç modelleri kestirilmesi çok önemlidir. Aksi takdirde kişi saçlarından kalmayabilir. Saçlar kesildikten sonra değiştirme, saçı eski haline geri döndürme gibi seçenekler olmadığından seçilen …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-17 Haziran

Apple'ın Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar Tekrar ücretli olma ihtimali var. Bu nedenle indirmek için uygulama için acele etseniz iyi olur. moosic ile ile ile …

Devamını Oku »

Kısa Sarı Saç Modelleri

Kısa Sarı Saç Modelleri; Bu saç renginin pek çok çeşidi bulunur. Buz sarısı, altın sarısı vb. gibi. Kısa sarı saçlara onun modelini yakışır. Türkçe çevirisi, türkçe çevirisi, türkçe çevirisi, türkçe çevirisi türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe türkçe Kısa …

Devamını Oku »

Kısa Saçlılar Günlük Modeller

Kısa saç kesimi son zamanlarda oldukça eğilim ve uzun saça oranla daha modern bir görüntü yakalanmasını sağlar. Kısa günlük saç için oldukça farklı ve kolay saç modelleri vardır. Bunlardan bir ilki ısıyla uygulanabilecek saç modelleridir. Saç düzleştiricisi yardımıyla saçların sadece uç kısımlarını içe veya isteğe göre dışa düzgün düzleştirmek sıradan ve dümdüz saç modellerine oranla daha modern görünmektedir. Düzleştiriciyi kullan …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Kısa süreliğine ücretsiz ikon paketleri – 16 Haziran

kısa süreliğine ücretsiz hale getirilan ikon paketleri büyükler için bir araya getirdik. kısa süreliğine ücretsiz hale hale getirilan ikon paketlerini daha fazla ücretli olarak kullanıcıların huzuruna Kısa süreliğine ücretsiz ikon paketleri! Kullanıcılarının Play Store 'dan kolaylıkla indirebileceği kısa süreliğine ücretsiz olarak indirebileceğiniz bu ikon paketleri ile birleşmiş bir görüş kazandırmaya hazır mısınız? İşte karşdaş '' Kısa Süreliğine Ücretsiz İkon Paketleri …

Devamını Oku »

Çekici Kısa Düz Saç Stili Pics | Kısa Saç Stilleri 2016 – 2017

Dalgalı saç stilleri yakın zamanda çok popüler ancak düz saçlar yakında moda olmayacak. Dolayısıyla size kısa kısa saçlar için en iyi saç stili fikirlerini göstermek istiyoruz. Bunlar, hem kalın hem de ince saç dokuları için idealdir. 1. En Kısa Saç Düz Saç Stilleri Karanlık kökleri olan Ombre sarışın bob, orta cilt tonuyla ve kalın saçlı kadınlar için belki de en …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-15 Haziran

Apple'ın Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar Tekrar ücretli olma ihtimali var. Bu nedenle indirmek için uygulama için acele etseniz iyi olur. PrivateShare İki iOS cihaz …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-14 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için acele …

Devamını Oku »

30+ En Popüler ve Seksi Kısa Saç Fikirleri | Kısa Saç Stilleri 2016 – 2017

Kısa saç stilleri çok modern ve seksi olabilir, böylece uygun bir kısa saç kesimi ile gerçekten şık görünürsünüz. Yeni kısa saç kesimi 'u benimsemek için saçınızı kesmek isterseniz aşağıdaki galeriden biraz ilham alabilirsiniz: 1. Popüler Kısa Seksi Saçlar Kadınlar için en seksi görünümlerden biri, aşağıdaki gibi doğal yumuşak kıvrımlarla gri bob saç kesimi yapıyor: Kaynak 2. Kısa Seksi Saçlar Karanlık …

Devamını Oku »

Fab Yeni Kalın Kuşlardaki Kalın Saçlar İçin En İyi 10 Kısa Saç Stilleri

Daha sıcak havalarda arkadaşlarımızla ve ailenizle daha fazla sosyalleşmemizi istiyoruz, şimdi saç kesiminizi ve renginizi güncellemenin zamanı geldi! Renkliler kül sarışınlı ve kül renginin sanatsal renk karışımlarıyla bu sezon limiti yaratıcılık altına alıyorlar. Cildiniz sıcak bir tonlamaya sahipse, gorgeously yumuşak, zarif ve gülünç bej renkleri arasından seçim yapabilirsiniz. Scarlet red şu anda esmerler için güçlü bir trend. Ve gerçekten maceraperestlik …

Devamını Oku »

30+ Soğuk Kısa Doğal Kıvırcık Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Doğal saç stilleri kadınlar arasında giderek daha popüler hale geliyor, eğer doğal olarak kıvırcık saçlarınız varsa, sizi şık ve özgün bir zahmetsizce gösterecek saç stillerini benimseyebileceğinizi bilmelisiniz. 1. Serin Kısa Doğal Kıvırcık Saç Stil Doğal saçlar siyah kadınlar için harika, basit bir bob saç kesimi ile bu şık ve benzersiz görünüyorsun ve kesinlikle şaşırtıcı görünüyorlar: Kaynak 2. Kısa Doğal Kıvırcık …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-10 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için acele …

Devamını Oku »

Dokulu Stil için Son Kısa Saç Kesimler | Kısa Saç Stilleri 2016 – 2017

Eğer saçınıza biraz ekstra stil ve doku isterseniz saçınıza güzel bir doku katacak bu muhteşem dağınık katmanlı saç modellerini deneyin. Aşağıdaki galeride muhteşem bob saç kesimi var ve hemen seveceksin pixie kesiyor. 1. En Kısa Saç Dökülmüş Saç Stil Mavi tonları olan pastel gümüş rengi dalgalı uçları ve dalgaları olan bu bob üzerinde kesinlikle muhteşem görünüyor Kaynak 2. Kısa Dalgalı …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları -9 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-3 Haziran Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için …

Devamını Oku »

En Güzel Yazlık Kısa Saç Modelleri

En Güzel Yazlık Kısa Saç Modelleri Kısa saç modelleri 60'lardan bu yana kadınların gözdesi. Modern, zarif ve cesur, kısa saç kesim modellerinin en çok tercih edilene nedenleri biri de elbette kullanımı kolay olmaları. Özelliklere göre yaz aylarında uzun saçların kullanımı oldukça zor olabiliyor. Sıcak havalarda saçlarınızı kurutmak, fön çekmek ya da şekillendirmek tam bir işkenceye dönüşebiliyor. Üstelik onca zahmet edip …

Devamını Oku »

Şık ve Eğlenceli 30+ Pics Kısa Sarışın Saç Kesimi | Kısa Saç Stilleri 2016 – 2017

Sarışınlar daha eğlenceli, ha? Hiçbir zaman bunun hakkında emin olamayacağız, fakat saç kesimlerinin tamamının sarışın saç modellerinde gerçekten dramatik ve şık görünen bir şeyden eminiz. Işık saç renkleri sarışın gibi saç kesiminin ve katmanlamanın her detayını sergileyerek saç kesiminiz mükemmel olmalıdır. 1. Popüler Kısa Platinum Blonde Haircut Şık düz platin sarışın saç keskinleşiyor ve ince ve düz saç türleri için …

Devamını Oku »

Yaz Saati İçin 30+ Kısa Saç Kesimi | Kısa Saç Stilleri 2016 – 2017

Yaz geldi ve birçok kadın yeni ve taze saç kesimi, özellikle de daha kısa saç kesimi almak istiyor. Bu yazıda, bu sezonda trend olacak en iyi saç kesimi seçeneklerini göstereceğiz, onlara bir göz atalım: 1. Kadınlar için Yeni Kısa Saçlı Pixie saç kesimi her zaman süper kısa yol değil, katman ve stille gerçekten şık görünebilir. Kaynak 2. Kadınlar İçin Sarışın …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları – 4 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-3 Haziran Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-3 Haziran

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-11 Mayıs Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-3 Haziran

Apple'ın Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar Tekrar ücretli olma ihtimali var. Bu nedenle indirmek için uygulama için acele etseniz iyi olur. Sarkaç yaratmadan video düzenlemeye …

Devamını Oku »

Önü Uzun Arkası Kısa Saç Modeli

Kısa saç kullanımı en rahat saç modeli biridir ama onun yüzü tipine gitmez. Ilk önce kendin yüzünüzü iyi tanımalısın sonra yüzünüze gidecek saç modelini belirlemelisiniz. Bir döneme damgasını vurmuş olan Beckham modeli özellikle ince yüz yapılı kadınların tercih etmesi bir model. Dönem dönem ünlülerin çoğunlukla hoşnutsuzluk saç hiç bir zaman modası geçmez bir model. Önceden uzun arkası kısa saç modelleri …

Devamını Oku »

25+ Sevimli Kısa Dalgalı Saç Fikirleri | Kısa Saç Stilleri 2016 – 2017

Dalgalı saç son zamanlarda eğilimdedir ve galerimizde göreceğiniz gibi kısa orta boy saç modelleri olan kadınlar farklı dalgalı saç stillerini tercih edebilir. Dalgalı stilinize, elastik ağırlıksız saç şekillendirici saç ürünlerine ve bazı ilhamlara bağlı olarak bir kıvırma demirine veya demirinize ihtiyacınız olacak! 1. Sarışın kısa dalgalı saçlar Bu dalgalı tarz, balya bütünü, şerpilli katmanlı uçlarla sarışın bob tüyü görünümünü tamamlar. …

Devamını Oku »

Bayan Kısa Saç Modelleri

Gelen yeni yaz sezonu ile birlikte bayanlar da saçlarında farklı tarz değişiklikler yapılıyor. Tabii ki sen tüm modelleri yüz ve omuz yapısına göre değişiklik. Onun bayanın farklı yüz şekli bulunmaktadır. Günümüzde çok ilgi ve beğeni görmektedir. Bununla ilgili olarak da kısa küt saç modelleri bayan tasarımları kesinlikle onun bayanın incelemesi gereken modellerdendir. Hangi Yüz Şekline Hangi Kesim Saç Modeli Yakışır …

Devamını Oku »

Arkası Kısa Önü Uzun Saç Modelleri

Profesyonel saç kesim alanlarına giren bazı modeller vardır. Özelleşmek ve farklı görünmek isteyen kişiler bu tarza ayak uydurmak yanı sıra, hiç bir zaman sona ermeyecek kombin currentını oluşturmak ve oluşturmak. arkası kısa önü uzun saç modelleri özel tarz sahibi olmak isteyenlerin lekeler arasındadır. Simetrik Kesimin Konuştuğu Saç Modeli İlk olarak önü uzun arkası kısa saç modelleri Hazal kaya Güneş ışığından …

Devamını Oku »

Kıvırcık Saçlar İçin 25+ Süper Kısa Saç Kalıpları | Kısa Saç Stilleri 2016 – 2017

Doğal olarak kıvırcık saçlı olup olmadığınıza bakılmaksızın, kıvırcık veya kıvırcık saçlarla mükemmel görünen gerçekten harika kısa saç kesimi fikirleri bulacaksınız. Muhteşem loblardan serin pixie serilerine en iyi saç kesimi ve stil fikirlerini denemek istediğinizi topladık! 1. Kıvırcık Saçlar İçin Süper Kısa Saç Kestirme Düz veya kıvırcık bu uzun sarışın bob koyu köklü saç ince dalgalı saçlı kadınlar için mükemmel. Kaynak …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-30 Mayıs

Apple'ın Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar Tekrar ücretli olma ihtimali var. Bu nedenle indirmek için uygulama için acele etseniz iyi olur.

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-30 Mayıs

birdeki için, için, olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamalar sizler için sıraladık. Bakalım listesine hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-11 Mayıs Birkaç farklı uygulama ve oyunun bulunduğu listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için acele etseniz iyi olur. …

Devamını Oku »

Yanlar Kısa Üstler Uzun Saç Modeli

Son dönemin en popüler saç modeli olarak bilinen yıldızlar uzun saç modelinin modern adı Amerikan traşıdır. Yolda yanınızdan geçen iki tane erkekten birinde rastlayabileceğiniz bu saç modeli, pek çok erkeğin kendi tarzını bulmasını istiyorsanız saç modelidir. Son birkaç yıldır mevcut olan bu saç modeli, herkes tarafından kullanılacak başlanınca sıradanlaşmaya başlamıştır. Bunun önüne geçilebilmesi için birkaç değişiklikler yapılarak yeni modelleri öne …

Devamını Oku »

Kadınlar İçin Kısa Kısa 10 Saç Kesimi – Shocking Yeni Bir Kesim ve Renk Deneyin!

Günümüzün kısa, keskin saç kesimlerinin galerisi son ​​kesim teknikleriyle bazı çok cesur renkleri sergilemek için seçildi! Bu heyecan verici yeni görünüm, pembe ve kırmızı çizgili ve parlak sarı çığlık atarak, göz kamaştıran kırmızı renkli serin serin sarışın serinletici bir "yakalama" imkanı sunuyor! Dolayısıyla, modayı seviyorsanız ve en son trendleri tanıtan sevgiyi seçerseniz, bu şok edici yeni kesme ve renk fikirlerinden …

Devamını Oku »

Doğal Vibe: Kısa Saçlı Saç Fikirleri | Kısa Saç Stilleri 2016 – 2017

Dağınık stil veya yatak başı görünümü birkaç yıldır eğilimdedir ve doğal güzelliğini ortaya çıkarmak için mükemmel bir yoldur. Dağınık plaj dalgaları her fırsatta mükemmel, bu stili özel etkinlikler için spor yapabilir, istediğiniz zaman rahat bir gece dışarı çıkarsınız! 1. İyi Kısa Saçlı Saçlar Magenta ve gül saç renkleri birlikte mükemmel görünüyor ve dağınık dalgalar, bu katmanlı boba gerçekten harika ve …

Devamını Oku »

30+ Inspiring Short Blonde Hair Pics | Kısa Saç Stilleri 2016 – 2017

Sarışın saçlara ve kısa saç kesimine gelince, seçebileceğiniz birçok farklı stilin bulunduğunu biliyorsunuz ancak şunu akılda tutmalısınız: Sarı saç, saç kesiminin ve katmanlamanın tüm ayrıntılarını gösterir. sarışın saç rengi gibi hafif bir renge sahipseniz, mükemmel saç kesimine sahip olmanız gerekir . 1. Son Kısa Sarışın Saçları Platinum sarışın saç rengi ve uzun katmanlı bob saç modeli birlikte modern ve şık …

Devamını Oku »

Alluring Styles için 30+ Son Katmanlı Saç Kesimi Resimleri | Kısa Saç Stilleri 2016 – 2017

Katmanlar, kısa saç kesiminin stilini belirler; saç tipinize ve yüz şeklinize uyacak bir katman seçmeniz çok önemlidir. 1. Son Katmanlı Sarışın Saçlar Kabartmalı katmanlı açılı sarışın bob saç ince saçlı kadınlar için mükemmel. Kaynak 2. Kısa Katmanlı Saç Kestirme

Devamını Oku »

Balinalar kısa süre önce yeni devler haline geldi …

                                                                                                          Hayat tarihinde şimdiye kadar yapılmış en büyük omurgalı hayvanı olan mavi bir balina, California kıyılarındaki krili engelliyor. Hugh Pearson ve David Reichert'in izniyle BBC programı 'The Hunt' için National Marine Fisheries Service izni # 16111 uyarınca fotoğraf çekildi. Kredi: Copyright Silverback Films / BBC.      Kaynak

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-23 Mayıs

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-11 Mayıs Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için …

Devamını Oku »

Kıvırcık Kısa Saç Modelleri

Kıvırcık saç nerdeyse ona dikkat çeker. Saçın kendine ait bir tipinin olması, saçı çok kullanışlı kılar. Ancak saç kontrol nitelikse bu durum sevilebilir. Kıvırcık saçları, çok fazla kadının en başta kullanılmasıyla zorlandığı bir saçtır. Kişi kendi tarzını bulana kadar kıvırcık saçı kullanmakta zorlanır. Eğer kıvırcık saçlarınız ile bağdaşamısınız kısa saçları mutlaka denemelisiniz. Kısa kıvırcık saçlar çok fazla kişinin gözünü korkutur. …

Devamını Oku »

'Tabby'nin Yıldızı', astro-boffin'leri kısa bir süre için entrika içine alıyor …

                                  Dünya çapında gökbilimciler, belirsiz bir karartma evresine giren ünlü "Tabby's Star" (Boyajian'ın Yıldızı olarak da bilinir) gibi birçok görüntü yakalamak için dünya çapında bir çaba sarf ediyor.                  Gizemli KIC 8462852, Tabetha Boyajian'ın 2011 ve 2013 yılları arasındaki Kepler gözlemlerinde karartıcı imza üzerinde çalışmasından bu yana astro-boffins ilgisini çekti. Takip çalışmaları, işyerinde iki mekanizma olduğunu ortaya koydu: periyodik …

Devamını Oku »

Şık Bayanlar İçin Fantastik Kısa Kıvırcık ve Dalgalı Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Dalgalı ve kıvırcık saç stilleri, kadınlar için en çok aranan saç stilidir. Dalgalı saç stilleri en son saç trendidir. İster doğal dalgalar olsun veya olmasın, bu galeride yüz özelliklerini anında düzleştirecek güzel saç stilleri bulacaksınız! 1. Gül Ombre Kısa Dalgalı Saç Stilleri Yumuşak ve doğal dalgalar gül altın saçlarının gerçekten sevimli ve şık görünmesini sağladığı gibi her saç rengine hayran …

Devamını Oku »

Kısa süreliğine ücretsiz Android uygulamaları-21 Mayıs

bir biri, için, önceden ücretli olan ancak kısa biründeğine ücretsiz indirilmeye sunulan uygulamaları sizler için sıraladık. Bakalım listelerine de hangi uygulamalar var? Kısa süreliğine ücretsiz Android uygulamaları-11 Mayıs Birkaç farklı uygulama oyunun oy Listesi yerinde listemize geçmeden önce şu uyarıyı yapmadan geçmeyelim: siz bu yazıyı okurken dahi listedeki çalışanlar tekrar ücretli olma ] Ihtimali var, dolaylı indirmek için uygulama için …

Devamını Oku »

Kusursuz Kısa Sarışın Saç Modelleri You Must See | Kısa Saç Stilleri 2016 – 2017

Sarışın saçlar uzun veya kısa saç kesimi olsun kadınlar için en çekici ve seksi saç rengidir. Bugün sarışın renk tonları her kadından cilt tonu için uygun olanı seçip şık ve görünüş yaratacak daha çok yönlü hale geliyor. 1. Süper Kısa Sarışın Saç Stilleri Bob saç stilinde ombre olarak bulunan bu doğal sarışın saç rengi açık ten tonlarına sahip genç kadınlar …

Devamını Oku »

Kısa süreliğine ücretsiz 6 iOS uygulaması-19 Mayıs

Apple'ın Apple'ın belirli aralıklarla uygulama mağazası App Store 'da bulunan rastgele seçilmiş ücretli uygulamalar, sınırlı bir süre için ücretsiz indirilebilir hale getiriyor. Kısa süreliğine ücretsiz 6 iOS uygulaması! Sınırlı bir süre için ücretsiz indirilmeye sunulan iOS uygulamalarını sizler için sıraladık. Tekrar Tekrar ücretli olma ihtimali var. Bu nedenle indirmek için uygulama için acele etseniz iyi olur.

Devamını Oku »

Kısa süreliğine ücretsiz ikon paketleri!

Önceden ücretli olsa da, daha sonradan kısa süreliğine ücretsiz hale getirilmiş ikon paketleri kaçırmadan indirmek, hızlı olmanız da fayda var! Android için kısa süreliğine ücretsiz ikon paketleri! Android cihazınıza farklı bir kat katlanabilir ikon paketleri Play Store ücretsiz olarak indirebilirsiniz. Bu ikon paketleri telefonunuza farklı bir görünüm ve hava katabileceksiniz. İşte karşınızda '' Kısa Süreliğine Ücretsiz İkon Paketleri '' Boekt …

Devamını Oku »

Aston Martin, Londra IPO'sunu önümüzdeki yıl en kısa sürede ele alacağını söyledi

Tommaso Ebhardt Bloomberg 19 Mayıs 2017 08:58 CET Aston Martin, İngiliz otomobil üreticisinin Ferrari'nin yatırımcıları cezbetme listesinin başarısından yararlanmaya çalışması nedeniyle önümüzdeki yıl halka arzı mümkün olduğunca erken yapmayı düşünebilir, dedi. Sahipleri arasında Investindustrial Advisors olan yüzyılın otomobil üreticisi, Londra'da listeleyebileceklerini söyledi, görüşmeler özel olduğu için tanımlanmamasını istedi. Aston Martin, resmi bir sürecin danışmanlarını seçmeden önce 2017 finansal sonuçlarını beklemektedir, …

Devamını Oku »

2017 Yazının En Kısa Saç Stili Fikirleri | Kısa Saç Stilleri 2016 – 2017

İlkbahar ve yaz saç trendleri netleşmeye başladı, bu nedenle 2017 yılının en son kısa saç kesimi fikirleri, saç boyama teknikleri ve saç stil seçeneklerini biraz konuşmak istedik. 1. Kadınlar İçin En İyi Kısa Saç Modelleri Bu hafifçe açılı kül sarışın saç stilinde orta cilt tonuyla ince saçlı genç kadınlar için mükemmel bir seçim olacaktır. Kaynak 2. Kısa Saç Modelleri

Devamını Oku »

Kısa Kesim Saç Modelleri

Kısa saç kesim modelleri son ​​yıllarda popüler olmuş ve popülerliğini arttırmak saç modelleridir. Kısa saç kesim modelleri bayan larda, taşımacılık zor saç modelleri olarak bilinmektedir. Bir uzun süredir güzelleştirebilirsin. 2016 kısa saç kesim modelleri 2017 kısa saç kesim modelleri ile neredeyse aynı seyretmektedir. Kısa saç, özellikle birkaç kesim modeli ile özdeşlemiş ve popülerliğini arttırmak günün geçtikçe arttırmak çok çok kadının …

Devamını Oku »

Katlı Kısa Saç Modelleri

Katlı saç modelleri, çok kadının aklını çelen saç modellerdir. Pek çok yüz ipucu giden katlı saçlar, saçıptan daha hacimli ve havalı gösterdiklerinden akıl çelmemeleri mümkün değildir. Son yıllarda dayanıklı saç modellerinde küpe saçları gözle çarpmaktadır. Ancak o küt saç modellerine göre çarpan katlı kısa bir saç modeli vardır. Bu kısa katlı saç modelleri bir kadının uzun saça ihtiyaç duymadan çekici …

Devamını Oku »

Genç Kız Kısa Saç Stilleri Fikirleri | Kısa Saç Stilleri 2016 – 2017

Tüm genç bayanlara sesleniyorum! Hemen sevineceğiniz gerçekten güzel ve şık kısa saç stilleri fikirlerimize sahibiz! Şimdi galerimize göz atın ve stilinize, yüz şeklinize ve ruhunuza uyacak mükemmel saç kesimini bulun! 1. Kızlar için Güzel Kısa Saç Modelleri Pastel saç rengi genç kadınlar arasında çok popüler ve yarım topuzlu bu uzun bob gençlere mükemmel bir stilde. Kaynak 2. Kısa Saç Modelleri …

Devamını Oku »

Yuvarlak Yüze Kısa Saç Modelleri

Bir saç modelinin, bir kişide mükemmel bir şekilde durabilmesi için kişinin yüz ipucu uygun bir saç kesimi yapılmasına bağlıdır. Yüz verenlerin sevimli yanlarının önüne çıkarılması, sevilmeyen yanlarının gizlenebilmesi için kesilen saç, çabasız güzelliği de beraberinde get. Yuvarlak yüze kısa saç modelleri 2015 ve ve 2016 yılında benzer modellerdir. Bir önceki yılda olduğu gibi, yuvarlak yüze kısa saç modelleri 2016 yılında …

Devamını Oku »

Kısa Saçlar İçin Saç Modelleri

Kısa saçla uğraşmak göründüğü kadar kolay değil. Saç, onun dur dur durduğu gibi. Şekli bozulur ve bazen düzeltilemeyecek haller alır. Bunun önüne geçebilmek için ya saç yıkanmalıdır ya da anı kurtaracak saç modelleri bilinmelidir. Bir kişi, saçları kısa sürdürebilir bakmak ve iyi görünmek isteyebilir. Bu onun en doğal haklarından bir tanesidir. Kısa saçlar için okula giderken yapılabilecek saç modelleri pratik …

Devamını Oku »

Düz Saç Tipi için Yeni Kısa Saç Modelleri | Kısa Saç Stilleri 2016 – 2017

Düz saçlar kadınlar için en kolay saç stillerinden biridir, özellikle sağlıklı kalın ve düz saçlarınız varsa farklı saç kesimlerini kolayca uygulayabilirsiniz. Uzun pikseli patlamalı, bob saç stilleri açılı tabaka veya dalgalı tabakalı kısa bob düz saçlı kadınlar için iyi fikir olabilir. 1. Yeni Kısa Saç Düz Saçlar Pembe kökler ve muhteşem platin saç renginin yanı sıra bu şık düz saç …

Devamını Oku »