17 Aralık 2017,Pazar
Anasayfa » Tag Archives: kendine

Tag Archives: kendine

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Waymo kendi kendine çalışan kamyonlarda çalışıyor

Alphabet Inc'in kendi kendine çalışan otomobil birimi Waymo, kendinden tahrikli kamyon geliştirmeye çalışıyor, şirket Perşembe günü yaptığı açıklamada, Kendi kendine sürüş otomobil çabalarını genişletmek isteyen Waymo, özerk araçların önümüzdeki yıllarda daha uzun mesafeli kamyonları devralmasını ve insan sürücülerinin yerel alım ve teslimat rotalarını ele almasını beklemektedir. Bir Waymo sözcüsü, yaptığı açıklamada "Kendi kendine sürüş donanım ve yazılımı kurma konusundaki sekiz …

Devamını Oku »

Continental, Baidu, kendi kendine sürüş tekniği konusunda anlaşma imzaladı

Continental'in şasi ve güvenlik biriminin başkanı Frank Jourdan (solda) ve şef işletme görevlisi Bay Qi Lu, Fotoğraf kayıdı: Avrupa Edward Taylor Reuters 31 Mayıs 2017 12:32 CET FRANKFURT – Continental, Çinli İnternet şirketi Baidu ile birlikte, özerk ve bağlı araç teknolojileri geliştirmek için Çarşamba günü stratejik bir işbirliği anlaşması imzaladı. bildirisinde Continental her iki ortaktan otomatik sürüş, bağlı araçlara ve …

Devamını Oku »

Waymo'nun Kendi Kendine Sürüş Otomobilinde Sensörleri için Fantezi Silecekler var »AutoGuide.com News

Google'ın Waymo, günlük hayatta insanların kendi kendine sürüş araçlarını nasıl kullandıklarını görmek için gerçek dünyaya doğru ilerliyor. Şirket, bu ay kendine tahrik yapan test arabalarında Phoenix, Arizona bölgesi etrafında insanları taşıyacak ücretsiz, deneysel bir hizmet başlatıyor. Ancak bu arabaları hazır hale getirmek için Waymo, araçların çevredeki çevreyi daha iyi görmesine yardımcı olmakla kalmayıp, arabadaki bu bilgilere yeni donanım ve iç …

Devamını Oku »

Alman endüstrisi, kendi kendine çalışan araçların hukukunu kabul ediyor

VW CEO'su Matthias Mueller, sürücüsüz arabaların Sedric konseptini temel alarak önümüzdeki on yılın başlangıcına varmasını bekliyor. Fotoğraf kredisi: Volkswagen Almanya'nın otomotiv endüstrisi, hükümeti kendi kendine sürülen otomobilleri yasal olarak yaygınlaştıran ilk dünya ülkesi olarak övdü. Bununla birlikte, ülkenin dört bir yanındaki yollarda teknolojiyi kullanıma sokmak için yalnızca ilk ama önemli bir adım olduğu konusunda uyarıda bulundu. ] Yeni bir yasaya …

Devamını Oku »

Lyft, Waymo kendi kendine sürüş arabalarında işbirliği yapıyor

                                                                                                          Ridesharer Lyft, kendi kendine sürüş araç teknolojisini test etmek için Google'ın ana Alfabesinin kendi kendine çalışan otomobil birimi olan Waymo ile birleşiyor     Şirketlerin, Google üst Alphabet'ın kendi kendine sürüş otomobil birimi olan Waymo'nun, kendi kendine sürüş otomobil teknolojisini test etmek için ridesharer Lyft ile anlaşmaya vardığı bildirildi.                                                                                 Waymo ve Lyft, kendi …

Devamını Oku »

Kendi kendine süren otomobiller için yol yükseltmeleri nasıl finanse edilir

       Öncü bir ulaştırma düşünce kuruluşu, WASHINGTON – Kongre, önce arabayla gelinen araçların güvenli bir şekilde çalışması için gerekli olan altyapı iyileştirmelerinin finanse edilmesine yardımcı olması için başlangıçta otomatik araç yolculuğunu mil başına bir kuruşa yatırması gerektiğini belirtti. Kullanıcılara maliyet, kabaca 18.3-cent-galon federal benzin vergisine (dizel için 24.3 sent) denktir ve insanlara daha fazla güvenmesi beklenen şoförsüz araçlardan vazgeçmemelidir Eno …

Devamını Oku »

ABD için kendi kendine sürüş taksileri var

       Delphi Automotive, önümüzdeki bir ay içerisinde ABD'li bir şehirde (büyük olasılıkla Boston veya Pittsburgh) yeni bir kendi kendine araç kullanan taksi hizmetini planladığını duyurmayı umuyor. Şirket, geçtiğimiz sene hizmeti açıklamak isterken, potansiyel ortaklarla pazarlık yapmak için daha fazla zaman gerektiğini söyledi. Delphi'nin teknoloji departmanı başkanı olan Glen De Vos. De Vos, Otomotiv Haberleri'ne "Son başvuru sürecini inceleyeceğiz ve önümüzdeki …

Devamını Oku »

Almanya kendi kendine sürüş otomobil testlerine izin veren yasayı onayladı

Markus Wacket Reuters 12 Mayıs 2017 13:43 CET BERLİN – Almanya, dev otomotiv endüstrisinin kendi kendine sürülen otomobilleri test etme yolunu açtı. Parlamentonun üst meclisi Cuma günü koşulacak koşulları belirleyen bir yasayı onayladı. Alman yolları. Geçen yıl Başbakan Angela Merkel tarafından hazırlanan yasa uyarınca, bir sürücünün özerk araçla bunu yapmak istendiğinde kontrolü geri almaya hazır olan her zaman tekerleğin arkasında …

Devamını Oku »

Nvidia teknolojisini kendi kendine süren otomobillerde kullanmak Toyota

SAN JOSE – Toyota Motor Corp., yaklaşmakta olan kendi kendine sürüş otomobilleri için Nvidia'nın özerk sürüş platformunu kullanacak. Yonga üreticisi yıllık GPU Teknoloji Konferansı'nda Çarşamba ortaklığını Toyota'nın özerk araçlarına Drive PX bilgi işlem platformu sağlayacağını açıkladı. Otomobil, teslimi araçlarda Nvidia teknolojisini kullanırken Tesla Motors, Audi, Mercedes-Benz, BMW ve Volvo Cars'a katılıyor. Nvidia otomotiv başkanı Danny Shapiro, gazetecilere duyurunun ardından yapılan …

Devamını Oku »

Ford, Beden Dili Okumak İçin Kendi Kendine Sürüş Otomobilini İstiyor »AutoGuide.com News

Ford, bir sürücünün beden dili temel alınarak araç hareketlerini öngörebilen teknoloji üzerinde çalışıyor. Bu hafta 4 Kasım 2015'te başvuruda bulunan bir patent başvurusu yayınlandı ve içinde "insan odaklı bir aracın sürücü amacını ve gelecekteki hareketlerini öngören sistemler, yöntemler ve cihazlar" ayrıntıları veriliyor. Temel olarak, sistem Bir kamera sistemi, bir sınır bileşeni, bir gövde dili bileşeni ve bir tahmin bileşeni kullanarak …

Devamını Oku »

Teknoloji devi Samsung, kendi kendine sürüş araçlarını test etme iznine kavuştu

Teknoloji devi Samsung, Seul merkezli çokuluslu şirketin Güney Kore'den onay aldığını bildiren otomobil yarışında önemli bir adım attı. Kamu yollarında kendi kendini sürme teknolojisini test etmek için Kara, Altyapı ve Ulaştırma Bakanlığı. • Kendinden tahrikli arabalar: bilmeniz gereken her şey Elma, Google ve Uber gibi firmaların yanında, özerk araçlar alanına girmek için en son teknoloji endüstrisidir. Samsung, akıllı telefonlar ve …

Devamını Oku »

Neden Mercedes Tesla'dan Daha İyi Kendi Kendine Sürüş Teknolojisine Sahip? »AutoGuide.com News

Mercedes-Benz uzun süredir kendinden tahrik sistemleri söz konusuysa, güncellenmiş S-Serisi'nin piyasaya sürülmesiyle korunmayı planladığı bir konumda. Mercedes, bu yılın ilerleyen saatlerinde piyasaya çıkacak olan büyük gövdeli sedan revize edilmiş versiyonunu "özerk sürüşün geleceğine doğru atacak bir adım daha atacak" dedi. Ve bu, zekice hazırlanmış halkla ilişkiler propagandası gibi görünse de – çoğunlukla öyleyse- şüphe etmek için hiçbir neden yok Geçen …

Devamını Oku »

Yakıt tasarruflu, kendi kendine sürüş teknolojisinde Valeo satışları% 22 arttı

Laurence Frost Reuters 27 Nisan 2017 10:13 CET Fransa tedarikçisi Çarşamba günü yaptığı açıklamada, yakıt tasarrufu ve otomatik sürüş için güçlü talep üzerine 2017 yılındaki umut verici hedeflerini yinelediğini açıkladı. Paris'in üç ayda bir satışları, Teknolojisi. Şirket, bir önceki yıl 3.92 milyar olan geliri Ocak-Mart döneminde 4.77 milyar euroya (5.19 milyar $) yükselterek, bildirisinde CEO'su Jacques Aschenbroich açıklamalarında "dört iş …

Devamını Oku »

Apple, otomobil üreticileri, California'nın kendi kendine sürüş araç test politikalarında değişiklik önermektedir

GÜNCELLENDİ: 4/28/17 4:21 ET – ayrıntıları ekler Apple Inc., California eyaletinden sürücüsüz araba teknolojisini takip etmenin en yeni işareti olan kendi kendine sürüş otomobil politikalarında değişiklik yapmasını istedi. Cuma günkü bir mektupta Apple, geliştirilmekte olan politikada bir dizi öneri değişikliği yaptı ve Kaliforniya ve diğerleriyle "çalışmak için sabırsızlandığını açıkladı ve" böylece hızlı teknoloji geliştirme, Seyahat eden halk. " Google'ın kendi …

Devamını Oku »

Kendi kendine çalışan teknoloji, birleşmeler ve devralmalar için pazarı artırabilir

Cruise Automation'ın kurucularından Daniel Kan ve Kyle Vogt, sol taraftan GM Başkan Dan Ammann'la birlikte. Mart 2016'daki anlaşma 1 milyar dolar değerinde oldu. Kendi kendine sürülen otomobilleri kullanmak için yapılan yarış, birleşme ve satın alma pazarına yeni bir hayat getirebilir. ABD'deki siyasi belirsizlik ve yükselen faiz oranlarının diğer endüstrilerdeki anlaşma işlemlerini yavaşlatması beklense de, otomobil üreticilerinin, tedarikçilerin ve teknoloji şirketlerinin …

Devamını Oku »

Uber, kendi kendine sürüş teknisyeninin merkezindeki exec'i indiriyor …

                                     Uber, alfabe Waymo'nun hırsızlığı paylaşan devi hırsızlığı suçlayan bir davanın merkezinde yer alan kendi kendine çalışan otomobil operasyonlarına yön veren bir yöneticiyi indirdi.                                                                       Perşembe günü bir Uber sözcüsü, Anthony Levandowski rolünden istifa edeceği yönündeki basında çıkan haberlere teyit etti. Medya raporlarında belirtilen bir e-postaya göre Levandowski, "Waymo dava geri kalanı boyunca" özerk sürüş konusunda "reddedilecek" ancak diğer …

Devamını Oku »

Kendini iyileştiren araba: kendine has bir araba – resimler

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                                                                                                                                                              …

Devamını Oku »

Görevli: Apple, California'da Kendi Kendine Sürüş Yapan Otomobillerini Test Ediyor!

                         Teknolojinin cesaret ve zarif tasarımıyla yakında arabalara girecek olan bir şirketten Apple, mobilite işine girme planları konusunda çok sessizdi. Bununla birlikte, son zamanlarda, kendi evinde California eyaletinde bazı kendinden itici araçların test edilmesine izinler için başvuruda bulundu ve California Motorlu Taşıtlar Departmanı şimdi bunu resmen onayladı. İzin, Apple'ın kendinden tahrikli bir otomobil filosunu, muhtemelen otomatik alana giren Google ve …

Devamını Oku »

Kendini iyileştiren araba: Kendine önem veren bir araba

Bir Porsche Boxster'ın tertemiz siyah kaputuna tel metal fırçalamasını istediği için rahatsız edici bir istek var. Fakat biz teslim etmeden ve kazımamızdan önce, "Bu aklımı uçuracak" İlk tereddütten sonra, bazı dirsekli gresler koyduk ve silen metal fırça boya kalın, pürüzlü oluklar bıraktı. İki dakika boyunca, çoğu insanın kaputun yıkıldığına ikna edecek işaretlerde sessizce duruyoruz – ama sonra bir şeyler olur. …

Devamını Oku »

J.D. Power Tech Choice Study, Kamuoyu Kendi Kendine Sürüş Yapan Otomobillerden Daha Şüpheleniliyor: Tek Bir Çalışma Yazıyor

Gen Y hariç tüm diğer gruplar kendi kendine süren otomobillerden kuşkulanıyor. Bu, otomobil üreticileri ve teknoloji geliştiricileri için güçlük çeken güvensizlik meselesidir. Şüphecileri nasıl üstesinden gelebilirler? Bebeğinizin adımlarını atarak. Kaynak

Devamını Oku »

Kendi kendine sürüş sırlarını nerede keşfedebilirim

Özerk araç gelişimi son derece rekabetçi bir hale geldi ve teknoloji üzerinde çalışan şirketler, planlarını yelekle yakın tutmaya eğilimliler. Ancak, bu sırların sürmediği bir yer var: California Motor Vehicles Bölümü. California, toplu yollarda özerk araç testlerini düzenleyen az sayıdaki eyaletten biridir. Ve Silikon Vadisi'ne ev sahipliği yapan California, damarlarında motor yağı bulunan teknoloji meraklıları, otomobil ve teknoloji dünyasını birleştirmeye çalışıyor. …

Devamını Oku »

Apple kendi kendine sürüş araba test planı, teknoloji programının ipuçlarını verir

SAN FRANCISCO – Apple Inc, bu ayın başlarında California düzenleyicilerine gönderilen belgelerde kendi kendine sürüş araçlarının operatörlerini yetiştirme planını açıkladı ve şirketin otonom araç teknolojisi özlemlerinin en son ipuçlarını verdi. Apple, 14 Nisan'da kendine ait otomobillerini California Motorlu Taşıtlar Departmanı tarafından test etme izni aldı ancak şirket, planı hakkında hiçbir şey söylemedi. Eyalet, Reuters'e Apple'ın başvuru belgelerinin 41 sayfasını yayımladı …

Devamını Oku »

Lipid çift katmanının kendi kendine montajının simülasyonu …

Kendi kendine montaj mekanizması Mevcut çalışmadaki (2) fosfolipidlerin hepsi, kendi içinde iki katmanlı yapıya sahip olabilirler Simüle edilen tüm atomlu lipid kuvvet alanına bakılmaksızın. Slipids kuvvet alanına dahil edilmeyen POPS, Lipid14 veya Charmm C36 kullanılarak tarif edildiğinde çift tabakalar oluşturdu. Lipidler, ancak iki yinelemenin tamamında (bir Slipids POPC ve bir C36 POPS tekrarına bakınız), simülasyon süresinin 1 μs'inde iki katmanlara …

Devamını Oku »

GM, Silikon Vadisi'ndeki kendi kendine sürüş çabasını artırmak için …

                                     General Motors, özerk sürüş çabalarını artırarak 14 milyon dolarlık yatırım yapıyor ve San Francisco'daki yeni bir araştırma merkezinde 1,100 iş yükleniyor.                                                                       En büyük Amerikan otomobil şirketi, otonom araç araştırması endüstrisindeki bir yarışın ortasında Perşembe günü bu duyuruda bulundu. GM, California, Arizona ve Michigan'daki Cruise Automation ünitesi aracılığıyla özerk araçlarını denemekle birlikte, yeni girişim bu çabaları hızlandıracak. GM'in …

Devamını Oku »

Nori West stiliyle kendine hayran bırakıyor

                     2017-04-13 17:39:00                                           Güneşin günlüğünün çocukları için bir ikonuşa geldi … Kuzeyde onlardan biri. Kuzeyin stilini mercek altına aldık … Kanye West ve Kim Kardashian'ın kızları Kuzey güzelliği ve tarzıyla büyülüyor. Doğadaki ve gelen tarzından ödün vermeyen Kuzey, annesi ile takım giyinmekten hoşlanıyor. Genelde siyah tercih sebebi, tütü eteğe bayılan minik stil ikonu özel davetlerde de ışıltılı gece …

Devamını Oku »

Kendi kendine çalışan tekniğin araba-eat-araba dünyasında …

                                                                                                          Google'ın kendi kendini sürüş otomobilinin nihai prototipi.      İlk önce, sadece bir rüyaydı. Sonra, robot endüstrisindeki en az sayıda mühendis tarafından üstlenilen tuhaf bir araştırma projesi haline geldi.                                                                                 Artık kendinden tahrikli arabalar ulaşımı dönüştürmenin eşiğindedir. Özerk araçlar için teknoloji yaratan endüstri, özgürce akan fikirlerin işbirlikçi bir alanından yüksek hızlı bir yol …

Devamını Oku »

NASCAR yarışçısı kendi kendine sürüş teknolojisini benimsiyor

Landauer: Bir denge istiyor DETROIT – NASCAR sürücüsü ve Stanford Üniversitesi mezunu olan 25 yaşındaki Julia Landauer, işçinin sporunun Silikon Vadisini büyüledi yeni teknolojileri birleştirmenin bir yolunu bulmaya kararlı. Fakat O, özerk sürücü teknolojilerinin NASCAR ile zorlu bir satışla karşı karşıya olduğunu onaylıyor. NASCAR yöneticileri "geçen hafta SAE International'ın Dünya Kongre Deneyimi'nde yaptığı açıklamada Landauer," sporun bütünlüğüne olan bu kararlılığa …

Devamını Oku »

Berlin, bisiklet hatlarını genişletmek için kendi kendine sürüşü onayladı …

                                                                                                          Bu 1 Haziran 2014 dosya fotoğrafında, insanlar Berlin, Almanya'daki Brandenburg Kapısı'na doğru dönüyor. Berlin'deki yetkililer ve bisiklet kampanyacıları, Alman başkentindeki araç trafiğini azaltmak amacıyla bisiklet yollarını geniş çaplı olarak genişletmeyi kabul ettiler. Yerel basında, iki tarafın yılda yaklaşık 50 milyon avro (53 milyon dolar) yatırım yapma kararı aldığı bildirildi. Berlin gazetesi B.Z. Cuma günü …

Devamını Oku »

Kendine Feel İzin Ver

Büyümek, çoğumuza bir çeşitlilik olarak güç fikri takdim ediliyor gibi görünüyor Stoacıların. Sıklıkla, güçlü olmak bizim koyu duygularımız hakkında sessiz olmak demektir. Güçlü kişilerin mutluluğu projelendirdiği söyleniyor; Karanlıklarını kendilerine saklıyorlar. Güçlü insanlar başkalarının önünde kontrolü kaybetmez. Ancak bu güç fikri tamamen haksızdır. İnsanlar tam bir duygu spektrumunu yaşarken hepimiz yaparız. Hep mutlu değiliz, her zaman her şeyin üstünde, her zaman …

Devamını Oku »

Udacity'nin kendi kendine sürüş taksi üssü Voyage, Uber'i hedef alıyor

       FRANKFURT – Silikon Vadisi'nde online eğitim başlatma Udacity Perşembe günü yaptığı açıklamada, şirketin Uber Technologies Inc gibi amaçları alarak kendi kendine sürüş taksileri geliştiren bir şirketi devirdiğini söyledi. Udacity, Google'ın kendi kendine çalışan otomobilinin geliştirilmesine öncülük eden Google X araştırma laboratuvarının kurucu ortağı Sebastian Thrun tarafından ortaklaşa kuruldu. Voyage Auto olarak adlandırılan yeni şirket, kendi araçlarını kurmayacak, ancak mevcut …

Devamını Oku »

Daimler, kendi kendine çalışan otomobil sistemleri geliştirmek için Bosch'la birleşiyor

Mercedes'in ana şirketi Daimler, Alman otomobil mühendisleri Bosch'la tamamen özerk sürüş sistemleri geliştirmek için yeni bir ortaklık kurduğunu açıkladı. Yollar "önümüzdeki on yılın başlangıcı" itibariyle. İki şirket, sistemin ne zaman hazır olacağına ilişkin kesin bir tarihe geçmiyor, ancak mümkün olduğunca erken sunulacağına söz veriyor ve 2020'lerin başında hedefi Mercedes'in önceki zaman çizelgesiyle uyumludur. Bosch'un kendi kendine sürüş otomobilleri konusundaki deneyimi …

Devamını Oku »

15 Küçük Yol, En İyi Yeşeyi Kendine Kestiriyor …

@aniamisyyy 1. Çevrenizdeki herkesle karşılaştırarak hayatınızı kendiniz sabote ediyorsunuz. Başkalarının hayatına karşı kendinizi sürekli olarak değerlendiriyorsanız, içerik hayatı yaşayamazsınız. Yapmamayı öğrenmek en zor şeylerden biridir, ancak karşı koyduğunuz kişiyi karşı karşıya kaldıkça ne kadar mutlu olursanız edersiniz. 2 Sağlığınızı ihmal ederek kendiniz sabotaj yapıyorsunuz. Spoiler Uyarısı: Kendinize bakmamak (fiziksel olarak, zihinsel olarak ve içinde bulunan her şeyden) neden bok gibi …

Devamını Oku »

Bosch, Daimler kendi kendine sürüş taksi servisinde ortak

       Robert Bosch ve Daimler, önümüzdeki on yılın başlangıcına kadar 2020 yılına kadar kendi kendine sürüş yapabilen bir taksi hizmetini sunacak bir sistem geliştirmek için ortak çalışıyorlar. Şirketler, belirli koşullarda insani müdahaleye gerek duymayan 4. Seviye – ve tamamen sürücüsüz 5. Seviye – kentsel alanlarda özerk araçlar çalıştırmak amacıyla özerk yazılım üzerinde işbirliği yapacaklarını söyledi. Bosch Salı günü yaptığı açıklamada, …

Devamını Oku »

NASA Kennedy, kendi kendine sürüş geliştirmeye yardım etmek için ortak …

                                                                                                          Kennedy Uzay Merkezi'ndeki Shuttle Landing Facility pistinin bu hava fotoğrafı Güneybatı'da görünüyor. Çoğu ticari pistten daha uzun ve geniş olan bu, 15.000 feet uzunluğunda ve 300 feet genişliğindedir. Space Act Anlaşması uyarınca NASA tarafından desteklenen Central Florida Automated Vehicle Ortaklığı kapsamında süresiz otomobiller için bir test sitesi olabilir. Space Florida şu anda, çeşitli ticari …

Devamını Oku »

Uber kısa sürdükten sonra kendi kendine çalışan otomobil programını sürdürüyor …

                                                                                                          Bu pazartesi, 12 Eylül 2016, fotoğraf, bir grup kendi kendine sürüş Uber aracı, Pittsburgh'daki Uber'in Gelişmiş Teknolojiler Merkezi'ndeki bir medya önizlemesi sırasında gazetecileri sürmek için kendilerini konumlandırıyor. 27 Mart 2017 Pazartesi günü Uber, hafta sonlarında meydana gelen bir kaza sonrasında askıya alınmasının ardından Arizona ve Pittsburgh'daki kendi kendine sürüş otomobil programını yeniden başlatacağını açıkladı. …

Devamını Oku »

Uber, kazadan sonra San Francisco'da kendi kendine sürüş otomobil programını sürdürüyor

Fresco News tarafından dağıtılan bir videodan elde edilen görüntü, Arizona'daki Tempe'deki diğer iki aracın bulunduğu belirgin bir çarpışmadan sonra bir Volvo'nun yanına döndü. SAN FRANCISCO – Uber Technologies Inc. tarafından işletilen şoförsüz araçlar, kendiliğinden çalışan otomobillerinden biri Arizona'da düştükten sonra Pazartesi günü San Francisco'da yola çıktı ve binicilik şirketi "19459007] Arizona'daki Pittsburgh ve Pennsylvania'daki Pittsburgh'daki özerk araçlar, tespit edilmeyi reddeden …

Devamını Oku »

Kendi kendine sürüş Arizona'daki Uber kazası diğer sürücünün hatasıydı

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Gezen dev Uber, geçtiğimiz hafta Arizona'nın Tempe kentinde meydana gelen ciddi bir kazanın ardından özerk otomobil programını geçici olarak askıya aldığını açıkladı. Trafik kazası, Über'in değiştirilmiş Volvo XC90 SUV'larından ve birkaç başka aracın fotoğraf ve videolarını Twitter'da bir Ford Kenarının yanındaki bir caddenin ortasında yanlarında bulunan İsveçli SUV'u …

Devamını Oku »

İnsanların Kendine Kalan Kabul Edemediğini Söylemeyin: …

unsplash.com Terapistin ağzının her yerinde. İnternetin her yerinde ve Barnes and Noble'da. Justin Bieber bile bunu yapmanızı istiyor. Kendine kabul yeni bir mangal ve sizin için de iyi olsa da, gerçekten rahatsız edici. Kitaplar ve TED'ler, dikkatlilik ve şefkat yüklüyorlar, ancak süreçte meditatif olmaktan çok tokatlayan parçaları aydınlatıyorlar. Son bir yılda tükenmişlik, depresyon, öfke, suçluluk, pişmanlık, hayal kırıklığı vs. gibi …

Devamını Oku »

BMW, 2021'de Tam Kendi Kendine Sürüş Yapan Otomobilleri Satmak İstiyor »AutoGuide.com News

BMW, kendi kendine sürüş arabaları için 2021 yılına kadar yolda kalmayı planlayan bir zaman çizelgesi hazırlıyor. BMW'nin otonom sürüş kıdemli başkan yardımcısı Elmar Fickenstein, "2021'de seviye 3, 4 ve 5 olan bir araba teslim etmek üzereyiz." Düzey üç özerklik, sürücünün aracın kontrolüne odaklanmasını gerektirirken, dördüncü ve beşinci dereceler, sürücünün dikkatini çekmemek üzere tamamen kendi kendine sürüş olarak en iyi şekilde …

Devamını Oku »

Google'ın kendi kendine çalışan otomobil şirketi savaşı artırıyor …

                                     Google tarafından kurulan kendi kendine çalışan bir otomobil şirketi, eski bir yöneticinin Uber'e sattığı teknolojiyi çığlık atan servisin kendi robot destekli araçlarını inşa etmesine yardımcı olduğu iddialarını desteklemek için yeni kanıtlar sundu.                                                                                 Google'ın sekiz yıl önce taklit ettiği bir proje olan Waymo, Cuma günü bir San Francisco federal mahkemesinde açılan yeminli ifadelerle aldatmacalığa başladı. Belgeler, eski …

Devamını Oku »

Uber kendi kendine çalışan otomobiller tekrar California'ya geliyor …

                                                                                                          13 Eylül 2016 dosya salı olan bu Salı günü, şoförsüz modda bir Uber araba San Francisco'daki bir test sürüşü sırasında trafikte beklemektedir. Uber'in kendine tahrik eden araçları California'nın caddesine geri dönecek. Ancak şirket şu an için yolcu almayı planlamıyor. Motorlu Taşıtlar Kaliforniya Departmanı, 8 Mart 2017 Çarşamba günü yaptığı açıklamada, Uber'e iki Volvo SUV'sının …

Devamını Oku »

Continental, kendi kendine sürüş tekniğinde yüksek satış hedefini destekliyor

Andreas Cremer Reuters 2 Mart 2017 09:58 CET BERLIN – Continental, küresel otomobil üretiminde daha fazla büyümenin ve kendi kendini sürüş teknolojisine yapılan yatırımların getirisinden fayda sağlanacağından ötürü bu yıl daha yüksek satış beklentileri sağlamıştır. Continental, Perşembe günü yaptığı açıklamada, yükselen hammadde fiyatlarına rağmen satışlarını yüzde 6'dan fazla artırarak 43 milyar avroya (45.28 milyar dolar) çıkarmayı amaçladıklarını söyledi; "Yeni yıla …

Devamını Oku »

Toyota'nın En Son Kendi Kendine Sürüş Aracı Zamanla Daha Akıllı Oluyor »AutoGuide.com News

Lexus LS600hL, bireysel sürücü alışkanlıklarını öğrenecek ve diğer araçlardan gelen paylaşılan istihbarattan yararlanacaktır. Toyota'nın Sonoma, California'daki Prius Challenge etkinliğinde açıklanan 2.0 nesil gelişmiş güvenlik araştırması aracı, şu andaki nesil Lexus LS600hL üzerine kurulu ve güçlü drive-by-wire arayüzü içermektedir. Toyota, 2.0'ın sürekli ve sıklıkla yükseltilebilen, esnek, tak-çalıştır bir test platformu olarak tasarlandığını söylüyor. Ayrıca, tamamen Toyota Araştırma Enstitüsü (TRI) tarafından geliştirilen …

Devamını Oku »

Araştırmacılar, koloidal küreleri kendi kendine birleştirmek için koaksiyel hale getiriyorlar …

                                                                                                          Süper küreler, yeşil ile gösterilen bir elmas ve kırmızı ile gösterilen diğer piroklore olmak üzere iki iç içe geçmiş alt bölümden oluşur. Önceden oluşturulmuş kırmızı tetrahedral kümeler ve yeşil küreler, MgCu2 süper-kafese içine kendiliğinden yerleşirler. Kredi: NYU Tandon Mühendislik Fakültesi     Gıdalar, mürekkepler, boyalar ve kozmetik dahil olmak üzere bir dizi teknik uygulamada kullanılan koloidal …

Devamını Oku »

Beyrut İş Yerler | Gezipgordum.com Lübnan 'dan daha fazla En büyük şehirleri arasında bulun Beyrut ; Kendine özgü kültürel özellikleri, modern yapı ve tarihi kalıntıları çeşitli dünyanın dört bir yanından turist çekmeyi başarıyor. Orta Doğu'nun ticaret merkezi konumunda yer alan, vizesiz olan sebebiyle onun geçen günlerindeitesitesini arttırıyor.

Beyrut İşaretleri Beyrut Gez 장소 Hakkında Beyrut İşaret Olanakları Listesi Ülkenin lokomotif şehirlerinden olan Beyrut savaş sonrası yapılanma kalkınma planları sayesinde mazzam bir şehir silueti sergiliyor. " Orta Doğu'nun Paris'i " nitelendirilen kozmopolit başkent bünyesinde, İslam ve Hristiyan mabetler bir arada göze çarpıyor. Otel pahalıları araştıremek ve değerlendirmek. Ve rezervasyon yaptırmak için 1. Hamra Caddesi

Devamını Oku »

Portekiz'in mekanları | Gezipgordum.com İber Yarımadası Üzerinde konuşlanmış olan Portekiz kendine özgü kültürü, tarihi yapıtları ve birbirinden güzel plajlarıyla gelen tümlarlaini kendine hayran bırakıyor. Avrupa Kıtası'nın en çevre yeryüzü, görülmeye değer 18 ayrı alt bölge vardır.

Portekiz Siteleri Listesi Portekiz Sitemizin Faydaları Tarihte belirli bir zaman güçlü deniz krallığı yapan Portekiz ılıman iklime sahip olduğu için yılın her dönemi gezginlere ev sahipliği yapıyor. 92,100 kilometrekarelik yüz ölçümü bulunulan ülke, özellikle de coğrafi güzelliklerininitesitesini artırmayı başarıyor. Boylulara kozmetik, masmavi sularıyla dikkati çeken koylar ve engin tepeler, ülkede muazzam bir doğa manzarası yaratıyor. Otel için inceleme ve rezervasyon …

Devamını Oku »

Hollanda Bizans | Gezipgordum.com Hem huzurlu hem de eğlence dolu ] Hollanda hayret verici tabiatı ile doğa ananın ve torpillerin geçtiği ülkeler arasında ve kucakladığı tarih ile ansiklopediyi andırıyor. Hollanda gezilecek yerler başlıklı yazımızda ise, Hollanda'ya seyahatine çıkmadan önce göz atabileceğiniz şehirler ve gezilecek yerler Batı Avrupa'nın en çok ziyaret edilen ülkelerinde Hollanda, yani diğer adıyla ] " Özgürlükler Ülkesi " kendine sahiptir ile dikkat çekiyor. Deniz seviyesinin altında seyreden ülke toprakları gözle görülebilir bir farkı ortaya koyarken, hangi şehre giderseniz gidin karşı karşıya kalırsınız, arabalardan daha fazla yoğunlukta olan bisikletler ve rengarenk laleler Hollanda'yı simgeleyen detaylar arasında yer alıyor. Gökyüzünden dahi muntazam bir görüntüye sahip olan bu ülkede hem sakinliği hem de hızlı yaşamı tadabilir; Otel için inceleme ve rezervasyon yaptırmak için Hollanda Duş Konum Listesi Diğer Avrupa ülkelerinin bambaşka bir mimari ve tarihle karşımıza çıktı Hollanda kültür ve sanat bakımından da gezginleri doyuracak altyapıya sahip. 1. 1. Amsterdam

Yalnızca Hollandanın değil, Avrupa görülmeye değer birçoğumuzun aklına Çim Kahve 'leri ve Kırmızı Işık Mahalle ' i bunları getirirken elbette sadece bunlarla sınır değil. Şehri boylu boyunca saran Dam Meydanı Madame Tussauds Müzesi Yeni Kilise Bu yazı için etiket yok. masterdam Kanalları Vlaamse Fritez ibadethane olarak yapılan Beginjnhof tüm gidenlerin Iamsterdam yazısı önsöz mutlaka bir fotoğraf çektirdiği Rijksmuseum yerel bira …

Devamını Oku »

Waymo, eski çalışanın kendi kendine sürüş tekniği sırlarını çaldıklarını iddia ediyor

Bir işarette özerk araç geliştirmede üstünlük savaşı ısınırken, Waymo eski bir çalışanın kendi lidar sistemi tasarımlarını çaldığını iddia ederek Über'e dava açıyor. Waymo, tedarikçilerinden birinin e-posta zincirine yanlışlıkla dahil edildikten sonra fikri mülkiyet hırsızlığına maruz kaldığını söyledi. Waymon, e-posta zincirinin, şirket içinde tasarlanmış bir Waymo lidar devre kartına benzeyen benzersiz bir Uber lidar devre kartı tasarımı olduğunu söyledi. Aralık ayında …

Devamını Oku »

Kendi kendine çalışan otomobil tekno … ile çığlar öngören

                                     Karlı Sierra Nevada'da 22 yılın en büyük kar paketiyle bol kış var. Kayakçılar ve snowboardcular için harika bir haber, ancak tüm bu kar, çığ düştüğünde anında güzel bir battaniyeden ölümcül bir örtüye dönüşebilir.                                                                                 64 yaşındaki doktor Tom Barker, kendisinin ve bir arkadaşının Mt.'nin kapalı bir alanına girmesinden sonra, 9 metre karın altında gömülmesine neden olan bir …

Devamını Oku »

Kendi kendine çalışma yasası küçük oyuncuların yanına düşebilir

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Bazı devletler, teknoloji şirketlerini sınırları dahilinde kendinden tahrikli araçlardan dışlayabilecek yasaları düşünüyorlar. Bazı ülkelerde Güvenli Özerk Araç eylemleri olarak belirtilen tasarıdaki yasa, yalnızca araç üreticilerinin Eyaletteki kendi kendini sürüş filosunu test edin. "Amerikalılar hangi arabada bir araba seçme hakkına sahipler gibi Uter ve Waymo gibi özerk sürüş sistemleri …

Devamını Oku »

Atlanta, diğer şehirler kendi kendine doktora için göz testi …

                                                                                                          26 Şubat 2017 tarihli bu Perşembe günü, süresiz bir servis otobüsü, Austell, Ga'daki Riverside EpiCenter'da sergilenmekte olan izlerini izlerken, kendinden tahrikli araçlar, arabalar, otobüsler, bisikletçiler ve bisikletle dolu hareketli bir Atlanta caddesine araç kullanmaya başlayabilir. Kentin gelişmekte olan teknolojiyi test etmek için ülke çapında diğer topluluklarla yarışması nedeniyle üniversite öğrencileri. (AP Fotoğraf / David …

Devamını Oku »

'VW kendi kendine olan karmaşasından ödeyecek olan fiyatı kaçırıyor'

Volkswagen'in derinden zararlı dizel çöküşü ortadan kalkmaz. Skandala neredeyse 18 ay kala, Alman devi hala hile yapmakla suçlanıyor – ve çok daha fazlası. Çok milyon avro maaşına sahip suçlu yöneticilerin yanı sıra çok daha az kazanan üst düzey yöneticiler iş ve mesleklerini kaybetti. Eski başkan Ferdinand Piech, skandal kırılmadan önce mazot konusunu yönetim kurulu toplantısında gündeme getirdiğini iddia ettikten sonra, …

Devamını Oku »

GM binlerce kendi kendine çalışan cıvata EVleri kurmak istiyor

Gelecekteki sürüş paylaşımı hizmetlerinin geliştirilmesinde diğer otomobil şirketlerine katılıyor Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda …

Devamını Oku »

Uber, kendi kendine çalışan mühendisliğe yardım etmek için Google gazisi Singhal'ı seçti.

Amit Singhal, yaklaşık bir yıl önce Google'dan ayrıldığını açıkladı ve bir sonraki kariyerinin hayırseverliği kapsayacağını söyledi. Fotoğraf kredi: Reuters SAN FRANCISCO – Yürüyen firma Uber Technologies Inc. CEO'nun Travis Kalanick ile yakın çalışması ve şirketin kendi kendine sürüş otomobil programının geliştirilmesine yardım etmesi için Google aramasının arkasındaki adamı işe aldığını söyledi. Amit Singhal kişisel blogunda Cuma günü yaptığı açıklamada, Google'ın …

Devamını Oku »