24 Kasım 2017,Cuma
Anasayfa » Tag Archives: ilgili

Tag Archives: ilgili

Hamilelikle İlgili İlginç Bilgiler | Annelik ve Gebelik

Hamilelik normal koşullarda 9 ay 10 gün sürede zor zorlanacak bir süretir. Bu surete hem de bebekte muazzam değişiklikler olur annede. Sonuç olarak tümüyle bir insanın görüntüsünde, yavru bir birinin çıkarması. Elbette insanlığın en başından berilitin kadınlar hamile kalıyor. Peki hamilelikle ilgili ilginç bilgiler nelerdir? Tarihte neler yaşanmıştır? Belki daha uzun süredir var tüm dünyada kayıtlara geçen uzun süre hamilelik …

Devamını Oku »

ICANN, Afrika DNS Pazar Araştırması ile İlgili Nihai Raporunu Yayınladı

Atanmış İsimler ve Numaralar İnternet Kurumu (ICANN), Afrika Etki Alanı Adı Sistemi (DNS) Pazar Çalışması ile İlgili Nihai Raporunun yayımlanacağını duyurmaktan memnuniyet duyar. Bu çalışma, ICANN'ın bölgesel DNS endüstrisini destekleme ve geliştirme yönündeki çabaları kapsamında hizmet etmektedir. Raporda, 54 ülkeyi de içeren bölgedeki ilk örneği. Görevlendirildi: Afrika'daki DNS sektöründe güçlü ve zayıf yönlerini vurgulayın, Mevcut fırsatlardan daha iyi yararlanma ve …

Devamını Oku »

Saçlarla İlgili Pratik Bilgiler | Saçlarım ve Ben

1- Tel tokları uzunluğu üste gelecek şekilde takın, böylelikle saçlarınızı sımsıkı tutar ve kaymazlar. 2- Saçlarınızı yıkadıktan sonra geniş dişli bir tarak ile tarayın. Diğer taraklar saçlarınızın hasar görmesine neden olur. Daha da kolay taranmasını sormak için bir tarak kremliyken tarama işlemini yapın.

Devamını Oku »

Zafer Bayramı İle İlgili Şiirler

Bu sayfada zafer bayramı şiirleri, zafer bayramı şiirleri, zafer bayramı şiirleri 2 kıtalık bulunmaktadır. Yeter ki siz oku. ZAFER TÜRKÜSÜ Yaşama bakıldığında ölüyüz bakalım, Zafer göz yummadan koşana gider. Bayrağa kanının alı çalmayanın, Gözyaşı boşana boşana gider. Kazanmak istersen sen de zaferi, Gürleyen sesinle doldur gökleri. Zafer dedikleri kahraman peri, Susandan kaçar da coşana gider. Diriler şerefli, ölüler şanlı. Yurt …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Ramazan Ayı İle İlgili Hadisler

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Oruç ve Ramazan ile ilgili Hadis ve Ayetler

Ayet-i Kärn Ramazan ayı, okula giden yol gösterici, doğrulan ve doğruyu eğriden ayırmanın açık delilleri olarak Kur'an'ın indirildiği aydır. Öyle ki sizden ramazan ayını idrak edenler onda oruç tutsun. Başka bir günlerde kaza etsin. Allah senin için kolaylık ister, zorluk istemez. Bütün bunlar, sayıyı tamamlamanız ve doğru yolu göstermesine karşılık, Allah'ı tazim etmeniz, şükretmeniz içindir. (Bakara Suresi 185) Ey iman …

Devamını Oku »

Ramazan Ayı ile ilgili sözler

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

ORUÇLA İLGİLİ GENEL BİLGİLER

                      Oruçla İlgili Hakkında Bilgiler Oruç, İslâm'ın beş temelinden biridir. Farsça "ruze" kelimesinden Türkçe'ye geçmiştir. Önceleleri "Oruze" (günlük) olarak kullanılmış; Daha sonra "Oruç" şeklinde telaffuz edilmeye başlamıştır. Arapça karşılığı "savm" ve "sıyam" dır. Savm; 'Yiyip-içmemek', 'hareketsiz kalmak' ve 'her şeyden el etek çekmek' anlamlarına gelir. Terim olarak oruç, "ibadet niyetiyle tan yerinin ağarmasından güneşin batmasına kadar, içme ve cinsel …

Devamını Oku »

Serhat Akın'dan eşiyle ilgili çarpıcı itiraf

                     2017-06-10 22:37:00                                                                      'Kadıköy'ün Boğası' lakaplı Fenerbahçe'nin efsane futbolcularından Serhat Akın, Survivor'da eş çarpıcı itiraflarda bulundu. Serhat Akın'ın bugüne kadar kamuoyunun gizlediği eşinin, evlendrimi dönmede engelli bir oğlu ve bir kızı varmış. Survivor'da stres ve gerginlikten bahsedilen isim isim, 11 senedir evli olduğu Eileen Akın'la birleşki yaşadıklarını belirterek, Tanıştığımızda Eileen'in 2 yaşında engelli oğlu vardı. Şu …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Ducati, Satın Alma İle İlgili İlgi Çekiyor, Motosiklet Firmaları

                         İkonik İtalyan motosiklet markası Ducati, özel sermaye şirketleri ve motosiklet üreticilerinin ilgisini çekiyor çünkü sahibi Volkswagen AG satışları değerlendirdiğinde, meseleyi tanıdıklarını belirtti. Permira ve CVC Capital Partners gibi şirketlerin ve Hero MotoCorp Ltd'nin de aralarında bulunduğu şirketlerin teklifleri tartılıyor ve halk, görüşmelerin özel olduğu için tanımlanmamasını istiyor. Kraliyet Enfield motosikletinin yapımcısı Eicher Motors Ltd de ilginizi çekebilir, iki insan …

Devamını Oku »

Uber, kamyonla ilgili isteğe bağlı hizmeti genişletir

                                                                                                          Ride paylaşım hizmeti San Francisco merkez binası burada görülen Uber, akıllı telefon uygulamasıyla kargo teslimatlarında kamyona genişleme ilan etti.      Kaynak

Devamını Oku »

FCC seçimleri düzenlenmesiyle ilgili bir savaşı başlattı …

                                                                                                          Federal Haberleşme Komisyonu Komisyon Üyesi Ajit Pai, 26 Şubat 2015'te düzenlenen dosya fotoğrafta Washington'da düzenlenen "Net Tarafsızlık" konulu açık duruşma ve oylamalar sırasında konuştu. FCC, AT & T, Verizon ve Comcast gibi geniş bant sağlayıcılarının internete müdahale etmesini önlemek amacıyla tasarlanan "net tarafsızlık" kurallarının yürürlükten kaldırılmasına oy vermeye oy verdi. (AP Resmi / Pablo …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

IPhone 8 ile ilgili yeni görseller sızdırıldı!

iPhone 8 hakkında iddialar ortaya atılmaya devam ediyor. Apple 'in yeni telefonuna ait olduğu, tarama görselleri paylaşılmış. Bu yazıya yapılan yorumlar. iPhone 8'in tasarımı netleşiyor! Engadget tarafından oluşturuldu çıkartılan bu görseller birlikte birlikte, telefonun tasarımı hakkında kullanıcıları bilgilendirdi. Henüz hiç bir fotoğraf bulunmuyor. iPhone 'un tasarımı hakkında söylenti tasarımlarından yola çıkarak, tarama görsellerini gün yüzüne çıkarttı. Tarza görsellerine bakacak olursak, …

Devamını Oku »

AB, İtalya'yı Fiat emisyon davasıyla ilgili olarak soruşturacak

Handelsblatt Salı günü bildirdi BERLIN – Avrupa Komisyonu, İtalyan hükümeti Fiat Chrysler'in emisyon hileleri soruşturması üzerine İtalyan hükümetine yönelik ihlal davası açmayı planlıyor . Komisyon, İtalya'yı Fiat'daki dizel otomobillerdeki emisyon seviyelerini manipüle etmek için sözde cheat cihazlarının kurulumunu göz ardı etmekle suçladı. Gazetede, Fiat veya İtalyan hükümetinden herhangi bir yorum bulunmadığını bildirdi. İtalya ulaştırma bakanı Şubat ayında yaptığı açıklamada FCA …

Devamını Oku »

Çek mahkemesi, Rus hackerının ekstresiyle ilgili duruşmayı açtı …

                                     Amerikalı şirketlerde bilgisayarları kesmekle suçlanan ABD'li bir Rus askeri, güvenlik kaygılarından ötürü bir Prag cezaevinde iade davasına bakıyor.                                                                       Yevgeniy Nikulin'in Perşembe günü duruşması Prag'ın Pankrac hapishanesinde düzenleniyor. Nadir bulunan tedbir, davanın hassasiyetinin altını çizer. Çek yetkilileri Interpol, uluslararası bir emir çıkardıktan sonra Nikulin'i FBI ile işbirliği içinde 5 Ekim'de Prag'da tutukladı. O, bilgisayarlara saldırmak, LinkedIn, Dropbox ve …

Devamını Oku »

VW CEO, maliyet tasarrufuyla ilgili daha fazla sendika çatışması görüyor

Matthias Mueller: "Şüphesiz yolumuz zor." Andreas Cremer Reuters 10 Mayıs 2017 12:05 CET HANOVER, Almanya – Volkswagen Group'un üst düzey yönetimi, dizel emisyon skandalını takiben stratejik bir değişikliğin finanse edilmesine yardımcı olmak için otomobil üreticisi bir verimlilik sürücüsü önermesi nedeniyle emek liderleriyle maliyet tasarrufu konusundaki tartışmalarını bekliyor, CEO Matthias Mueller sözü geçen. Mueller, Çarşamba günü yapılacak yıllık ortak toplantı toplantısında …

Devamını Oku »

Okulların Şampiyonları Takımları Belli Oldu! Avanos, Nevşehir'de düzenlenen ve 51 KKTC'den 121 takım, 594 sporcunun yarıştığı Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Düzenlenen ödül töreniyle sona erdi. Spor Genel Müdürlüğü Okul Sporları Şube Müdürlüğü'ne, Türkiye 2007 yılından bu yana, Satranç Federasyonu ve Türkiye İş Bankası'nın destekleyicileri ile birleştiğinde Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Avanos Atatürk Spor Salonu'nda gerçekleştirilecek ödül töreni ile sona erdi. 3 Mayıs 2017 akşamında final yarışmasının ödül töreni; Nevşehir Valisi İlhan Aktaş, Gençlik Spor İl Müdürü Mustafa Ünlüer, Türkiye İş Bankası Kurumsal İletişim Müdürü Suat Sözen, Türkiye Satranç Federasyonu Başkanı Gülkiz Tülay, Avanos Gençlik Hizmetleri ve Spor İlçe Müdürü Kerem Yılmaz, TSF Başkan Vekilleri Prof. Dr. Yusuf Doğruer ve Aşkın Keleş , Yönetim Kurulu Üyesi Ümit Şifaver, Nevşehir Okul Sporları Şube Müdürü Aslan Uçar, Okul Sporları Şefi Hüseyin Karatut, Türkiye İş Bankası Kurumsal İletişim Birim Müdürü Müge Nevşehirli Veziroğlu, TSF Nevşehir İl Temsilcisi Birsen Babacan Çengel, antrenörler, öğretmenler, veliler, sporcular ve çok sayıda Davetlinin katılımıyla gerçekleşti. Spor Genel Müdürlüğü'ne düzenlenen Eğitim Takvimi, Satranç Türkiye Birinciliği'ni, Türkiye İş Bankası'nın destekleyicisi ve öğrencilere verdikleri hediyelerle ilgili daha fazla bilgi almak TSF Başkanı Gülkız Tulay, okul Larda satranç sporunun daha fazla yerinde alması ve öğrencileri bu sporla buluşturmayı çok önemsedikleri açıklama bulundu. Tüylü sözleşmeyi şöyle sürdürdü: "51 ilimiz ve KKTC'den 121 takım ve 594 öğrencimiz centilmence ve dostça hamle yaptılar 7 tane tur boyunca. Öğrencilerimiz okullarını zirveye çıkarmak için yarıştılar and 경쟁in birlik ve beraberlik ile iç içe geçtiği bir final heyecanı yaşattılar bizlere. Bu yazıda, yazarların yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, Açılış konuşmalarının ardından, 6 kategoride ilk dört dereceyi, 6 kategoride ilk dört dereceyi Elde Edilme Formu. Ders >> Küçükler Kızlar (19459006) >> Yazan: Küçükler Kızlar – – Küçükler Genel / Yıldızlar Kızlar – Yıldızlar Genel / Gençler Kızlar – Gençler Genel Küçükler Kızlar

Özel Kocatürk Ortaokulu, Manisa Kılıçarslan Ortaokulu, Samsun Çerkezköy Tepe Ortaokulu, Tekirdağ Mağaracık Ortaokulu, Hatay Küçükler Genel Özel Bursa Bahçeşe Bahçeşehir Koleji Ortaokulu, Ankara Özel Bursa Bahçeşehir Ortaokulu, Bursa ] Kaynak

Devamını Oku »

Mueller, maliyet tasarrufuyla ilgili olarak VW sendikalarıyla daha fazla çatışma görüyor

Matthias Mueller: "Şüphesiz yolumuz zor." Andreas Cremer Otomotiv Haberleri Avrupa 10 Mayıs 2017 12:05 CET CEO'su Matthias Mueller, dizel emisyon skandalını takiben stratejik bir değişikliğin finanse edilmesine yardımcı olmak için verimlilik güdüsünü artırdığından, Volkswagen Group'un üst düzey yönetici, emek liderleriyle maliyet tasarrufu konusundaki tartışmalara devam etmesini beklemektedir . Mueller, Çarşamba günü yapılacak yıllık ortak toplantı toplantısında "Yolumuz şüphesiz zorlu, sürtünmeye …

Devamını Oku »

Steve Jobs'la ilgili tekno-infüzyon operası yeni önem kazanıyor …

                                                                                                          Santa Fe Opera Genel Müdürü Charles MacKay, Apple'ın kurucu ortağı Steve Jobs'un hayatıyla ilgili tekno enfekte bir operanın 9 Mayıs 2017'de Salı, Santa Fe'de düzenlenecek bir basın toplantısında sonunda San Francisco, Seattle ve Indiana'ya gideceğini duyurdu. NM Santa Fe Opera, New Mexico'nun Sangre de Cristo Dağlarının eteklerindeki açık hava yaz döneminde Temmuz 2009'daki "Steve …

Devamını Oku »

Snapdragon 845 ile ilgili müthiş iddia!

Snapdragon 845 hakkında yeni bilgiler ortaya çıkmaya devam ediyor. Qualcomm'un ön önümüzdeki yılın üstünde segmetli telefonları için geliştirdiği Snapdragon 845 ile ilgili yeni bir iddia öne sürüldü. Snapdragon 845 oldukça iddialı geliyor! Qualcomm 'un önümüzdeki yıl düzenleyeceği etkinlikle birlikte gün yüzüne çıkartacağı yeni nesil güçlü işlemcisi, 7nm üretim döneminde geçirilerek üretileceği söylentisi ortalıkta dolaşmakta. Galaxy S8 gibi Galaxy S9 'da …

Devamını Oku »

Atatürk'ün sanatla ilgili sözleri – arabuloku.com

  Mustafa Kemal Atatürk sanata ve sanatçıya büyük önem vermiştir. Atatürk'ün sanat ile ilgili sözleri, Atatürk'ün sanat sözleri ve açıklamalar, Atatürk'ün sanat sözleri ve anlamları, Atatürk'ün sanat sözleri hakkında kısa yer verilmiştir. Bir millet sanat ve sanatkârdan mahrumsa, tam bir hayata sahip olmasın. Bir milletin güzel yeteneği güzel sanatlara verdiği değerle ölçülür. Sanat güzelliğin ifadesidir … Bu ifade sözüyle olursa …

Devamını Oku »

Atatürk'ün Fen İle İlgili Sözleri

  Atatürk'ün Fen Bilimleri İle İlgili Sözleri, Atatürk'ün Fen Bilimi İle İlgili Sözleri, Atatürk'ün Atatürk'ün bilim ve fen konularıyla ilgili sözleri 'Ün Bilim Fen İle İlgili Sözler Kısa olduğu. Dünyada her şey için, medeniyet için, hayat için başarı için en gerçek yol gösterici ilimdir, fendir. İtiraf ederim ki, düşmanlarımız çok çalışıyor. Bizden daha çok çalışmaya mecburuz. Çalışmak demek, boşuna yorulmak, …

Devamını Oku »

Atatürk'ün Barış İle ilgili sözleri

  Atatürk'ün Sözleri, Atatürk'ün Barış İle ilgili Söylediği Sözleri, Atatürk'ün Barış Hakkında Söylediği Sözleri Yurtta barış, dünyada barış için çalışıyoruz. (1931) Komşularıma ve bütün devletlerle iyi geçinmek Türkiye siyasetinin esasıdır. Türk Cumhuriyetinin temel prensiplerinden biri olan yurtta barış, dünyada barış gayesi, insaniyetin ve medeniyetin refah ve ilerlemesinden en esaslı etken olsa gerekli. Buna elimizden geldiğinde kadar hizmet etmiş ve ettirmek …

Devamını Oku »

GELİŞİMLE İLGİLİ TEMEL KAVRAMLAR, İLKELER VE GELİŞ …

                     2017-05-04 15:17:00                                                                                   GELİŞİMLE İLGİLİ TEMEL KAVRAMLAR, İLKELER VE GELİŞİMİ ETKİLEYEN FAKTÖRLER-2 Mehmet TUNÇER MEB Müfettişi / Sosyolog / İK Uzmanı C- PSİKO – SOSYAL GELİŞİM – PSİKOLOJİK GELİŞİM Erik Erikson'un Psikososyal Gelişim Kuramı Ertesi Kurtlar Vadisi'nin görüşleri istifa ettiklerini ifa ettiler. Erikson'un kuramı hakkında Freud'un görüşlerini uyuşmayan en belirgin yönleri şöyle özetlenebilir;

Devamını Oku »

IPhone 8'in RAM kapasitesi ile ilgili açıklama!

Akıllı telefon üreticilerinin amiral gemi modellerini kullanma ile buluşturması birlikte, gözler iPhone 8 modeli için Apple'a çevrildi. iPhone 4 hakkında bugünün kuruluşu TrendForce tarafından yayınlanan rapor ve bir yenisi daha eklenmiş oldu. Günümüzde üst seviye cihazlar için 4GB RAM standart hale getirken, iOS'un başarılı bellek optimizasyonu sayesinde Apple'ın iPhone modelleri düşük RAM kapasitesi ile bir derece iyi bir kullanıcı deneyimi …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

Nissan'ın yeni tasarım şefi bir efsaneyle ilgili

"Benim için bir Peter Pan varlığıydı, istediğim zaman tasarıma başladım." Nissan'ın Alfonso Albaisa Başlık: Kıdemli Başkan Yardımcısı, global tasarım, Nissan Motor Co Yaş: 52 Anavatan: Miami Birinci dil: İspanyolca Eğitim: Pratt Enstitüsü'nden endüstriyel tasarım lisans derecesi, 1988 İlk araba: 1970 Chevrolet Monte Carlo        NEW YORK – Alfonso Albaisa, Nissan Motor Co'daki yeni işinin zor olduğunu kabul ediyor. Bayanlar, ofis …

Devamını Oku »

İlk küresel simülasyon r ile ilgili yeni anlayışlar getiriyor …

                                                                                                          Görselleştirme, Chariklo'nun çift halkasının benzetiminden yapıldı. Film klibi URL'den indirilebilir. Kredi: Shugo Michikoshi, Eiichiro Kokubo, Hirotaka Nakayama, 4D2U Projesi, NAOJ      Japonya'daki bir araştırmacı ekibi, Güneş Sistemi'nde halkaları olduğu bilinen en küçük ceset olan Chariklo'nun etrafındaki iki halkayı modelledi (Şekil 1). Bu, tüm halka sisteminin halka parçacıkları için gerçekçi boyutlar kullanılarak simüle edildiği ve …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

Araştırmacı, politikle ilgili özelleştirilmiş içeriği söylüyor …

                                                                                                          Kredi: Buffalo Üniversitesi     Buffalo Üniversitesi İletişim Fakültesi ve İktisadi ve İdari Bilimler Fakültesi öğretim görevlisi Doç. Dr. Ivan Dylko'ya göre, siyasal web sitelerindeki yolunuza kavuşmak ve yalnızca inançlarınızla uyumlu içeriği görmek demokrasi için iyi değildir. Iletişim teknolojisinin politik etkileri konusunda uzman.                                                                                 Dylko, bir sitenin kişiselleştirdiği popüler bir teknoloji olan özelleştirilebilirliğin politik …

Devamını Oku »

Amber Heard, teknoloji milyarderiyle ilgili oluyor …

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın doğru olduğu ve önereceğiniz bilgiler. Açıklamaları okumaya devam ediniz: Eğer siz de bu konuda reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Tes, Meb'e Rehber Öğretmenlerle İlgili Değişikliği …

Türk-Eğitim-Sen tarafından yapılan açıklama, Rehber öğretmenlerin niteliklerine örtüşmeyen yeni Bir yönetmelik ya da yönetmek için yönetmelikte değişiklik yapılacağı duyumları ile ilgili Sendikamıza ayrıntılı bilgi vermek ve ayrı taslak metnin tarafımıza gönderilmesi ve değişikliğin tüm paydaşların görüşleri de alındıktan sonra, gerekiyorsa, ihtiyacınız Türk eğitim-Sen tarafından MEB'e yazılı başvuruda kâr Kaynak

Devamını Oku »

Eğitim İle İlgili Sloganlar – arabuloku.com

  Eğitimle İlgili Sloganlar, Eğitimle İlgili Sloganlar örnekleri, Eğitimle İlgili Sloganlar nelerdir, Eğitim İle İlgili güzel Sloganlar Akıl, bilim ve birlik, güçlü Türkiye nedir. Bilgi çağında eğitim; Ekmek, su, vitamin. Okul kapısı, bilgi yuvası. Çağdaş eğitim, huzurlu ülke, aydınlık gelecek. Eğitim çağdaş medeniyetlerin kapılarını açan eldir. Eğitimli bir millet, gelişmiş bir memleket. Parlak bir gelecek için iyi bir eğitim gerek. …

Devamını Oku »

Eğitim İle İlgili Sözler – arabuloku.com

  Eğitimle İlgili Sözler Kısa, Eğitim İle İlgili Sözler Facebook, Eğitim hakkında sözler, Eğitim İle İlgili güzel Sözler Eğitimli insanlar yapabileceklerinden kaldırsın söylemeye izin verirler. Konfüçyus Eğitim sisteminin belirli bir düzene göre işlemesine karşılık, yaşam okulu düzensiz ve karışıktır. Albert Einstein Bir ulusu yönetmek, dört çocuğu eğitmekten daha kolaydır. Winston Churchill İnsan eğitilmesi zorunlu ve tek yaratıktır. lmmanuel Kant Bilgiyle …

Devamını Oku »

Tesla, 'tehlikeli derecede arızalı' otopilot yazılımıyla ilgili dava açtı

SAN FRANCISCO – Tesla A.Ş., araç sahipleri tarafından Autopilot özelliğinin devreye girdiğinde "tehlikeli olarak kusurlu" olduğunu iddia ederek dava açtı. Elektrikli otomobil üreticisinin özerk sürüş teknolojisine dayanan sürücüler Çarşamba günü ABD'nin San Jose Kaliforniya'daki Bölge Mahkemesinde (19459003) dosyalanmış bir şikayetine göre "yarı pişmiş yazılımın beta test cihazları olan Tesla araçlarını tehlikeli hale getirdi" Autopilot etkinleştirildiğinde tüketiciler, 81,000 $ ila 113,000 …

Devamını Oku »

25 Nisan Salı günü üst düzeydeki Coğrafi Adlarla ilgili GNSO Web Seminerine katılın

En üst düzeydeki coğrafi isimler konusunda ICANN topluluğuyla meşgul olma çabalarının bir parçası olarak Genel İsimleri Destekleme Kuruluşu (GNSO) Yeni gTLD Sonraki Prosedürler Politika Geliştirme Süreci (PDP) Çalışma Grubu (WG), İki Web seminerinde 25 Nisan 2017 Salı günü düzenlenecek. Seminer, ICANN59'da Johannesburg, Güney Afrika'da devam edecek olan bir tartışmanın başlangıcı olacaktır. PDP WG liderliği ekibi, web seminerinde sunulan pozisyonlar üzerinden …

Devamını Oku »

Afetle ilgili dili büyük veri ile inceleme …

                                     İnsan Faktörleri ve Ergonomi Topluluğu, Andrew Hampton ve Valerie Shalin'i, "İhlalin Duyguları: Toplumsal Medyada Acil Durum Ölçütü Olarak Sözlü Seçim" başlıklı yazısı için 2016 İnsan Faktörleri Ödülü'nü tebrik ederek kutluyor. İnsan faktörlerinin / ergonomisinin (HF / E) araştırmasında mükemmelliği tanıyan ödül, Topluluğun amiral gemisi olan İnsan Faktörleri'nde kazanılan kağıdın 10.000 ABD Doları nakit ödül ve yayınını sunar. Yazarlar çalışmalarını …

Devamını Oku »

HECT-family E3 ligazlar, hemen hemen her ökaryotik süreci kontrol etmek için protein substratlarını ubikitinleştirir ve bunlarda yanlış regülasyona uğrarlar. HECT-ailesi E3 ligazları, protein desteğini hızla kontrol etmek için, protein substratlarını ubikitinleştirirler ve bu proteinlerin tümü ökaryotik prosesleri kontrol etmek üzere hatalardan düzelirler. Çok sayıda hastalık. Bununla birlikte, HECT E3'lerin anlaşılması, seçici ve güçlü modülatörlerin azlığı ile sınırlıdır. Bu zorluğun üstesinden gelmek için, sistematik olarak HECT E3'leri inhibe eden veya etkinleştiren ubiquitin varyantlarını (UbVs) geliştirdik. 6 HECT-UbV kompleksinin yapısal analizi, E2-bağlanma bölgesini kaçıran UbV inhibitörleri ve bir ubikitin-bağlayıcı ekzositi işgal eden aktivatörler ortaya koydu. Dahası, UbVs, NEDD4 alt ailedeki HEK'ler arasında farklı düzenleyici mekanizmalar ortaya çıkardı ve HECT E3'lerin hücrelerdeki ve barsak organoidlerindeki terapötik olarak ilgili hedeflerinin modüle edilmesi için yararlı olduğu kanıtlandı ve hücre migrasyonunun düzenlenmesinde NEDD4L için rol teşkil eden bir genetik ekranda keşfetti. Çalışmalarımız, bir E3 ailesi boyunca aktiviteyi modüle etmek için UbVs'ün çok yönlülüğünü gösterir, mekanizmaları tanımlar ve HECT E3'lerin problama işlevleri için bir araç seti sağlar ve sinyal proteinlerinin ailelerini hedefleyen modülatörlerin sistematik olarak geliştirilmesi için genel bir strateji oluşturur. E1-E2-E3 çok enzimli basamakların aracılık ettiği ubiquitination, sayısız protein fonksiyonlarını düzenleyen baskın bir mekanizma olarak fosforilasyona karşı gelmektedir (Cohen ve Tcherpakov, 2010; Nalepa ve ark., 2006, 1949).

GİRİŞ ). Tekrarlanan katalitik döngüler, protein işlevlerini çok çeşitli şekillerde değiştiren çeşitli poliubikitin zincirleri ile çoklu lizin üzerinde modifiye edilmiş substratlarla sonuçlanır. E3 ligazlar, substrat özgüllüğünü ve ubikitinasyon topolojisini kontrol ettiğinden terapötik müdahale için cazip hedefleri temsil etmektedir (Nalepa ve diğerleri, 2006; Petroski, 2008). Bununla birlikte, E3 ligazlarını düzenleyen mekanizmaların çeşitliliğini belirlemek ve manipülasyonu için araç üretmek, düzenlemenin şifresini çözmekte …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

Su araştırmacılar titanyum ile ilgili temel soruyu çözüyor …

                                                                                                          Ortak katalizör titanyum oksit (kırmızı ve yeşil renkte gösterilir) üzerine iniş yapmak için su (mavi renkle gösterilir) geldiğinde, zamanın hemen altındaki hidroksillere (sol yüzeyde) ayrılır. Kredi: Zdenek Dohnalek      Ortak bir katalizör olan titanyum oksit üzerine iniş için bir su molekülü geldiğinde, bazen parçalanır ve hidroksil olarak bilinen bir çift molekül parçası oluşturur. Fakat …

Devamını Oku »

Kokmuş şişme havuzla ilgili bir şey var mı …

                                     Şişme oyuncaklar ve yüzme yardımcıları, banyo halkaları ve kol bantları gibi, genellikle çeşitli tehlikeli maddeler içerdiğini gösterebilecek farklı bir kokuya sahiptir. Karbonil bileşikleri, siklohekzanon, fenol ve izoforonu içeren bu bileşiklerin bazıları, çocuk oyuncaklarında daha yüksek konsantrasyonlarda bulunduğunda kritik olabilir, dergide bir çalışmanın yazarları olan Christoph Wiedmer ve Andrea Buettner Analitik ve Biyoanalitik Kimya ..                                                                                Kurşun yazar Wiedmer …

Devamını Oku »

Avustralya'daki örümcek ısırıklarıyla ilgili gerçeği – onlar …

                                                                                                          Büyük ölçüde zararsız beyaz kuyruklu örümcek bir sürü lepistes koptu. Kredi: Robert Raven      Bir erkeğin bacaklarını beyaz kuyruklu bir örümcek tarafından ısırıldıktan sonra kesilip kaldırıldığına dair haberler, nispeten zararsız olan bu örümceği olumsuz bir şekilde hafifletti. Uzmanlar o zamandan beri, amputasyonların bir örümcek ısırığı üzerine yanlış suçlanabileceğini ve yetkililerin şimdi bakteriyel bir enfeksiyonun …

Devamını Oku »

Türk Böbrek Vakfı Başkanı'ndan gelen tuzla ilgili önemli …

                     2017-04-08 12:44:00                                           Türk Böbrek Vakfı (TBV) Başkanı Timur Erk, tuz kullanımının geçmiş yıllara oranla azaltıldığını ancak daha da indirmek istediğini bildirdi. Timur Erk, AA muhabirine göre açıklamada, tuz, şeker ve unun oranları için insan sağlığı için zararlı anlat anlatıldı. Erk, "Başta tuz fazla alındığı zaman büyük sağlık sorunları ortaya çıkıyor." "Sağlık hizmetlerinin tuz tüketiminin azaltılmasıyla ilgili 6 …

Devamını Oku »

İşte selülitle ilgili ilgili doğru ve yanlışlar

                     2017-04-04 21:20:00                                           Selülit yaşlılarda daha fazla fazla olur mu? Kadınlarda erkeklere daha çok mu görülür? Selüliti engellemek için yapılmalı. İşte selülitle ilgili merak edilen tüm merak edilenler … 1 / Selülit ile birlikte kadınların bulunduğu düşüncesi yanlıştır. Evet kilolu ve yaşlı kadınlar selülit meyillidir. Bunun nedeni selülitlerin aşırı yağdan olmadığı, kasların deriye yapışmasını kullanırsan kolajenin lifli yapılı …

Devamını Oku »

Kanserle ilgili doğru meydana yanlışlar | Sağlık

     Dünya Bülteni / Haber Merkezi Abdi İbrahim Medikal Direktörlüğü, kanser le ilgili doğru mevcut yanlışlara yönelik uyarıları bulundu. Direktörlüklük, dünyada ölüm nedenleri arasında ilk sırada bulunan kanser hakkında farkındalığı arttırmayı amaçlayan 1-7 Nisan Kanser Haftası dolayısıyla hastalığa dair yanlış ifade edilmemişti. kanser içinde görülmeye değer riskinin son gün sanattığı vurgulandı. Açıklamada, kanser e karşı daha dikkatli olunması gerektiği bildirildi. …

Devamını Oku »

Kanserle ilgili doğru meydana yanlışlar | Aile-Sağlık

     Dünya Bülteni / Haber Merkezi Abdi İbrahim Medikal Direktörlüğü, kanser le ilgili doğru mevcut yanlışlara yönelik uyarıları bulundu. Direktörlüklük, dünyada ölüm nedenleri arasında ilk sırada bulunan kanser hakkında farkındalığı arttırmayı amaçlayan 1-7 Nisan Kanser Haftası dolayısıyla hastalığa dair yanlış ifade edilmemişti. kanser içinde görülmeye değer riskinin son gün sanattığı vurgulandı. Açıklamada, kanser e karşı daha dikkatli olunması gerektiği bildirildi. …

Devamını Oku »

ABD devletleri, Trump enerji gecikmesiyle ilgili yasal işlem başlatıyor

                                                                                                          Kozya hükümetine karşı, tavan fanı standartlarının yürürlüğe konması üzerine altı aylık bir gecikme konusunda itiraz eden ve bunları derhal uygulamak için bir mahkeme emri talep eden bir dava açıldı      Kaynak

Devamını Oku »

VW Almanya'daki mahkeme tarafından savcının aramalarıyla ilgili şikayetini reddetti

Joern Poltz Reuters 3 Nisan 2017 10:33 CET Münih – Bir Alman mahkemesi, Volkswagen Group'un savcıların, emisyon skandalını soruşturmak için görevlendirilen otomobil firmasının hukuk firması aramalarında ele geçirilen bilgilerin kullanılmasını önleme girişimini reddetti. VW geçen hafta bir avukatın ABD hukuk firması Jones Günü'nde 15 Mart saldırısı sırasında el konulan malzemelerin tutulmasını ve değerlendirilmesini önlemek için bir Münih mahkemesine şikayet etti. …

Devamını Oku »

Gıda krizi ile ilgili yeni küresel rapor – eylem için kriter …

                                                                                                          Gıda Krizleri Global Raporu 2017'ye göre, dünyadaki 108 milyon insan gıda 2016 yılında güvensizdir © Fotolia, mrmojo 101     Gıda güvencesizliği konusundaki uluslararası çabalara rağmen, dünyadaki 108 milyon insan besin krizleri ile ilgili yeni bir küresel rapora göre 2016'da ciddi miktarda gıda güvensizdir ve 2015'te 80 milyona kıyasla dramatik bir artış göstermiştir. 31 Mart 2017'de …

Devamını Oku »

Sağlıkla İlgili Öncelikli Eylem Planı …

Sağlıkta Sosyal Belirleyiciler Üzerine Komisyon (2008) 'nin önerileri üzerine Dünya Sağlık Örgütü ) Sağlıkla ilgili eşitsizlikleri belirleme ve planlamada yerel paydaşları desteklemek için Kentsel Sağlık Sadakati Değerlendirme ve Yanıt Aracını (HEART) geliştirdi. Bu raporun amacı, araçların gelecekteki gelişiminin yerel paydaşları sağlık eşitsizliklerini gidermede nasıl daha iyi destekleyebileceğini bildirmek için Kentsel Kalp uygulamasında kentlerin deneyimlerini analiz etmektir. Çalışma yöntemi, belgesel analizi …

Devamını Oku »

VW, hukuk firmasının dizel skandalıyla ilgili aramalarda yasal şikayet etti

Andreas Cremer Reuters 29 Mart 2017 14:14 CET – GÜNCELLENDİ: 29 Mart 15:40 CET – ayrıntı ekler BERLIN – Volkswagen Group, Münih mahkemesine Alman savcıları tarafından emisyon skandalını soruşturmak için görevlendirilen avukatlık bürosunun aramaları. Karar, VW'nin denetim kurulunun Salı günü gerçekleştireceği toplantı sonrasında yetkililer, şirketin Münih savcılarının ele geçirdiği materyali elinde bulundurmalarını ve değerlendirmelerini önlemek için ne yasal başvuruda bulunduklarını …

Devamını Oku »

Evlilik programlarıyla ilgili kritik gün belli eski …

                     2017-03-22 09:33:00                                           RTÜK Başkanı İlhan Yerlikaya programlarının kaldırılmasıyla ilgili ulusal çapta yayın yapan TV yetkilileriyle 23 Mart Perşembe günü görüşeceklerini söyledi. Radyo ve Televizyon Üst Kurulu Başkanı İlhan Yerlikaya Basın Yayın ve Enformasyon Genel Müdürü Mehmet Akarca'ya nezaket ziyaretinde bulundu. Nihai kararın bu konuda programa gideceğini söyledi. KRİTİK TOPLANTI PERŞEMBE GÜNÜ Genel Müdür'ün Akarca'ya yaklaşımı hakkında bilgi …

Devamını Oku »

İsrailli bir depoda, İsa'nın hayatıyla ilgili ipuçları …

                                                                                                          "Yeshua" ya da İsa kelimesini oluşturan İbranice harflerle yazılmış bir ossül İsrail'in Beit Shemesh, İsrail, 19 Mart 2017 Pazar günleri otorite deposunda saklanır. İsrail eski eserleri otoritesi, geniş depolama alanını Pazar günleri gazetecilere açtı. İsa zamanından itibaren seçilen eserlere göz atmak için. Uzmanlar, haçta ölen ve tarihin gidişatını değiştiren Yahudi vaizin doğrudan arkeolojik kanıtlarını …

Devamını Oku »

Nicole Mason Gerçek: Vücudumdaki her organ başarısız oluyordu ve kilomuz 56 kiloya düştüğünde anoreksiya nihayetinde kazanmış gibi göründüğünden ailemden cenaze törenimi planlaması söylendi. Ben: Ben iyiyim! Şişmanım! Kendimden nefret ediyorum! Ben değersiz biriyim. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Gerçek: Sadece 1 ½ yıl sonra, 221 pound'luk bir şiddetle çarpan bir ölçeğe baktım. Her gün boş yiyecek sarmalayıcılar şirketinde uyuşukluk yaşlı yemek yeme bozukluğu yerini anoreksi yerini aldı. Ben: Kendimden nefret ediyorum! Umutsuzum! Artık kendimi tanımıyorum bile. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Bulimia, umutsuzca kilo vermeye çalışırken yavaş yavaş hayatıma girdi. Aşırı müshil ile yakalanan – kısıtlama döngüsü; Bir defada 100 müshil ürünü yuttuğumda kaya tabanına düştüm. Ben: Ben iyiyim! Bu yemin ederim son olacak! Kendimden nefret ediyorum! Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Başlangıç ​​ İsmim Brittany Burgunder'dır, ancak hayatımın çoğunu kendim koşturarak geçirdim. On yıldan fazla bir süredir, dünyadaki en yüksek ölüm oranına sahip zihinsel hastalık olan bir yeme bozukluğu ile savaştım. Sevgi dolu ebeveynlerle büyüdüm, ulusal derecede tenis sporcusuyum, düz 'A' öğrencisi ve yetenekli bir at binicisiyim. Mükemmel bir gülümseme üzerine – parlak bir geleceği olan normal bir hayatını tasvir eden bir gülümseme, ancak altında yatan sıkıntılı ruhu kamufle eden bir gülümseme üzerine boyadım. Gerçeğim, acı çekingen, sürekli alay ve reddettiğim akranlarımın korkunç kaygı, depresyon ve OKB'ye yol açmasıydı. Neden herkes gibi uymadığımın ve hayatın neden bu kadar zor olduğunu anlamadım. Bildiğim şey, ben ile ilgili bir sorun olması ve yeterince iyi olmaması gerektiğiydi. Anoreksiya Anoreksi, 13 yaşındayken hayatıma girdi. Yeme bozukluğunun ne olduğunu, sadece yiyecek konusunda tuhaflaştığım ve kalori, bedenim ve egzersizle ilgili garip yeni ritüeller geliştirdiğim hakkında hiçbir fikrim yoktu. Hastalığım beni yaşamak istemediğim bir yaşama yönlendirmede yeni bir yol bulduğum için endişelerim yatıştı. Ailem hızla müdahale etti ve eve tedavi edeceğim düşüncesiyle beni ilk tedavi merkezime yolladı. Meydan okurcasına, bir sorunum olduğu gerçeğinden habersiz davrandım. Benim gibi diğer insanlar olduğuna şaşkına döndüm ve bir sefer yalnız hissetmedim ve arkadaş oldum. İyi fiziksel sağlıkta eve döndüğüm halde aklım kesinlikle düzelmedi ve bir dizi yeni hileyle silahlı olarak döndüm. Egzersiz bağımlısı oldum. Üç farklı spor müsabakası üyeliğime sahibim, bu nedenle aynı kişiler aşırı davranışsal davranışı gözlemlemiyorlardı. Çoğu yaş grubum baloya giderken, 20'li yıllarda kalp atış hızı ile hastanede yatıyordum. Bir zamanlar Division 1 üniversite tenisi oynamak için bir potansiyel buldum, ama şimdi eğlenmek için babamla bile uğraşamayacak kadar zayıftı. Bir zamanlar en büyük sevincim olan atım satıldı, çünkü ben daha derin ve daha derin bir yanılsama dünyasına girdim. Gerçeklerime olan tek tanık – gerçek düşüncelerim ve gerçek çatışma – bir günlük ve kalemdi. Her gün yoğun bir şekilde yazmıştım. Yeme bozukluğumun yanı sıra, sahip olduğum diğer tek şirket buydu. Günlüklerimde yazarken başımdaki karışıklığın bir kısmını boşaltmaya yardımcı oldular, ancak sırlarımı korumak için dergilerimi gizli tutmayı emrediyorum. Davis Kaliforniya Üniversitesi'ne kabul edildi. Ailem, ihtiyacım olan yeni başlangıç ​​olabileceğini düşünerek gitmeme kararı verdi, ancak yanılıyorlardı. Sınıf arkadaşlarımla sosyalleşmeye çalıştım, ama açıkçası onlar gibi değildi ve dışarı çıkmak için yapılan her davetiyeyi geri çevirmek için bir bahanem vardı: Eğer yiyecek veya alkol olsaydı ne olurdu? Egzersiz programıma müdahale etseydi ne olurdu?

ise Yeme bozukluğumla hayatım çabucak bana oldu. Profesörleri sevdiğim kadarıyla UC Davis'teki vaktim kısa sürede korkunç bir varlığa dönüştü. Özel bir yeme bozukluğu istikrar programına kabul edilmeden çok önce değildi. Tüm dolaşımı kaybettim, saçlarım düştü ve karaciğer yetmezliğiyle yüzleştim. Kilom çok düşük bir kilo aldı ve ailemden cenaze düzenlemeleri yapılması söylendi. Ancak bu bana gerçek dışı geldi. Ben şişmanım. İyiydim. …

Devamını Oku »

Audi CEO'su Rupert Stadler, baskınların ardından Volkswagen dizel skandalıyla ilgili baskıyı hissediyor

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Audi CEO'su Rupert Stadler olarak az sayıda Alman üst düzey yönetici vardır. Bununla birlikte, bu hafta, cilalı kaplama, Volkswagen Group'un dizel emisyon skandalına kadar olan rolü ile ilgili soruların istikrarlı akışıyla birlikte aşınmaya başladı. Stadler'in şirketinin yıllık Almanya'nın Bavyera kentindeki karargahında çıkan sonuçlara göre, Cumhuriyet Savcısı Ingolstadt ve …

Devamını Oku »

VW: Alman savcısı hukuk firmasının dizel skandalıyla ilgili arama yaptığını söyledi

GÜNCELLENDİ: 3/16/17 09:56 ET – ayrıntıları ekler FRANKFURT – Alman savcılar, skandalla ilgili olanları belirleme çabalarını hızlandırdıkları için, Volkswagen tarafından kiralanmış dizel emisyon testi hilelerini araştırmaları için kiralanmış olan ABD'li hukuk bürosunun ofislerini araştırdı. Avrupa'nın en büyük otomobil üreticisi, Çarşamba günü yapılan ancak Perşembe günü bildirilen aramayı "her yönden kabul edilemez" olarak kınadı ve kendini savunmak için her yasal adımı …

Devamını Oku »

Engelleri Teknoloji İle Aşıyorlar Esra ÜLKAR Elif Nur Sevim'i oynadı reklam filmiyle tanıdık. Görme engelliler için tasarlanmış sınıfta, doğum günü yaklaşan annesine bilgisayar yardımıyla yaptığı resmini hediye ediyordu. 2015'te MEB ile Turkcell (TMB) ile Turkcell'in ortaklaşa yürüttüğü bir eğitim programıdır. Iki yıl için imzalanan protokolle 45 ildeki 80 okulda teknoloji sınıfları ve meslek atölyeleri kurulması hedeflendi. Şimdiye kadar 47 okulda bu gerçekleştirildi. Sınıflar görme engelli ve az gören öğrenciler için özel teknoloji ve yazılımlarla donatıldı. Bir öğrenci bir öğrenci, öğretmenin tahtaya yazdıklarını bilgisayarında görebileceği şekle getirerek okuyabiliyor. Görme engelliler, özel yazılımla rahatça bilgisayar kullanabiliyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif halinden memnun. Başka yerlerdeki arkadaşlarının da bu imkânlardan faydalanabilmesi için sınıfların sayısının arttırabileceğini söylüyor. Sekiz öğrenciden oluşan sınıfının özellikleri şöyle anlatıyor: "Ankara'da birinci sınıfta gittim. Başta sınıf normaldi. Beşte s ninfta okumaya başladım. Sınıflar işimizi kolaylaştırıyor. İnterneti daha rahat kullanıyoruz. İstediğimiz bilgiyi bulabiliyoruz. Kitabın fotoğrafını çekip okutabiliyoruz, sesli olarak duyuyoruz. Kamera da çok kullanışlı. Bir şeyin fotoğrafını çekip bilgisayarla okutabiliriz. Bazı derslerin öğretmen anlatıyor, bazılarında konuları bilgisayarla işliyoruz. En sevdiğim dersler, bilgisayar. " Reklamda oynadığı için mutlu olduklarını söyleyen Elif," Önce okulda çekim yapıldı. Sonra beş kişi seçildi. Onların tercihi. İstanbul'a gittim. Filmde oynuyorum için mutluyum. Gelecekle ilgili aklımda bir sürü meslek var ama sunucu olmak istiyorum, spiker gibi "diyor. Hedef 80 okul Programla 2015'te 11, 2016'da ise 36 olmak üzere 47 okul tamamlandı. Nisana kadar 80'e ulaşılması hedefleniyor. MEB ile protokol sınırı belirlenmiş. Iller ihtiyaç önceliğine göre seçildi. Türkiye'de 16 görme engelli okulu var ve tamamına teknoloji sınıfı kuruldu. 20 işitme engelli meslek okulunun hepsine bilişim teknolojileri sınıfları yapıldı.

MEB tarafından gerekli önceliğine göre belirlenen 45 hafif zihinsel engelli özel eğitim mesleki eğitim okuluna ise meslek atölyeleri açıldı. Kaynak

Devamını Oku »

Hükümetten evlilik programlarıyla ilgili flaş açık …

                     2017-03-16 12:02:00                                           Malatya'da yayın yapan yerel televizyonların canlı programına katılan Başbakan Yardımcısı Numan Kurtulmuş, evlilik programı ile ilgili de konuştu. Kurtulmuş, evlilik programlarıyla ilgili olarak, "Cumhurbaşkanlığına ve Başbakanlığa bu şikayetler geliyor." Bir Kanun Hükmünde Kararname (KHK) düzenlemeleri ile gündeme getirebiliriz. İnşallah bu toplumsal talepleri karşılayacağız " Dedi. Birleşmiş Milletler'de Malatya'da yayın yapan bazı televizyon kanallarının canlı yayın …

Devamını Oku »

Bu seni özlediğimde ne yapacağım Pixabay Yazdıkların boşluğunu okumak için bulacağım Sözleriniz, beni ve hakkımdaki ne kadar heyacınız olmadığını hatırlamak. Onları bulacağım, böylece kırık vaatleri tekrar tekrar okuyup, asla gerçekten takip etmediğinizi ve muhtemelen niyetli olmadığınızı hatırlayabilelim. Aslında kaç kız kaçtığınızı, kaç hayranınız olduğunu ve özel olduğumu hiç düşünmediğinizi hatırladığını bildiğiniz güzel kızları görmek için Instagram'ınıza bakacağım, sonra oyun oynamayı hiç bırakmadın mı Sen benimle tanıştın Gözlerinizin ve zihninizin bana asla nasıl yüklenmediğini hatırlamak istiyorum. Hiç umursamadığınızı ispatlayan tüm delilleri görmek istiyorum. Beni özlemediğini hatırlarım. Ulaşmaya veya bir söz söylemeye çalışmadığınızı farkedeceğim. Yokluğunu hissedeceğim ve daha fazlasına ihtiyacım olduğunu hatırlayacağım. İstediğimi bana vermediğin için. İnsanlar neden ayrıldıklarını bilmiyorum, bizim hatamız varsayıyoruz, bizimle ilgili bir sorun var, ama bazen onların hatası, aradığımız şeyleri bize veremediler, etmedi Ihtiyaçlarımızı anlıyoruz ve bizi gerçekten görmediler. Bunlar sığ idi. yüzeyselti Ve sığ sığındın, beni anlamadın. Zayıf iletişim ve tutarsızlıktan dolayı iyi olacağımı düşünüyorsun. Kızlarından sadece bir tane olman iyi olacağını düşünmüştün. Seni beklemekle ve daha fazlasını istemediğimi idrak edeceğimi düşünüyorsun. Sen karar verene kadar arkadaş olmaya devam edeceğimi sanıyordun. Fakat daha iyi biliyorsundu. Sadece benim sevdiğim kişilerle konuştuğumu, daha çok şey istedim, potansiyel gördüğüm ve beni hissedebilen bir şeyleri hissettiğini bilmeliydin. Seni sevdiğimi söyleyince, 'u sadece gibi sevdiğim anlamına gelir, çünkü bu sık sık olan bir şey değildir. Ben genellikle aynı anda bir grup erkeğe düşmem. Onların özel hissettiklerini ve bakımlarını nasıl yapacaklarını bilmiyorum. Onlara, onları birlikte sıkacak kadar nasıl vereceklerini bilmiyorum. Sende değilim sen. Kolayca vermiyorum, ama ne zaman yaparsam, hepsini veriyorum. Sık sık düşmem, ama ne zaman yaparsam, çok düşerim. Ve beni daha iyi tanımanız gerektiğini bildiğinizden emin olabilirsiniz. Bana göre ne olursanız olun

hiç takdir etmeyeceğinizi bilmeliydim . Ve seni özlediğimde yaptığım buydu. Hatırladım ki, beni özledin ve senin seçiminizdeydi. Hatırlıyorum ki, sevgiyi aramıyorsun. Hatırlıyorum ki ben 'a bakmıyordunuz – bu yüzden sizi özlemekten vazgeçtim ve gerçek bir şey isteyen birini arıyorum. Sevmeyi bilen biri . Rania Naim, burada mevcut olan yeni kitabın Söylenmesi Gereken Tüm Sözcüklerin bir şairi ve yazarıymış .

Devamını Oku »