26 Eylül 2017,Salı
Anasayfa » Tag Archives: ile

Tag Archives: ile

Lumia 1020 ile profesyonel fotoğraf çekimi LetsGoMobile

N- Okia Lumia 1020, 41 megapiksel çözünürlüklü PureView dijital fotoğraf ve yeniden yorumladığı zoom özelliğiyle mobil fotoğrafçılıkta çığır açıyor. İşte, Nokia Lumia 1020 cep telefonuyla profesyonel bir fotoğrafçı olabilmenizi sağlayacak olan PureView teknolojisi, Nokia Pro Kamera, Zoom, Xenon flaş ve Nokia Smart Cam özelliklerinin detayları: Lumia 1020 PureView Teknolojisi Nokia Kar 1020, Nokia'nın Yenilikçi PureView Teknolojisi, ikinci ZEISS optiği optik …

Devamını Oku »

Japonya, mikrosatellit ile kuantum alan yarışına katılıyor …

                                  Japonya, bir uydu ile kuantum iletişimi gösteren en yeni ülke haline geldi, bu durumda SOCRATES adlı bir mikro-uydu.                  Ulusal Bilgi ve İletişim Teknolojileri Enstitüsü (NICT), SOTA kuantum iletişim vericisinin özelliklerini gösteren kuantum anahtarı dağıtımı (QKD) testini açıkladı.                  SOTA, onları polarize ederek sıfırlar, onları 10 Mbps hızında Koganei'deki NICT optik yer istasyonunda ateşler.                  Alım sonunda, on …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

IPhone 8 yeni renk seçeneği ile geliyor!

Apple'ın yönü ve diğer iPhone modelleri ayrılmayı beklenen yeni telefon iPhone 8'in (geçici isim) renk seçenekleri belli olmaya başladı. KGI Securities analisti Ming-Chi Kuo geçtiğimiz günlerde yayınlandığı bölümde OLED iPhone'un özel modelleri için daha az renk seçeneği ile geleceğini belirtmişti. Benyamin Geskin iPhone 8'de ayna benzeri bir renk seçeneği olurağını iddia etti. Geskin, bu renk seçeneğinin neye benzediğini gösteren görselleri …

Devamını Oku »

2000 – 2500 TL ile ne alınır? – TELEFON TAVSİYESİ!

2000 – 2500 TL bütçe ile satın alınabilir akıllı telefon tavsiye listemizle karşınızdayız. Bu videomuzda ithalatçı garantisi ile alınabilecek dikkat çeken modelleri derledik! 2000 – 2500 TL ile ne alınır? – TELEFON TAVSİYESİ! 2000 – 2500 TL arası Galaxy S7 edge var. Var. Şık tasarım ve yüksek seviye donanımı ile dikkat çeken telefon 2500 TL fiyata sahip. Listeye ilk girerseniz …

Devamını Oku »

LG Q6 özellikleri Geekbench ile ortaya çıktı!

Şubat ayı amiral gemisi LG G6 'nın birleşimi ve geçtiğimiz günlerde G6 Plus modeli için yeni bir video yayınlayan ' nin, yeni akıllı telefonu Q6 üzerinde çalıştığında daha fazla önce sizlere duyurmuştuk. Cihaza ait verilerin Geekbenç veritabanına giretim birlikte birlikte LG Q6 modelinin teknik özellikleri büyük oranda ortaya çıkmıştı. LG Q6 özellikleri ortaya çıktı! 11 Temmuz'da Polonya'da düzenlenecek olan LGBarbeQ …

Devamını Oku »

Amiloide Yapısal Değişiklik … Aβ fibril polimorfizminin AD'nin klinik ve patolojik özelliklerinde değişikliklerle ilişkili olabileceğine dair kanıtlar şunları içerir: (i) Farklı molekül yapılarına sahip Aβ40 fibrilleri, primerde farklı toksisite seviyeleri sergiler Nöronal hücre kültürleri 1 ; (Ii) Harici amiloid içeren biyolojik materyal tarafından indüklenen, transjenik farelerde amiloid biriktirme şekilleri, bu maddenin kaynağına göre değişir 13,14 ; (Iii) Transgenik farelerde sentetik Aβ42 fibrilleri ile indüklenen amiloid plaklarının boyutu ve bileşimi, bu fibrillerin morfolojisi ve büyüme koşullarına bağlıdır 15 ; (Iv) Aβ42 agregalarının beyin dokusunda kimyasal dağılımı ve direnci, hızla ilerleyen ve yavaş yavaş ilerleyen AD hastalarında farklılık göstermektedir. 16 AD'deki nörotoksik Aβ yapılarının yapılarının karakterizasyonu geliştirilmiş ve yapı ile Hastalık fenotipinin, patogenez hakkındaki anlayışımızda, uygun tanı ve terapötik biyolojik belirteçlerin gelişimine ve ilaç geliştirme üzerine önemli bir etkisi olacaktır. ssNMR'den gelen veriler, yapısal değişikliklere özellikle duyarlıdır ve iki boyutlu (2D ) 13 C- C ve N- 13 C ssNMR spektrumları, spesifik fibril polimorflarının "parmak izleri" olarak kullanılmaktadır. 1,4,20,21 ssNMR, miligram ölçekli miktarda izotopik olarak işaretlenmiş fibril gerektirdiğinden, beyin dokusunu tohum büyümesi ile büyüttüğü ve etiketlediği beyin dokusunun kaynağı olarak . . tarafından tanımlanan fibril tohumları Farklı suşların farklı hastalık süreleri ürettiği prion hastalıklarına benzer olarak, Ve hastalıkla ilişkili prion proteinlerinde konformasyonel farklılıklar ile ilişkilidir 17-19,22 görme işleminin bozulması ile ilişkili PCA-AD gibi olağandışı iki AD alt tipindeki hastalardan doku örnekleri seçtik. 23 ve n-dejenerasyonunun aylar içinde gerçekleştiği ve kliniksel olarak Creutzfeldt-Jakob hastalığına benzediği r-AD 24 Demans olmadan ölen üç kişi (ND) Otopside Aβ depolanması bulunduğu tespit edildi. Aβ40 ve Aβ42 fibrillerini, amiloidle zenginleştirilmiş korteks özlerinden tohumlanmış büyüme ile ayrı ayrı hazırladık. Tüm fibril numuneleri için transmisyon elektron mikroskopu (TEM) görüntüleri alındı. Tüm örnekler için ssNMR ölçümleri denendi, ancak bazı durumlarda sinyal / gürültü oranları 2D spektrumlarının edinimi veya müteakip analizi için yetersizdi. Doku örneklerini, hasta kategorilerini ve ssNMR ölçümlerini özetler. TEM görüntülerinin örnekleri ve 2D spektrumlarının tam setleri -. AD olmayan bir hastanın korteks özü ile kontrol deneyleri önemli Aβ depolanmasına sahip değildir Ek Tartışma ve

Beyin tohumlanmış Aβ42 fibrillerinin temsili TEM görüntüleri ve 2D ssNMR spektrumu

Devamını Oku »

Windows 95 ile ofis simülasyon oyunu

7 saat önce 0 Oyun dünyasında simülasyon türünün her zaman farklı bir yeri ve bu türe ilgi duyan insanların sayısı hiç de az değil. Tır şoförü bizim için Euro Truck Simulator ve doktor olduğumuz Cerrah Simülatörü 'dan sonra bir de "ofis çalışanı" simülasyonu çıktı. Windows 95 nostaljisi! Tasarım profesörü Pippin Barr tarafından geliştirilen " Sanki İş Yapıyormuşsunuz gibi" Windows 95 …

Devamını Oku »

Not 8, kalemi ile birlikte görüntülendi!

Galaxy Note 8 ile ilgili nerdeyse her gün bir sızıntı ortaya çıkıyor. Daha önce kılıfları da sızdırılan Not 8 bu sefer de S Pen ile birlikte görüntülendi. Yatay bir çift kameraya sahiplediği düşünülen Not 8'de parmak izi tarayıcı yine hayal kırıklığı oluşturacak bir konumda yer almış. Not 8 kalemi ile birlikte görüntülendi! Yeni görselde Galaxy Note 8'e önden bakıldığında Galaxy …

Devamını Oku »

Endoplazmik retikulum-mitokondri karşılaşma yapısı (ERMES), mitokondriyal dış zar ile ER'yi birbirine bağlar . ERMES'e, mitokondriyal morfolojinin, protein montajı ve fosfolipid homeostazının sürdürülmesi de dahil olmak üzere çoklu fonksiyonlar bağlandı. Mitokondriyal dağılım ve morfoloji proteini Mdm10, hem ERMES hem de mitokondriyal sıralama ve montaj makinelerinde (SAM) mevcut olduğundan, ERMES işlevlerinin moleküler düzeyde nasıl bağlandığı bilinmiyor. Burada, Mdm10 β-varilin karşıt taraflarındaki korunan yüzey alanlarının sırasıyla SAM ve ERMES ile etkileşime girdiğini bildiriyoruz. Molekül ve fosfolipid homeostazından (ERMES) protein montajını (SAM) ayırmak için nokta mutantları ürettik. Çalışmamız, Mdm10'un β-varil kanalının farklı fonksiyonlara hizmet ettiğini ortaya koymaktadır. Mdm10, SAM'de α-sarmal ve β-varil proteinlerinin biyogenezini arttırır ve SAM-aracılı protein montajının ER-mitokondriya temas bölgelerinden farklı olduğunu gösteren ERMES'in entegre membran ankoru olarak işlev görür.

Mitokondri aslen başlangıçta ATP üreten yarı özerk organel olarak işlev gördü, ancak hücrenin geri kalanından büyük ölçüde bağımsızdı. Mitokondriyanın çok sayıdaki metabolik yolaklardan protein ve lipid biyogenezine, sinyal süreçlerine, kalite kontrolüne ve apoptozise kadar, merkezi hücresel fonksiyonlara derinden entegre olduğu bulunmuştur, bu görüş radikal bir şekilde değişmiştir. 2 ] 3 4 . Son çalışmalar, mitokondrianın hücresel homeostaz ve organizasyona geniş …

Devamını Oku »

Mitsubishi Electric ile sürüşüz araç dönemi!

    Mitsubishi Electric sürücüsüz araç kullanımı için gerekli olan geniş bir çözüm yelpazesi sunmayı amaçlıyor. Patentli Mobil Haritalama Sistemi 'nin yapay zeka ile birleştirilmesi, sürücüsüz araç kullanımıyla zamanında hızlandırmaya yardımcı oluyor. 3D sokak haritaları 3D sokak haritaları oluşturan haritalama sistemi, konsept otomobil ve diğer diller konuşan insanlar veya işitme engelli bireyler arasındaki iletişim uygulaması, Mitsubishi Electric geliştirilmiş ana uygulamalar için …

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

IPhone 8 ve iPhone 7 ile aynı videoda!

Apple onuncu yıla özel hazırlandığığı iPhone 8 ile ilgili her gün yeni bir sızıntı ortaya çıkıyor. Onleaks geçtiğimiz günlerde iPhone 8 'boyutlarını ve tasarımını çıkarmak koyan bir video yayınlamıştı. Onleaks şimdi iPhone 7 ve iPhone 7 Artı 'in yerinde aldığı yeni bir iPhone 8 videosu yayınladı. iPhone 8, iPhone 7 ve iPhone 7 Artı Aynı Videoda! iPhone 8 'in iPhone …

Devamını Oku »

H. ile yaşayan postmenopozal kadınlarda osteoporoz …

Avrupa PMC Javascript'in etkili bir şekilde çalışmasını gerektiriyor. Ya web tarayıcınız Javascript'i desteklemiyor veya şu anda kapalı. İkinci durumda lütfen Web tarayıcınızda Javascript desteğini açın ve bu sayfayı yeniden yükleyin. "'); exportDisplaySection (); // $ (". Results_pagination_range"). FadeOut (hız – 100) $ ( '# ExportPanel') odak ().; } Else { $ ( "# ExportPanel") slideUp (hız).; SetTimeout (işlev () { …

Devamını Oku »

Karanfil ile Saç Bakımı | Saçlarım ve Ben

Karanfil ağacının çiçek tomurcuklarından oluşturulan karanfil kendine sahip olduğu aroması ile ağız kokusu ve diş ağrılarında yüzyılları jelleştirecektir. Güçlü aroma ile yemekler dışında. ve B6 vitaminlerinden esinlenerek Yana zengin, ayrıca kalsiyum, potasyum, sodyum ve manganez deposu olmasına borçludur. Omega 3 ve Omega 6'da bulunur, uçucu yağlar içerir. Aynı zamanda karanfil Anti bakteriyel etkisindenanıtdır. Solunum yollarının rahatsızlıkları, öksürüğe, akne ve lekelerin …

Devamını Oku »

OnePlus ile kritik sorun! – ShiftDelete.Net

Apple'ın yıl önce önce yaşadığı büyük bir sorun, şimdi de OnePlus firmasının başını ağrılacaktır. Amiral gemisi katille OnePlus 5 'in sağ üst kısmını elinizle kapadığınızda Wi-Fi sinyalini daha alçaltmaya başladı. Telefonu yanlış tutmak! OnePlus Şirketin bu bölümünde yeni gelen Oksijen İşletim Sistemi 4.5.2 ile birlikte ortaya çıktı denebilir. Çünkü güncellemeyi yükleyen kullanıcı, Wi-Fi (2.4 GHz) ağına bağlanırken sorun yaşanıyor, diğerleri …

Devamını Oku »

Nintendo 29 Eylül'de Super NES ile geliyor!

     Nintendo Bu yıl Eylül ayında Süper NES Klasik Sürümü 'yani, 20 yıllık aşkın bir süre önce pazaraya çıkmak orijinal konsol'u eskiyi özlemle düşünen oyuncular için piyasaya çıkarıyor.                           Nintendo 29 Eylül'de Süper NES ile geliyor! Nintendo SNES Classic 'in ayrıntılarını açıkladı. Bağımsız mini konsol, Süper Mario Dünya, Topraküstü, Süper Mario Kart ve Zelda Efsanesi gibi oyunların da dahil …

Devamını Oku »

Tarçın İle Saç Rengi Açma

Saçlar bayanların en önemli güzellik aracıdır. Özellikle saç modelleri ve saç renkleri bayanlar için hem modanın rüzgârını taşımakta hem de görselliği en iyi yansıtan araç olmaktadır. Bu nedenle, bayanlar için saç renginde açma ve istenilen saça özel zararlı işlemlerdir. Bu sebeple, doğallıktan yana olanların, doğal yöntemlerden yararlanmaktadır. Saç rengini açmak için tarçın kullanımıdır. Tarçın İle Saç Rengi Nasıl Açılır? Tarçınla …

Devamını Oku »

Apple iPhone 8 devrim niteliğinde bir kamera sensörü ile gelecek!

Günümüz akıllı telefonlar ya da bir Teknolojik aletin çıkmadan önce yarattığı heyecanının yok dönem, belki de en büyük sebebi yaşanan erken dönem sızıntılar ] Gerek gerek. Bu bağlamda Apple 'in merakla beklenen yeni akıllı telefonu iPhone 8 ' in deiden, şimdiden bu erken dönem sızıntı kurbanı olan akıllı telefonlar arasına katıldığını ] Söylesek yalan olmaz her halde. iPhone 8'in kritik …

Devamını Oku »

Araştırmacılar, ilk dünya sorununu güve-e ile çözdüler …

                                  Yeni parlama önleyici film, telefonlarımızı parlak bir günde biraz daha iyi görmemize yardımcı olabilir.                  Taipei'deki Ulusal Tayvan Üniversitesi elektrik mühendisi Jiun-Haw Lee, "Ortam ışığı her yerde" diyor.                  Doğal ışık, görüntü ekranlarının kontrastını düşürür ve çok daha koyu görünmesini sağlar. Bunun nedeni güneşin ışığı cama çarptığında, bazıları yansır.                  Teknik dükkandan edinilebilen ticari çok katlı yansıma önleyici …

Devamını Oku »

IOS 11 ile Beraber Uçak Modu Özelleştirilebilecek!

iOS 11 'in, gün geçtikçe farklı gizli özellikleri iOS 11 ' in, gün geçtikçe farklı gizli özellikleri ortaya çıkarılmaya devam ediyor. Bu seferki haberlerin konusu çok sayıda kişinin aklına gelmeyecek " Uçak Modu ". iOS 11'in Uçak Modu Şaşırttı! ile gelen yeniliklerin çoğu biliniyor azınlık küçük ama işlevsel detaylar işletim sistemini çok daha cazip bir hale getiriyor. Uçakta Modu "açıldığında …

Devamını Oku »

"Acun ile arama beddualar safra giremez"

                     2017-06-24 10:53:00                                                                      Acun Ilıcalı ile evlilik planları yapan Şeyma Subaşı ilişkisiyle ilgili itirafta bulundu. ST. Tropez'de 3 gün 3 gece sürecek düğünle Acun Ilıcalı ile hayatını birleştirecek olan Şeyma Subaşı, Ilıcalı ile ilişkisini şu sözlerle açıkladı: "Acun ile arama beddualar safra giremez"                      6                      0                      0                                                                                                                                                      Kaynak

Devamını Oku »

ICANN, Afrika DNS Pazar Araştırması ile İlgili Nihai Raporunu Yayınladı

Atanmış İsimler ve Numaralar İnternet Kurumu (ICANN), Afrika Etki Alanı Adı Sistemi (DNS) Pazar Çalışması ile İlgili Nihai Raporunun yayımlanacağını duyurmaktan memnuniyet duyar. Bu çalışma, ICANN'ın bölgesel DNS endüstrisini destekleme ve geliştirme yönündeki çabaları kapsamında hizmet etmektedir. Raporda, 54 ülkeyi de içeren bölgedeki ilk örneği. Görevlendirildi: Afrika'daki DNS sektöründe güçlü ve zayıf yönlerini vurgulayın, Mevcut fırsatlardan daha iyi yararlanma ve …

Devamını Oku »

LG G3 meraklıları ile buluşuyor LetsGoMobile

L G G3, Türkiye'de satışa sunulmadan önce tüm dünyada ilk ve tek olan Kanyon AVM'deki özel deneme mağazasında sürpriz hediyeler ile tüketicilerini bekliyor. LG'nin yeni amiral gemisi LG G3'ü merakla bekleyen tüm tüketiciler 10 Haziran – 4 Temmuz tarihleri ​​arasındaki Kanyon AVM'de ürünü diledikleri gibi gerçekleştirebilme fırsatı bulacak. Haziran ayı sonunda tüketicisiyle buluşacak olan LG G3 için özel olarak hazırlanan …

Devamını Oku »

YouTube kullanıcı sayısı ile adeta büyülüyor!

Dünyanın en popüler video platformu ve onun geçen günleri büyüeye devam eden YouTube günümüzde insanların birer birer kişiye ulaşabilmesini sağlar hale geldi. Los Angeles'ta düzenlenen ve Youtube yıldızlarının hayranları ile bir araya jelleştirmek için VidCon etkinliğinde, terör içeriklerini kolay bulma için diğer farklı yazıları güvenlik süzgecinden geçireceğini açıklayan Youtube hakkında önemli bilgiler verilmiştir . Gelin, şimdi YouTube CEO'su Susan Wojcicki …

Devamını Oku »

Spotify ile Facebook ortak oldu!

Spotify'a yapılan açıklamaya göre artık Facebook Messenger üzerinde Spotify grup çalma listeleri oluşturulabilecek. Bu çalma listeleri de kullanma silmediği sürece kullanılabilecek. Messenger'da çalma listesi dönemi başlıyor! Yeni özelliğin çalışma prensibi de pol단. Facebook Messenger ile bir grup konuşması başlattığınızda, üst kısımda bulunan "+" simgesine tıklayınarak Spotify'ı seçmenizve "Yeni çalma listesi oluştur" seçeneğiğine dokunmanız yeterli. Bu andan itibaren siz ve siz …

Devamını Oku »

Google ile iş ilanı artık çocuk oyuncağı!

Google yeni projelerle kullanıcılara daha kaliteli hizmet vermek için çalışmalarına son hız devam ediyor. Google'dan iş ilanları için özel sekme! Hatırlayacağınız üzere Google G / Ç 2017 etkinliği öncesinde yetkililer, Google for Jobs adlı kişiye yeni bir girişimini halkoyuna duyurmuştu. Yapılan açıklamaya göre arama devi Google iş arayan kişilerin oldukça yüzüne güldürecek. İş arama için daha kullanıcılara Google'da iş bulma …

Devamını Oku »

OnePlus 5 ile çekilen fotoğrafları yayınlandı!

OnePlus 5 ile çekilen fotoğraflar, 5 'in kamera kalitesini merak ediyorsanız, şirketin CEO'su Pete Lau tarafından yayımlanan ve OnePlus Tam boy göremiyor. OnePlus HDR şovu! Fotoğrafların çözünürlüklerinin 16 MP'li ve bu yüzden artık OnePlus 5 'in en azından bir kamerasının 16 mpüyağının ortaya çıkmış olduğunu belirtmemek gerekiyor. Görsellere göz atacak olursanız cihazın şu anda mobil fotoğrafçılık konusunda rakipleriyle rahatlıkla çocuk …

Devamını Oku »

Tişört ile Dalgalı Saç Yapımı

Doğal dalgalı saçlar için ihtiyacınız olan tek şey bir tişört ve lastik. 🙂 Tişörtünüzü sıkılsın bir şekilde dolayıp çember haline getirdikten sonra lastik ile iki ucunu bağlıyorsunuz ve başınızı üzerine yerleştiriyorsunuz. Sonraki adımların da tutamlara bırakılmasıyla saçlarınızı sırası ile çembere doluyorsunuz. Bir süre beklettikten sonra çemberi saçınızdan çıkarabilirsiniz oy; Kuaför eli değmiş gibi doğal dalgalı saçlar. 🙂 Hem böylelikle, yüksek …

Devamını Oku »

Zafer Bayramı İle İlgili Şiirler

Bu sayfada zafer bayramı şiirleri, zafer bayramı şiirleri, zafer bayramı şiirleri 2 kıtalık bulunmaktadır. Yeter ki siz oku. ZAFER TÜRKÜSÜ Yaşama bakıldığında ölüyüz bakalım, Zafer göz yummadan koşana gider. Bayrağa kanının alı çalmayanın, Gözyaşı boşana boşana gider. Kazanmak istersen sen de zaferi, Gürleyen sesinle doldur gökleri. Zafer dedikleri kahraman peri, Susandan kaçar da coşana gider. Diriler şerefli, ölüler şanlı. Yurt …

Devamını Oku »

SMCHD1 mutasyonları ile ilişkili olan SMCHD1 mutasyonları …

1 Harvard Üreme Endokrin Bilimleri Merkezi ve Narkotik Direnç ve İnfertilitede Translasyonel Araştırma Merkezi, Tıp Bölümü Üreme Endokrin Ünitesi, Massachusetts Genel Hastanesi, Boston, Massachusetts, ABD 2 Ulusal Çevre Sağlık Bilimleri Enstitüsü, Araştırma Üçgeni Parkı, Kuzey Carolina, ABD 3 Massachusetts Genel Hastanesi ve Harvard Tıp Fakültesi, Nöroloji Anabilim Dalı, Massachusetts, Boston, Massachusetts, Massachusetts Genel Hastanesi, Moleküler Nörogenetik Ünite ve Psikiyatrik ve …

Devamını Oku »

Elektronik sigara ile kesmek – ShiftDelete.Net

Güvenlik dünyaca günden güne yapay zekaların gücünü de yanına alarak hacker lara karşı sıkı önlandsısınıte. Bu nedenle hacker lar tahminlerde zor yöntemlere yönelerek güvenlik önlemlerini geçmeyi başarıyor. Geçmişten Günler 'da ' da FourOctets kullanıcısının arkadaşları Çevrimdışı e-sigara bir bilgisayarın saniyeler içinde hacklenebileceğini gözler önüne serdi. İş yerinizde vape kalemlerini almam için üzgünüm …… pic.twitter.com/VYhIIvyDEx – Derbi biletini alacaksın (@FourOctets) 25 …

Devamını Oku »

Translasyonel sonlandırma ile …

Bakterilerde mRNA transkriptlerinin% 2-4'ünde, hatalı transkripsiyon veya nükleolitik bölünme nedeniyle bir çerçeve içi durdurma kodonu yoktur (1). Tercüme edildiğinde serbest bırakma faktörlerini toplama yeteneği, ribozomların bu kesintisiz transkriptlerin 3 'ucunda durmasına neden olur. Ribozomları çevirmek, bir durdurma kodonu ya translasyonel çerçeve kaydırma (2, 3) ile okunur ya da geçilirse, bozulmamış transkriptlerin 3 'ucunda durur. Durmuş ribozomların birikimi potansiyel olarak ölümcül …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Ramazan Ayı İle İlgili Hadisler

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Oruç ve Ramazan ile ilgili Hadis ve Ayetler

Ayet-i Kärn Ramazan ayı, okula giden yol gösterici, doğrulan ve doğruyu eğriden ayırmanın açık delilleri olarak Kur'an'ın indirildiği aydır. Öyle ki sizden ramazan ayını idrak edenler onda oruç tutsun. Başka bir günlerde kaza etsin. Allah senin için kolaylık ister, zorluk istemez. Bütün bunlar, sayıyı tamamlamanız ve doğru yolu göstermesine karşılık, Allah'ı tazim etmeniz, şükretmeniz içindir. (Bakara Suresi 185) Ey iman …

Devamını Oku »

Avrupa Birliği Google ile mahkemelik oldu

Önümüzdeki sırasında birkaç hafta boyunca Avrupa Birliği ile Google'da yaşanacak yasal savaşa tanıklık edeceğimiz artık kesin gibi. Çünkü AB'nin sözellikayı Google'ın arama sonuçlarını, bir avukatın bir ceza kesileceği belirtildi. Google arama sonuçlarına müdahale mi ediyor? Avrupa Komisyonu ya da Google Google ile ilgili resmi açıklama yapmasa da, bazı bilgiler doğruysa önümüzdeki birkaç yıl boyunca çözülemeyecek bir yasal sürecin başlayacağını söylemek …

Devamını Oku »

Li-ion batts ile uzaya giderken, yapma …

                                  Sony, 1991'de dünyanın ilk ticari lityum iyon pilini piyasaya sundu … ve o zamandan beri tasarım o kadar da değişmedi.                  Yeni araştırma, sıvılaştırılmış gazın dahil edilmesinin, lityum-iyon pillerin daha önce mümkün olmadığından daha düşük sıcaklıklarda çalışmasına izin verebileceğini önermektedir.                  Lityum iyon piller ucuz, oldukça güvenilir ve yüksek bir enerji yoğunluğuna sahip. Uzaydaki nesneleri güçlendirmek için ideal …

Devamını Oku »

Ramazan Ayı ile ilgili sözler

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Nexus 6 Sprint ile satışa sunuldu LetsGoMobile

S Baskı, yılbaşı ve tatil alışveriş sezonunun başlangıçasına az zaman kala Android işletim sistemli Nexus 6 akıllı telefon telefon 2.5G Hz LTE bağlantı desteğinde Sprint Aile Paylaşımı Paketi gibi paket seçenekleri ile telefonseverlerin beğenisine sunuyor. Motorola'nın Nexus 6 modeli Google'ın en son versiyonu Android 5.0 Lollipop işletim sistemi yüklü olarak gelen ilk cihazlardan bir taneye sahipbilgisi dikkat çekiyor. 14 Kasım …

Devamını Oku »

Papatya İle Saç Açma

Papatya suyu en etkili saç rengi açıcılarının başında gelmektedir. Papatya suyu, papatya suyu, papatya suyu, olgunlaşmak. Papatya suyu sadece saç renginin açılmasına yardımcı olmaktadır. Renk değiştirme amacı ile kullanılamaz. Bu yazı renk değişikliği ve farklılık isteyen genç kızlar tarafında yoğun talep görmektedir. Papatya İle Saç Rengi Açma Yapılır? Papatya ile saç rengi açma doluluk oranı ve pratiktir. Tek dezavantajı tek …

Devamını Oku »

C Vitamini İle Saç Açma

Boyalı saçlar için saç kurdu zordur. Bunun yöntemlerinin en bilindiği kimyasal saç açıcıları. Bunu kullanmak yerine C vitamini ile saç açma saçlarınızı yıpratmadan açabilirsiniz. Hem saçınıza yıpranmayacak hem de homojen bir şekilde açılmasını sağlayacaksınız. Tabi ki boyanın renk tonu da önemli. Çok koyu bir boya isterseniz tonlayın ve tonla kumaşla açma işleminiz uzun sürecektir. C vitamini işlemi kimyasal açıcılar gibi …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

FOX TV ile Kanal D arasında savaş çıktı!

                     2017-06-14 19:24:00                                                                      Milliyet yazarı Ali Eyüboğlu, FOX TV ile Kanal D'yi karşı karşıya getiren format kavgasının ayrıntılarını yazdı.Milliyet yazarı Ali Eyüboğlu, iki kanalı karşı karşıya getiren format kavgasının ayrıntılarını yazdı. Kanal D'de yayınlanacak Kısmetse Olur programında adını duyuran Seda Akgül'ün FOX TV'ye aktarımı ve burada "Yuvamız Yıkılmasın" isimli bir 'barıştırma' programı yapacağını duyurmuştuk. Milliyet yazarı …

Devamını Oku »

NVIDIA ile 4K 60fps (E3 Özel)

Teknosa 'nın katkılarıyla devam etmek Teknoloji ve oyun turumuza NVIDIA görüntüleri ile devam ediyoruz. Fuarın ilgi çekici konuklarından biri NVIDIA en yeni oyunlar için kurduğu bootlerle dikkatleri çekti. Tüm E3 haberlerine buradan ulaşabilirsiniz! NVIDIA E3 görüntüleri Destiny Monitörler ve NVIDIA ekran kartları ile denenmeye hazır Destiny 2 Mass Effect Andromeda gibi bir çok oyun hazır haldeydi. Ayrıca NVIDIA'nın E3 için …

Devamını Oku »

Apple'ın güç ile entegre Dokunmatik Kimlik patenti alındı ​​

Apple'ın ana ekran tuşuyla kaldıracağı uzun süredir gündemde. Onuncu yıla özel iPhone'da çerçevesiz OLED bir ekranını çok analistin ortak görüşü. Fakat Dokunmatik Kimlik 'nın yeri ile ilgili netleşen bir şey yok. Apple'ın bir kaç gün önce aldığı güçekt Entegrasyonu olan bir parmak izi okuyucusu patenti Touch ID bilmecesini iyice karıştırdı. Dokunmatik Kimlik güç tuşunda mı olacak? Yeni iPhone'da Dokunmatik ID'nin …

Devamını Oku »

Şalgam 2 Mandalina: Enginar ile Penne

Bugün Menü Yapın ~ Enginalı Penne Bu makarna tariflerini atma vakti … Hava daha da ısınıyor ve Sıcak, sıcaksın ~ Makarna salataları ve yaz sadece kitabımda bir araya geliyor. Dışarıda sıcak olduğunda ve ne için acıktığını bilmiyorsan, Lezzetli, serin bir makarna salatası her zaman yerinde olur Enginalı Penne Malzemeler      1 kavanoz (12 oz)      Dört bölmeli enginar kalpler      …

Devamını Oku »

Qualcomm Snapdragon 845 ile X20 modem çipi sunulacak

Qualcomm 'un sonraki üst seviye çipseti karşımıza çıkacak Snapdragon 845 hakkında yeni bilgiler gün ışığına çıkmaya devam ediyor. Son olarak, çipsetle birlikte gelecek modem çipi hakkında yeni ayrıntılar geldi . Snapdragon 845 X20 modem çipiyle gelecek Samsung Galaxy S8 ve Galaxy S8 Plus modelleri Snapdragon 835 çipsetiyle gelmiş ve adeta çipsetin stoklarını tüketen akıllı telefonlar sebebiyle LG G6, ] Snapdragon …

Devamını Oku »

Bethesda VR hamlesi ile şaşırttı!

oyun dünyası VR Teknolojisine yatırım yapmaya devam etse de bu alanda hazırlanan AAA yapımların azlığı gerçekten can sıkıcıydı. Bu algıyı kırmayı bir nebze başaran Resident Evil 7 'den sonra, Bethesda VR hamlesi le karşımızda. Düşen 4 ve DOOM sanal gerçeklik dünyasında! Bethesda 12 Haziran sabahı gerçekleşen E3 2017 konferansında iki büyük oyun ile VR dünyasına adım attığını duyurdu. HTC Vive …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

IOS 11 ile fotoğraf ve video boyutları yarı yarıya azalıyor

Apple, geçtiğimiz yıl en düşük depolama alanı olarak 32 GB 옵션ğine devamti. Fakat iPhone'la birlikte iPhone'ların 4K video çekebilme özelleşmesine kavuşması için bazı kullanıcılar için 128 GB lık alanın bile yetersiz olmasına sebep oldu. Durum için bu halde olduğu için 16 GB iPhone'un sahip olduğu ciddi anlamda yığı sıkıntısı yaşıyorlar. Apple, iOS 11'de fotoğraf ve video kaydetme formatını değiştirerek alan …

Devamını Oku »

Anti sosyal medya simülatörü Binky ile tanışın!

Günümüze geçmiyor ki günümüzün hastalıkları-bağımlıkları için geliştirilmiş yeni bir buluş veya yazılım ortaya çıkmasın. Bugün sizlere bahsedeceğimiz uygulamanın adı ben Binky . Günümüz sosyal medyasının verdiği zararlara tepki olarak geliştirilen Binky 'e yakından bakıyoruz. Anti sosyal medya simülatörü Binky! Geliştiricisinin de sözündeki gibi " Şaka gibi başlayan " Bu proje kısa sürede gerçek bir uğraşa döndü ve ortaya anti sosyal …

Devamını Oku »

IOS 11 ile iOS 10.3.2 performans testinde!

Bu hafta başında tanıtılan iOS 11 iOS 10 kadar köklü değişiklikler getirmese de bir daha kullanışlı yeni özelliğe sahip. Bu özellik test etmek isteyen birçok meraklı kullanıcı iOS 11'in ilk betasını yükledi. Fakat henüz yüklememiş iOS cihaz sahiplerini düşünen iAppleBytes adlı kullanıcının YouTube kanalı, iOS 11 ile iOS 10.3.2'yi iPhone 6s, iPhone 6 ve iPhone 5s Ü zerinde karşılaştırdı. iOS …

Devamını Oku »

S ile Eğitilen Sinir Devreleri …

Bu mektup, öğrenmenin hesaplama hesapları ile karar alma süreçleri arasındaki ilişkiyi, takviye öğrenmeye (RL) ve ardışık olasılık oranı testine (SPRT) dayanarak analiz etmiştir. Belirli bir sınıf sınıfındaki RL kuralları tarafından öğrenilen sinaptik ağırlıkların WOE'lerle orantılı olduğunu ve dolayısıyla bilginin bir karar oluşturmak için birden çok işaretten entegre olmasını sağladığını gösterdik. Yang ve Shadlen (2007) görevindeki modelin simülasyonları hayvan davranışının ve …

Devamını Oku »

A ile aşı ile indüklenen bloke edici antikorlar …

Özet Arka plan Balık ağır IgE'nin sık görülen bir uyarıcısıdır Arad> r> lm> fl alerjik reaksiyonlar. Kaçınılmanın yanında, şu anda alerjene spesifik bir tedavi mevcut değil. Hedefler Bu çalışma, 2 kalsiyum bağlayıcı bölgenin mutasyonuna dayanan spesifik immünoterapi için büyük balık allerjeni olan parvalbumin'in hipoalerjik varyantları geliştirmiştir. Insan hastalığını andıran balık alerjisine yönelik bir fare modeli oluşturabilir ve majör sazan allerjeninin …

Devamını Oku »

Core i7-7740K ile yeni bir rekora imza atıldı!

AMD'nin Ryzen serisi işlemcileri duyurmasıyla birlikte rekabetin ciddi oranda arttığı işlemci pazarında bu yıl Intel, yeni 7. Nesil işlemcileri ile kullanıcıların karşısına çıktı. Bu işlemcilerden birisi olan Core i7-7740K üst seviye anakartlar için hızlı devreye alma işlemi bir rekora imza attı. Intel Core i7-7740K ile 7,5 GHz hızına ulaştılar! X299 serisi anakartlarının başarısız kanıtlanması için overclock uzmanları bir araya getiren …

Devamını Oku »

IOS 11 ile iPad'e gelen yenilikler!

Eylül ayı son sürümü yayınlanacak olan iOS 11 iPhone ve iPad'ler için birçok yenilik getiriyor. Apple'ın iPad'lere getirdiği özellikler karşımıza bilgisayar kullanımının verdiği rahatlığı yaşayacaklar. Peki iOS 11 iPad'e hangi özellik kazandırdı? İşte bilgiler. Dosyalarınız bir yerde Dosyalarla birlikte bütün dosyalarınız bir yerde toplanıyor. Son kullandığınız dosyalar rahatlıkla görebiliyorsunuz. IPad dışındaki iCloud Drive Dropbox gibi yerlerde sakladığınız dosyalarınız da burada …

Devamını Oku »

Hakan Akkaya taşıyıcı anne ile baba olacak!

                     2017-06-06 13:57:00                                                                      Ünlü modacı Hakan Akkaya, taşıyıcı anne ile baba olacak. Akkaya; 'Taşıyıcı anneden çocuk sahibi olmayı istiyorum. Diğer ilişkilere karşıyım; Çünkü zamanla bitiyor. ' dedi. Emre Saygı'nın Youtube'den canlı yayınlanan interaktif Talk Show programı 'Hadi Be'nin konuğu, ünlü modacı Hakan Akkaya oldu. "16 YILDIR AŞIK OLAMIYORUM" Hakan Akkaya, "Yolda gördüğüm herkesin sadece kıyafetine ve …

Devamını Oku »

IOS 11 ile birlikte 32 bitlik uygulama desteği sona erdi!

iOS 11'in ilk betasını piyasaya sürülmesinden önce 32 bitlik uygulamaların artık desteklenmeyeceğini gösteren bir işaret var. iOS 11'in ilk sürümünü beta sürümüyle birlikte onaylanmış oldu. iOS 11 ile 32 bitlik uygulamalara elveda! Apple, 32 bitlik uygulamalar için iOS 10'da Bu uygulamaya ait cihaz performasını olumsuz etkileyeceğini belirten uyarılar veriyordu. Geliştiriciler için son uyarılardan sonra beklendiği gibi iOS 11 ile 32 …

Devamını Oku »

Bomba aşk iddiası! Meryem Uzerli ile Adebayor …

                     2017-06-05 12:28:00                                                                      Birinci okunmamış Mesaja eklemek için tıklayınız Meryem Uzerli ile Başakşehir'in dünyaca ünlü yıldız futbolcusu Emmanuel Adebayor, sosyal medyada birbirini takibe aldı. Başakşehir Spor Kulübü'nün dünyaca tanınan golcüsü Emily Adebayor ile güzel oyuncu Meryem Uzerli'nin birbirlerini Instructions'da takibe alması dikkatlerden kaçmadı. SADECE 6 KİŞİYİ TAKİP EDİYOR Önce Emmanuel Adebayor Meryem Uzerli'yi takibe aldı. Meryem …

Devamını Oku »

Yeni iPad Pro ile gelen karşılaşma (VİDEO)

Bir süredir kullandığımız 9,7 inç'lik iPad Pro'yu, gelmiş geçmiş en iyi tablet olarak anlatmıştık. Ta ki, WWDC 2017'de duyurulan 10.5 ve 12.9 inçlik yeni bir iPad Pro'yu görene kadar. Burada detaylı anlattığımız 10.5 inçlik iPad Pro ile ilk karşılaşma anımızı ve deneyimlerimizi paylaştık. :: Yeni iPad Pro'ları nasıl buldunuz? SDN – ShiftDelete.Net  

Devamını Oku »

IMac Pro ile gelen karşılaşma (VİDEO)

WWDC 2017'de duyurulan yenilikçi ürünlerden biri iMac Pro oldu. Profesyonellere hitap eden iş istasyonu, uzay grisi renginin yanı sıra, aksesuarlarının da kez sayısı bir kez Apple'ınla olduğu gibi. Burada detaylı olarak anlattığımız iMac Pro ile ilk karşılaşma anımızı, takip videodan izleyebilirsiniz. :: iMac Pro sizde olsaydı neler yapardınız? SDN – ShiftDelete.Net  

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Papatya Suyu İle Saç Açma

Saç rengini açmak için kimyasallar yerine bitkisel doğal malzemelerden yaralanmak her zaman daha sağlıklıdır. Papatya takımı saç derisini açar ve saçlarını alır. Ayrıca papatya suyu saça canlılık verir. Papatya Suyu Nasıl Hazırlanır? 1 su bardağı dolusu kurtulmuş papatya 1 litre suya konarak kaynamaya bırakılır. Papatya'nın çayında beş dakika kadar kaynatılır ve ocağın altı kapatılarak 15 dakika demlemeye bırakılır. Bir süzgeç …

Devamını Oku »

Oksijenli Su İle Saç Açma

Birçok insan saçını boyatmaktan kaçınır. Fakat aynı durum saçlarını rengini değiştirmek istersiniz. Bu iki yöntem uygulamanın imkansız olduğu düşünülse de aslında öyle değil. Oksijen ile saç rengini açtırarak boya işlemine gerek kalmayacaktır. Oksijenli suyun kimyasal dildeki adı hidrojen peroksittir. Bu kimyasal işlem bazı saçılar boyadan daha çok yıpranmaya sebep olabilmektedir. Bu nedenle çalışan kişinin iyice düşünmesi ve daha sonra yapması …

Devamını Oku »

Twitter yeni bir hack olayı ile gündemde!

Yenile Dünyanın en çok Kullanılan sosyal medya platformlarından birisi Olan Heyecan evlat dönemde ciddi Artış Yaşanan siber saldırılar ile orantılı olarak Olayları kesmek ile anılmaya başlandı. ele geçirilmesi Rus hackerlar Tarafından 32 milyon hesabın Bitcoin karsiliginda satışa çıkarılması ile Birlikte Kullanıcıların bulunduğu aklında soru işaretlerine neden Olan Heyecan ettik, Yeni Bir hack olayı ile Gündeme geldi. Bahreyn Dışişleri Bakanı Twitter …

Devamını Oku »

OnePlus 5 kamerası ile büyüleyecek!

OnePlus 5 hakkında yeni gelişmeler yaşanmaya devam ediyor. OnePlus yeni telefon ile gümbür gümbür geliyor. OnePlus 5'in kamerası ile kullanıcılarının büyüleyecek! Bugünkü sızdırılan görüntüler ile birlikte yeni amiral gemi si OnePlus 5 'in kamerası ile çekilmiş, birbirinden güzel fotoğraflarken beraberinde. OnePlus kamera konusunda rakiplerine fark atmak istiyor. OnePlus 5 İle Birlikte Mesaj Gönder Edildi. Çift arka kamerası ile kullanıcılarına farklı …

Devamını Oku »

Siri IOS 11 ile birlikte daha çok uygulama destekleyecek

Apple'ın yeni mobil işletim sistemi iOS 11 'de Siri önemli yeniliklerin uzmanları bekleniyor. Reuters'in haberini göre Siri, iOS 11 ile birlikte daha fazla üçüncü parti uygulama desteğine verir. Yeni iOS 11 konsepti yayınlandı! Siri'nin kullanım alanı genişliyor! fotoğraf araması ödemeler İma Şartları IOS 10 VoIP çağrısı ve Egzersiz – Uygulamalı Siri ile entegre olmasına izin vermişti. Bu, sanal asistanın doğru …

Devamını Oku »

+100 Uzun Yüzlü Erkek Saç Modelleri ile Karizmanı Yeniden Keşfet

Uzun yüz saç modelleri erkek 2017: Yüz modelinde bazı modeller var. Var. Bazı erkek saç modelleri, uzun yüzlerde çok hoş dururken bazısı da hoş olmayan bir görüntü yaratabiliyor. Uzun yüze yani uzun bir kafaya sahip beylerin de yüzlerine uygun saç modeli seçmeleri önemli bir faktör. Kısa saçlarla daha iyi sağlandığını düşünorum. Dikdörtgen formundaki bu uzun yüz saç modelleri erkek lerin …

Devamını Oku »

Murat Boz ile Aslı Enver barıştı mı

                     2017-06-03 20:36:00                                                                      Geride bıraktığımız zaman ayrılmış Aslı Enver ile Murat Boz cephesinde şaşırtıcı bir gelişme yaşandı. 2016 yılının ocak ayında aşka Aslı Enver ile açan Murat Boz, ani bir kararla yollarını açıkladı. Murat Boz, Antalya konserinde 'Aslı ile ayrıldık' açıklaması yapmış, güzel oyuncu da geçtiğimiz günlerde 'Kavgasız gürültüsüz ayrıldık.' demişti. 'Ayrılık' itirafına rağmen, sosyal medya …

Devamını Oku »

Google, Wonder Woman ile kodlamayı öğretecek!

Bugüne kadar hayatımızdaki çok alanda varlığı gösteren Google bir süredir çocuklara programlama eğitimi için de ilgileniyordu. dün vizyona giren Wonder Woman filmiyle anlaştığını ve birlikte anlaşıldığını ve ortaokul çağındaki kız öğrencilere programlama öğreteceklerini duyurdu. Bu uygulama sadece kadınlar için! Google'ın 2014 yılında başlattığı Made with Code projesi, lise ve ortaokul çağındaki genç kızları programlamaya hazırlanmış bir proje. Google'ın en büyük …

Devamını Oku »

LG G4c ile mükemmel selfie fotoğraflar LetsGoMobile

L LG G4c, kolay kullanım ve LG kalitesiyle kullanıcıyla buluştu. LG G4'ün yeni akıllı telefonu LG G4c, tüm seviyedeki kullanıcılara LG G4'ün akıllı telefon pazarına verilmesi kaliteyi deneyimleme imkânı veriyor. LG G4c, 5.0 inçlik HD ekranı ile zenginleştirebilir ve gerçeğe yakın renkleri gösteriyor. LG G4c "title =" LG G4c " LG G4c ile benzersiz ve eğlenceli selfie fotoğraflar LG'nin amiral …

Devamını Oku »