15 Aralık 2017,Cuma
Anasayfa » Tag Archives: hale

Tag Archives: hale

Şirketinizi W'ye Mükemmel Hale Getirmenin Anahtarı …

İK profesyonelleri her zaman kaçınılması gereken gizli sos için ava çıkıyor; iyi bir kurum kültürünü mükemmel bir kurumsal kültüre dönüştürebilen uygulama, süreç veya zihniyet. Çalışanlar en çok değer veren şey nedir ve onları etrafında dolaşmaya yetecek kadar mutlu eden şey nedir? Ve iş açısından bakıldığında, olumlu bir kurum kültürü genel başarının daha iyi olmasına katkıda bulunuyor mu? Şirketlerin yüksek güvenlikte, …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Google Drive, çok daha gelişmiş bir hale geliyor!

Güneş Enrğı Bulut Storage Hizmetlerinden Birisi olan Google Drive kullanıcılara sunduğu sınırsız fotoğraf ve video yedekleme imkanı ile onun geçen gün daha fazla kullanıcı tarafından tercih ediliyor. Google, 850 milyonun üzerinde kullanıcıya ve 2 trilyondan fazla dosyaaya ev sahipliği yapan Drive'ı çok daha gelişmiş bir hale getiren, Yedekleme ve Senkronizasyon isimli üyemiz çevrimdışıdır. [Da] yeni bir aracı duyurmaya hazırlanıyor. 28 …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Evinizi akıllı hale getirecek 8 teknoloji

Akıllı ev teknolojileri gün geçtikçe daha da hayatımızın içinde yer aldı. CES 2017'de yetkili kılınmış akıllı ev teknolojileri. Hayatta kolaylaştıran teknolojilerden en çok dikkat çeken 8 teknolojiyi sizler için derledik. 1- LG akıllı InstaView buzdolabı: Akıllı buzdolabı LG Smart InstaView buzdolabı, ön tarafta bir ekran ve pencereye sahip. Ayroca envanter almak, pazar listelerini kaldırmak, son kullanma tarihlerini takip etmek, hatta …

Devamını Oku »

Uzaydaki 9 aydan sonra, fare spermleri sağlıklı hale …

                                                                                                                                          Kredi: martha sexton / public domain      Uzayda dokuz ay geçtikten sonra, fare spermleri sağlıklı farlar üretti, Japon bilim insanları Pazartesi günkü bir haberde.                                                                       Dondurularak kurutulmuş sperm örnekleri 2013'te Uluslararası Uzay İstasyonuna fırlatıldı ve 2014'te Dünya'ya geri döndü. Uzayın yoğun ışınlanması, spermde hafif DNA hasarına neden oldu. Yine de, in vitro fertilizasyon …

Devamını Oku »

Güvenlik teknolojisi, daha fazla kazayı düzeltmek için pahalı hale getiriyor

       Şeritten ayrılma uyarı sistemleri ve çoklu hava yastıkları gibi güvenlik özellikleri ölüme ve araç çarpmalarına bağlı yaralanmalara engel olur. Ancak kaza sonrasında toplam kayıp olarak kabul edilen araç sayısını da artırıyorlar. Dallas'ın riskli teorinin üst düzey başkan yardımcısı Bob Tschippert, pahalı teknolojilerin araç onarımlarını daha pahalı hale getirdiğini ve bunun sonucunda hasar görmüş bir aracın sigorta şirketi. "Geçmişte bir …

Devamını Oku »

Samsung cihazlar daha güvenli hale gel geliyor

Samsung akıllı telefonlar için yeni aylık bakım güncellemesi ni sunmak üzere gün sayıyor. Mayıs ayı güncellemesi yle Galaxy cihazlar çok daha güvenli hale gelecek . Samsung 60'tan fazla açığı ve sorunu gideriyor Galaxy S8 Galaxy S8 Plus Galaxy S7 ve Galaxy S8 Galaxy S8 Plus Galaxy S7 ve Galaxy S7 kenar modellerinin başı çekeceğini tahmin et hiç de güç değil. …

Devamını Oku »

PI3Kδ ve primer immün yetmezlikler – Avrupa PMC … Özet Birincil immün yetmezlikler, immün sistemin kalıtsal bozuklukları, Genellikle lenfosit gelişimi için gerekli genlerin mutasyonu ve Aktivasyon. Son zamanlarda, çeşitli çalışmalar, fonksiyon kazanım mutasyonları tespit etmiştir Fosfoinositid 3-kinaz (PI3K) genlerinde PIK3CD (ki P1106'yı kodlar) ve PIK3R1 (p85α'yı kodlar) Aktif olarak adlandırılan kombine bir immün yetmezlik sendromuna neden olan PI3Kδ sendromu (APDS) veya p1108-aktive edici mutasyona neden olan Yaşlı T hücreleri, lenfadenopati ve immün yetmezlik (PASLI). Paradoksal, Hem fonksiyon kaybı hem de bu genleri etkileyen fonksiyon kazanım mutasyonları Farklı mekanizmalar yoluyla olsa da, immünosüpresyona neden olur. Burada, Adaptif bağışıklıkta PI3Kδ'nın rolleri, klinik bulguları tanımlar Ve APDS'deki hastalık mekanizmalarını incelemek ve PI3Kδ'ya yeni bakış açıları vurgulamak Bu hastalardan elde edilen bulguların yanı sıra Klinik tedavi. Giriş Aktif PI3Kδ sendromu (APDS; PASLI olarak da bilinir), Içinde yeni tanımlanmış primer immün yetmezlik (PID) sendromlarının giderek artan sayısı Nedensel mutasyonlar, yeni nesil dizileme ile tanımlanmıştır. The APDS'nin klinik bulguları çeşitlidir ve heterojendir (Kutu 1), ancak hastaların çoğunluğu Tekrarlayan solunum yolu enfeksiyonlarıyla, sıklıkla hava yolu skarlasması ile birlikte görülen (Bronşektazi) ve kulak ve sinüs hasarı, ki bu antikorun (B hücresi) eksiklik. Herpes aile virüsleri ile şiddetli, tekrarlayan veya devam eden enfeksiyonlar, Kusurlu T hücre fonksiyonunu gösteren, bu durumda da sık görülür ve Bazı etkilenen bireylerde erken ölüm neden olur. Birçok hasta benign gelişir Hepatosplenomegali ile sıklıkla ilişkili olan lenfadenopati ve APDS ile ilişkili B hücre lenfoma riski önemli ölçüde artmıştır (Kutu 1). Viral duyarlılık artışı Enfeksiyon ve hafıza T hücrelerinin zayıf geri çağırma tepkileri APDS'yi ayırt eder İzole edilmiş hipogammaglobulinemi 1 – 4 dolayısıyla APDS kombine edilmiş olarak düşünülmelidir Bağışıklık yetersizliği 5 . 100'den fazla hasta APDS ile bugüne kadar bildirilmiştir, ancak kesin insidans henüz bulunmamaktadır. . Kutu 1 APDS'nin klinik özellikleri 6 APDS'li hastalar hem bağışıklık yetersizliği hem de bağışıklık özellikleri sergilerler Disregülasyon: Nükseden akciğer, kulak ve sinüs enfeksiyonları (kapsüllenmiş bakterilerle Olarak Haemophilus influenzae ve Streptokoklar Etkili olabilmek için opsonizasyona ihtiyaç duyan pneumoniae Öldürme) yakın evrenseldir ve yüksek bir insidans ile ilişkilidir Işitme bozukluğu ve bronşektaziyi içeren organ hasarı Havayolu korkutması) 1 4 . Herpes aile virüsü ile şiddetli, tekrarlayan veya kalıcı enfeksiyonlar Yaygın, özellikle kronik EBV veya CMV viremi ve HSV ve VZV Enfeksiyonlar 1 3 – 7 . Bazı solunum yolu virüslerinin sık izolatları 1 Fırsatçı enfeksiyonlar seyrek olmakla birlikte, birkaç hastada (örn., Adenovirüs ve echovirus) Tekrarlayan viral siğiller veya molluskum kontagiosum deneyimli Enfeksiyonlar 49 . Apse oluşumu, lenfadenit ve selülit insidansında artış Gram pozitif bakterilerle (çoğunlukla Staphylococcus Aureus ) ve mikobakterilerin hatalı öldürülmesi APDS'li bir hastadan izole edilen makrofajlar, Doğal bağışıklık 64 . Benign lenfoproliferasyon (lenfadenopati, hepatosplenomegali ve fokal Nodüler lenfoid hiperplazi) tüm hastalarda ortak özelliktir Bugüne kadar incelenmiş olan APDS Etkilenmiş hastalardaki lenfoid dokunun histopatolojik analizi Manto zayıflaması ile atipik folliküler hiperplaziyi gösterir APDS1'deki bölgeler ve APDS2'deki küçük B hücreli folliküller. Germinal merkezler Her ikisinde de T hücrelerini infiltre ederek (çoğunlukla PD1 pozitif) bozuldu APDS1 ve APDS2 APDS ile bağlantılı yüksek oranda bir lenfoma var ve bunları kapsıyor Geniş bir histopatolojik şekil yelpazesi 1 2 7 67 İmmün sitopenias (trombositopeni, hemolitik anemi ve nötropeni) Ve otoimmün benzeri katı organ koşulları (juvenil artrit, Glomerulonefrit, tiroidit ve sklerozan kolanjit) de var 7 66 ,% 34'lük bir frekansta APDS1'li 53 hastanın kohortu 7 Hafif gelişimsel gecikmeler hem APDS1 hem de APDS2'de görüldü. APDS2 olan 36 hastadan oluşan bir kohortta 7 Büyüme (Büyüme) Retardasyon APDS2 olan hastalarda yaygındır 6 73 74 ancak görünmemektedir Özelliği, APDS1'in heterozigot SHORT sendromlu (kısa boylu, boy kısalığı, Eklemlerin hiperekstansibilitesi, fıtı, oküler depresyon, Rieger anomali Ve diş çıkarma gecikmesi) 88 91 APDS heterozigot kazançtan kaynaklanır (GOF) mutasyonları Hiperaktivasyona neden olan PIK3CD veya PIK3R1 Sırasıyla protein ürünleri p1108 veya p85a, 1 – 4 . P85a düzenleyici altbirim ve p110δ katalitik altbirimi Birlikte heterodimerik lipid kinazı PI3Kδ oluşturur; B hücresi reseptörü de dahil olmak üzere bağışıklık sistemindeki hücrelerdeki çoklu reseptörler (BCR) ve T hücre reseptörü (TCR) yanı sıra sitokin ve kostimülatör Reseptörler. Bu aynı altbirimlerde homozigot işlev kaybı (LOF) mutasyonları neden olur İnsanlarda immün yetmezlikten oluşan belirgin ve daha seyrek bir şekil 8 – 10 ve bu belirgin ikiye bölünme, birlikte Etkilenen hasta gruplarının klinik özellikleri, anlayışımızı bildirmiştir. Bu derlemede, PI3Kδ hakkında bilineni özetleyeceğiz, odaklanacağız. Uyarlamalı bağışıklık tepkileri düzenlemesi üzerine. Bu bilginin büyük kısmı Gen hedefli fareler kullanarak yapılan çalışmalar. Ardından, şüphelenilen iki olguyu özetleyeceğiz Insanlarda PI3Kδ eksikliği bildirildi, daha önce tanımlanmadan önce APDS'nin klinik ve immünolojik belirtilerini ayrıntılı olarak açıklar. Sınıf I PI3K'lara genel bakış Sınıf IA PI3K'ler, Pı10a, pı10p veya pı108 katalitik altbirimi oluşturucu olarak Bir p85 düzenleyici altbirimi ile ilişkilidir; IB PI3K sınıfı, Bir p101 veya p84 düzenleyici alt-birim ile etkileşen p110γ katalitik altbirimi (). Pı10a ve pı10p Büyük ölçüde ifade edilirken, p110γ ve pl108 baskın olarak Lökositler tarafından ifade edilir. Fazlalık için önemli bir potansiyel olsa da Katalitik altbirimler arasında, her bireysel p110 izoformu için benzersiz roller var Farklı ifade şekillerini yansıtan ve aynı zamanda Kendi reseptörleri tarafından angaje edilirler 8 , 11 . Örneğin, p110a, Insülin benzeri reseptörler tarafından aktive edilir ve büyümeyi, metabolizmayı ve Angiogenesis 11 oysa p110β Metabolik sinyallemeye katkıda bulunur ve Fare nötrofilleri bağışıklık komplekslerine 12 , 13 . P110γ, Miyeloid hücreler ve kemotaktik tepkilere katkıda bulunur, ayrıca reaktif oksijen Nötrofillerdeki tür (ROS) üretimi 14 . P110δ ile birlikte, p110γ, pre-T hücresi sırasında da önemlidir Timusta gelişim 15 . P1106, Bu derlemenin odak noktası olan hemodiyaliz, hem lenfositlerde hem de Miyeloid hücrelerdir ve antijen reseptörleri, ko-uyarıcı reseptörler, Sitokin reseptörleri ve büyüme faktörü reseptörleri 8 PI3K altbirimleri ve APDS mutasyonları Sınıf Sınıf I PI3K'ler, PtdIns (4,5) P 2'nin fosforilasyonunu katalize eder. ila Bir membran görevi gören PtdIns (3,4,5) P 3 (PIP 3 ) üretirler Pleckstrin homolojisi (PH) alanları olan hücre sinyal proteinleri için ip. Göze çarpan Bunların arasında PDK1 ve AKT, bunlar gibi substratları fosforile edecek şekilde hareket ederler FOXO transkripsiyon faktörleri (inaktive hale gelir) ve regülatörleri MTOR kompleksi 1 (aktive olur). Bu nedenle, sınıf I PI3K'lerin aktivasyonu FOXO transkripsiyon faktörlerinin inaktivasyonu ile sonuçlanır. Lenfositlerde BTK ve İTK PIP 3 – Aktifleştirmeye katkıda bulunan tepki veren tirozin kinazlardır. Fosfolipaz C-gamma (PLCγ) ve diğer indirgeyici sinyal proteinleri (,). Lipid fosfataz PTEN, PIP 3 'i PtdIns'e (4,5) P 2 8'e dönüştürür. Sınıf IA PI3K düzenleyici altbirimler üç farklı gen tarafından kodlanır ( PIK3R1 PIK3R2 ve PIK3R3 ) (). PIK3R1 P85α, p55α ve p50α'yı kodlar (her biri bir alternatiften Transkripsiyon başlangıç ​​sitesi), PIK3R2 p85β'yı kodlar ve PIK3R3 p55γ 16 kodlar. Bu düzenleyici altbirimlerin SH2 etki alanları vardır ve bu bağlar Hücre yüzeyi reseptörlerinin fosforile YXXM motifleri ve membrana bağlı Proteinler. P85α, p55α, p50a ve p85β her yerde bulunur Ifade ederken, p55γ esas olarak beyinde ve testislerde 16 ifade edilir. Sınıf IA PI3K düzenleyici herhangi biri Altbirimler belirgin olmadan p110α, p110β ve p1108'e bağlanabilir seçicilik. PI3Kδ'nın, en iyisi, p85α'yı P1108, ancak p110δ ile diğer sınıf IA PI3K düzenleyici altbirimler de mümkündür. Ayrıca şunu da bilmek önemlidir: P85α birçok p110δ'dan bağımsız işlevlere sahiptir, çünkü aynı zamanda bağlayabilir P110α ve p110β 16 . Sınıf IA PI3K düzenleyici altbirimleri p110 katalitik altbirimlerini etkiler Üç şekilde 17 : proteolitik P110'un bozunması; P110 katalitik aktivitesini inhibe eder; Ve p110'u işe alıyorlar Altbiriminden plazma zarındaki tirozin fosforile proteinlere dönüştürülür. P85α'nın SH2 domenleri fosfotirozinler tarafından tutulduktan sonra, P110 ile inhibitör kontaklar hafifletilir 17 . Böylece, PIK3R1 genindeki mutasyonlar, PI3K aktivitesini, P110δ'nın parçalanmasına veya işe alımının azaltılmasına izin vererek Reseptörler ( PIK3R1 null veya LOF mutasyonları durumunda) veya tarafından P85α'nın p1108 üzerindeki inhibe edici etkisinin serbest bırakılması (durumda PIK3R1 GOF mutasyonları). Düzenleyici alt birimlere ek olarak, P110α ve p110δ RAS'ı bağlayabilir ve p110β, RAC'yi veya CDC42'yi bağlar. Bu küçük GTPazlar p110 altbiriminin membrana bağlanmasına yardımcı olur 17 18 . PI3Kδ ve bağışıklık: fareden alınan dersler APDS tanımından önce, rolü hakkındaki bilgilerin çoğunun Bağışıklık ve enfeksiyonda PI3Kδ, genetik ve farmakolojik Fare modelleri kullanılarak yapılan çalışmalar. APDS'ye neden olan GOF mutasyonları geçtiğimiz günlerde Artmış bazal ve uyarılmış PIP 3 seviyelerine ve PIP 3 – hastadan türeyen bağımlı sinyal iletim dizileri Lenfositler 1 – 4 ve bu hastaların incelenmesi bize yeni bilgiler verebilir PI3Kδ aktivitesinin dengesi bağışıklık hücresi işlevlerini nasıl düzenler. İşte, biz Farelerdeki bu çalışmaların bize ne öğrettiğini özetleyin, önce Mutasyon geçiren insan hastaların immünolojik fenotipleri PIK3R1 Veya PIK3CD

Fare B hücrelerinde PI3Kδ fonksiyon kaybı Farelerde, kemik iliğinde erken B hücresi gelişimi sadece hafiftir 19 – 23 p85α veya p1108'in kaybından etkilenir. Buna karşın p110α ve p110δ kombine kaybı, Pro-B hücresi safhasında 24 yakınlarında yakın komple geliştirme bloğu . Bununla birlikte, p85α veya p1108'den yoksun fareler Altbirimlerin foliküler B hücreleri daha az, marjinal bölge (MZ) B hücrelerinden yoksun ve …

Devamını Oku »

Kablosuz şarj standart hale mi geliyor?

     Konsorsiyumuna Katılmış ve Bu Da Yeni Cihazlarla Birlikte Yapılabilecekler Qi Teknolojisini kullandırarak kullanacak şekli yorumladıtı. Bugün geldi açıklamalarla da Apple'ın yeni iPhone modelleriyle birlikte özel şarj özelliğini birleştirebilme. Bu açıklamaların sahibi ise Powermat şirketinin CEO'su Elad Dubzinski'den başkası değil.                           Elad Dubzinski'den ilginç tahmin Dubzinski'nin Apple tarafından geçersiz kılınırken, birincil çıkarımda bulunulması ve bu iddiayı olayın gerçekleştiği belirtilmiyor …

Devamını Oku »

Bronzlaşma tutkusu bu hale getirdi!

                     2017-04-25 17:30:00                                           Alman model Martina Büyük, aşırı bronzlaşmış teni ve devasa boyuttaki göğüs ölçüsüyle sosyal medyada fenomeneştirmede yağmuruna tutuluyor. Genç modelin önceki halini görenler gözlerine inanamıyor … Almanya'nın Trier şehrinde yaşayan ve modellik yapan Martina Büyük (28), aşırı bronzlaşmış teni ve devasa göğüs ölçüsüyle dış basında büyük yankı uyandırdı. 'Afrikalı gibi görünen' isteğini takılmışadı ortaya çıkarmış Alman …

Devamını Oku »

Dondurulmuş lityum piller onları daha güvenli hale getirebilir ve …

                                                                                                          İyonik iletimi arttırmak için dikey olarak hizalanan ve bağlı seramik kanallarının şematik. Solda, seramik parçacıkları, iyon taşınımının düşük iletkenliğe sahip polimer matrisi tarafından engellendiği polimer matrisine rastgele dağılmıştır. Sağdaki dikey hizalanmış ve birbirine bağlı yapı, buz kalıplama yöntemi ile gerçekleştirilebilen iyon taşınmasını kolaylaştırır. Kredi: Yuan Yang / Columbia Mühendislik      Columbia Mühendislik Malzeme Bilimi …

Devamını Oku »

Depoları daha uygun hale getirmek, geri dönüşüm ve kazanıyor …

                                                                                            Kredi: University of British Columbia      Daha fazla geri dönüşüm veya komposto yapmak ister misiniz? UBC tarafından yapılan yeni araştırmalara göre, bidonları daha da hareket ettirmeyi deneyin.                                                                                 Çalışma, süit kapılardan 1,5 metre uzaklıktaki kutuları yerleştirmenin geri dönüşüm ve kompostlaştırma oranlarını yüzde 141 oranında büyük ölçüde artırdığını gösteriyor. Bulgular, kolaylıktaki küçük değişikliklerin performans üzerinde …

Devamını Oku »

Sistem, granüler dökme malzemeleri daha hızlı ve daha modern hale getirir …

                                                                                                          Kuru meyve, çakıl veya atık – hepsi boyut ve kaliteye göre kemer sistemlerine göre düzenlenir. Kredi: Fraunhofer IOSB     Kum, çakıl, kömür, deikasyon tuzu veya elmas, tahıl, şeker, kahve veya üzüm ve atık – çok sayıda gündelik eşyalar az ya da çok kumlu tanelerdir . Bu dökme malzemeyi kalite ve boyuta göre sınıflandırmak için sofistike …

Devamını Oku »

Canlı akan cinayet yeni normal hale geldiğinden …

                                                                                                          Sosyal medya cinayeti. Kredi: Google      74 yaşındaki Robert Godwin Sr.'ın öldürülmesinin Facebook Canlı videosu Steve Stephens tarafından en az 1.6 milyon kez izlendi.                                                                                 Videoyu indirmek için 3 saat süren Facebook, o zamana kadar Facebook kullanıcıları tarafından tekrar tekrar dolaşıma sokuldu. İsveç'te, bir kadının yaşadığı cinsel tacizi özel bir Facebook grubuna …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

Kişiselleştirme, Pandora Premium'u değerli bir hale getiriyor …

                                                                                                          Kredi: CC0 Public Domain      Abonelik müzik servisleri söz konusu olduğunda, Spotify ve Apple piyasaya hâkim. Ancak müzik endüstrisinde üçüncü büyük oyuncu, tüketicilere başka bir seçenek sunmak üzeredir.                                                                                 Popüler internet radyo servis sağlayıcısı Pandora, Pandora Premium olarak adlandırılan kendi talep üzerine müzik tekliflerini yayınlıyor. Şirket, radyo hizmetini kurarak yeni abone müzik …

Devamını Oku »

Hassas Hâle Sahip Olmak Gerçekten En Büyük Adam Olur …

@ Lesia.Valentain Ben Bir Kanser'im. Ve hastalık anlamına gelmez, yani astrolojik işareti ifade eder. Ben bir kanserim. Duygusal, sezgisel ve hassasım. Başka bir deyişle, ben şeyleri önemsiyorum. Çok. Komik olan, "hassas" kelimenin Kanser'in iyi ve kötü nitelikleri altında listelenmesidir. Astroloji-Insight'a göre, sevgi dolu ve duygusal, kurnaz ve ihtiyatlıyım, hassas ve besleyici. Fakat kapak tarafında, ben de kararsız ve duygusal, aşırı …

Devamını Oku »

Audi, EV'leri 'olmalı' hale getirmeyi amaçlıyor

e-tron quattro SUV konsepti ilk olarak 2015 Frankfurt otomobil fuarında gösterildi.       Nick Gibbs             Otomotiv Haberleri Avrupa 15 Mart 2017 15:21 CET INGOLSTADT, Almanya – Audi, CEO'su Rupert Stadler'ın otomobil üreticilerinin EV'leri "olmazsa olmaz" hale getirme planlarını ana hatlarıyla çizdiği için, 2020 yılına kadar üç tam elektrikli araba piyasaya çıkarma planlarının daha fazla ayrıntısını sundu. …

Devamını Oku »

Otoshops ikinci el otomobil alım satımında iddialı Otoshops ikinci el otomobil alım satımı konusunda 2016 yılındaki performansını ve 2017 hedef ve beklentileri ortaya koyduğu bir basın toplantısı düzenledi. Şirketin Kartal'daki tesisinde düzenlenen toplantıda konuşmalar yapan Otoshops Genel Müdürü Tuğrul Denizaşan, 2016 yılının oğlu çeyreğinde hizmetlerden başlayarak Otoshops'un, 1593 adetlik satış çıkarılacağını açıkladı. Otoshops ikinci el otomobil toplantısında 2017 hedeflerini de ortaya çıkardı Koyan Denizaşan, 2017 yılında ikinci el otomobil pazarında yüzde 15'e yakın büyüme beklediklerini belirterek "ÖTV düzenlemesi ve döviz kurlarının yükselmesi için sıfır otomobil fiyatlarına yansıyacak artış, 2017'de daha bariz görülecek. 2016 yılının son aylarında markalar çeşitli kampanyalar ile bu sanatı yansıtmadılar ve talebin öne çekilmesini sağladılar. Ancak 2017 model fiyatların artırılması birlikte pazara sunuluyor. Bu nedenle ikinci el otomobil pazarının daha cazip hale gelecek. 2014 yılında ikinci el otomobil pazarı yüzde 15'in üzerinde büyütülebilir "dedi.

Bu yazı, Kaynak

Devamını Oku »

Opel'in GM ile olan ilişkisi yıllarca çalkantılı bir hale geldi

Opel'in Amiral gibi lüks modelleri BMW'nin sunduğu ürünlerle yarıştı. Gösterilen Amiral B, 1969'dan 1977'ye kadar inşa edilmiştir. Fotoğraf kredi: Opel PSA Group'un Pazartesi günü ilan edilmesi beklenen Opel'i satın alması, General Motors'un yaklaşık 90 yıllık mülkiyet süresinin sona ereceği şekilde daha da çalkantılı ve acımasız hale gelmesini sona erdiriyor. Aslen Adam Opel tarafından dikiş makineleri inşa etmek üzere kurulan oğulları …

Devamını Oku »

Araştırmacılar, koloidal küreleri kendi kendine birleştirmek için koaksiyel hale getiriyorlar …

                                                                                                          Süper küreler, yeşil ile gösterilen bir elmas ve kırmızı ile gösterilen diğer piroklore olmak üzere iki iç içe geçmiş alt bölümden oluşur. Önceden oluşturulmuş kırmızı tetrahedral kümeler ve yeşil küreler, MgCu2 süper-kafese içine kendiliğinden yerleşirler. Kredi: NYU Tandon Mühendislik Fakültesi     Gıdalar, mürekkepler, boyalar ve kozmetik dahil olmak üzere bir dizi teknik uygulamada kullanılan koloidal …

Devamını Oku »

Nürnberg Tatil İçin | Gezipgordum.com Roma Cermen İmparatorluğu döneminde maliyede, sanayi devriminden Nınnı öne dayanan kenti Nürnberg gezilecek yerler söz konusu olduğunda zengin içeriği, kısa sürede gezginlerin sıkılmasına asla izin vermiyor. Çünkü Gotik mimarisiyle birlikte tanımını büyüleyen kentte; Nürnberg İpucu Konum Listesi ] Yer yer yakınlığı nedeniyle Nürnberg 'de 用iş alanında öne çıkan bölge Eski Şehir . Ayrıca şehrin toplu taşıma sistemi gelişmekte olan şehir içi ulaşım oldukça kolay hale geliyor. Otel için inceleme ve rezervasyon yaptırmak için tıklayınız. 1. Kaiserburg Kalesi

Devamını Oku »

PD1'in kristal yapısı, Haemophilus yüzey fibrili (Hsf) olağandışı büyük bir üçlü ototransporterdir En öldürücü soylar H tarafından eksprese edilen yapışkan (TAA). Influenzae . Hsf'nin patojen ve konukçu arasındaki yapışmaya aracılık ettiği bilinmektedir ve epiglotit, menenjit ve pnömoni gibi potansiyel olarak ölümcül hastalıkların kurulmasına izin verir. Yakın tarihli araştırmalar bu TAA'nın yeni bir 'saç tokası benzeri' bir mimari oluşturabileceğini önermekle birlikte, yüksek özünürlüklü yapısal veriler bulunmayan Hsf'nin karakterizasyonu silico modelleme ve elektron mikrograflarında ile sınırlı olmuştur. Burada, Hsf varsayımsal alan 1 (PD1) 'in kristal yapısı 3.3 Â çözünürlükte bildirilmektedir. Yapı, beklenmedik bir N-terminal TrpRing alanının mevcudiyetini açığa vurarak önceki alan açıklamasını düzeltir. PD1, çözülecek olan ilk Hsf alanını temsil eder ve böylece 'saç tokası benzeri' hipotez üzerine daha fazla araştırma yapılmasını sağlar. Anahtar Kelimeler: Hsf varsayımsal alan adı 1, trimerik ototransporter, Haemophilus influenzae adezin, hücre adhezyonu, Haemophilus yüzey fibril 1. Giriş Haemophilus influenzae üst solunum yolu enfeksiyonlarına, pnömoniye ve akut menenjit (Danovaro-Holliday ve ark. 2008 ; Murphy'ye bağlı enfeksiyonlara neden olan Gram negatif fakültatif anaerobik bir bakteridir ve diğerleri 2009 ). Farklı suşları H. Influenzae ya a-f serotiplerine, ikincisine de tipik olmayan olarak tanımlanan (Barenkamp ve St Geme, 1996 ) alt bölümlere ayrılmış şekilde kapsüllenmiş ya da kapsül içine alınmamıştır. H. Influenzae enfeksiyon, birçok pilus ve nonpilus yapışkan faktörlerin aracılık ettiği bir süreçte patojenin konak epitel hücresi astarlarına ve çeşitli ekstraselüler matriks (ECM) proteinlerine ( örneğin vitronektin) yapışmasıyla kurulur (Cotter ve diğerleri 2005 Virkola ve diğerleri 2000 ; Hallström ve diğerleri 2006 ). Yapışma, bakterinin konakçı tarafından temizlenmesini önlemesine izin verir ve sayısız virulans mekanizmaları yoluyla derin yerleşimli bir enfeksiyonun kurulmasını kolaylaştırır . Tüm suşları H. Influenzae patojeniktir, 1990'lı yıllarda etkili bir aşı kullanımına başlamadan önce hastanın morbidite ve mortalitesinin en yüksek oranlarından sorumlu olan virülan tip b (Hib) 'dir. Hib tarafından kullanılan böyle bir virülans faktörü, daha iyi karakterize edilmiş bir başka H ile önemli homoloji paylaşan bir trimerik ototransporter adhesin (TAA) proteini olan Haemophilus yüzey sarmalı (Hsf) dir. Influenzae ve diğerleri ve diğerleri 2015 (19459019). TAA'lar olarak bilinen HIA (Cotter ve ark. Salgılanan proteinlerin tip V ailesinin bir parçası olan, doğrusal bir fibril 'lollipop' yapısında düzenlenmiş üç ana alan türüne sahiptir. Baş ve küre alanları, hücre dışı bölgede N-terminüsünden serpiştirilir. YadA benzeri (YIhead) alanlar (Nummelin ve ark. 2004 gibi) ya çapraz mimarilere sahip β-tabakalardan oluşan ön alanlar ya da Triptofan halkası (TrpRing) alanları (Szczesny ve diğerleri 2008 (19459019)), tipik olarak proteinlerin yapışkan aktivitesine aracılık etmektedir. Sap, süper sargının derecesine ve yönüne (Hernandez Alvarez ve ark. 2010 ) bağlı olarak hepartan'tan pentadecad'a değişen periyodik üçlü üç boyutlu sargılı bir yapı oluşturur. Son olarak, C-terminal translokatör alanı, her bir altbirim bir amfipatik alfa-helis artı dört β-tabakaya katkıda bulunan bir trimerik β-namludur (Meng ve ark. 2008 ). Bu alan, proteinin geri kalan kısmının zar yoluyla translokasyonundan sorumludur ve tüm TAA'larda bulunur (Lehr ve diğerleri 2010 ). Son zamanlarda yapılan araştırmalar, Hsf'nin EM görüntülerine dayanan görünüşte yeni bir 'saç tokası benzeri' yapıya sahip olduğunu öne sürdü ( Singh ve diğerleri 2015 ). Paylaşılan bölgelerinde, Hia ve Hsf'nin% 72 sekans özdeşliği vardır (Hia161-1098 ve Hsf1484-2413, Ek Şekil S1), ancak tam uzunlukta trimerik Hsf (~ 750 kDa), Hia'nın (~ 340) iki katından daha büyüktür KDa). Hia'nın iki bağlayıcı alanı (HiaBD1 ve HiaBD2) de Hsf'de tanımlanmıştır (Laarmann ve diğerleri 2002 ); Bununla birlikte, Hia'nın aksine, Hsf'nin ek bir bağlanma alanı (HsfBD3) ve üç varsayımsal alanı vardır, yapısı ve fonksiyonu bilinmemektedir. Dahası, Hsf'nin alanlarını modellemeye yönelik sınırlı bir in silico yaklaşımı, ~ 200 nm'lik doğrusal bir TAA olmasının muhtemel olduğunu ortaya koymuştur (Singh ve diğerleri 2015 ). Buna rağmen, Hsf'nin elektron mikrografları H'de ifade edildi. Influenzae RM804 Hsf'yi doğrusal bir TAA olarak değil çift katlı bir saç tokası halkası yapısı olarak göstermiş görünüyor. Alan dizilişinin haritalanması, Hsf'nin N-ucunun zarın yakınında bulunması ve 'kıl tokası benzeri' hipotez ile tutarlı olmasını önerdi. Yapışkan işlevine ek olarak, Hsf'nin bağlandığı gösterildi. Kompleman inhibitörü vitronektin (Vn): etkileşim, HsfBD2 ve C-terminali Vn kalıntıları 352-374 ile eşleştirilmiştir (Hallström ve diğerleri 2006 ; Singh ve ark. 2014 ). Hem serumda hem de ECM'de bulunan bu glikoproteinin kazanılması, H'yi sağlar. Influenzae kompleman sisteminden kaçınmak ve epitelyal yüzeye daha iyi yapışmak suretiyle bakteri virülansını arttırmaktır. Bu kısmen Hia'nın aksine Hsf'nin en öldürücü, tiplendirilebilir H suşlarında ifade edildiğini açıklayabilir. Influenzae . Burada, bir Hsf varsayımsal alanının (PD1) kristal yapısını bildiriyoruz. Bu yapı, PD1, N-TrpRing: KG: TrpRing-C için yeni bir alan düzenlemesi ortaya çıkarır ve bu nedenle daha önce silico dizi analizi ile tanımlanan alan mimarisinin yerini alır. Bu çalışma, bu TAA'nın varsayımsallaştırılmış yeni 'saç tokası benzeri' yapıyı (Singh ve ark. 2015 kabul ettiği) belirlemek için Hsf'nin tam uzunluklu yapısını belirlemek için sürekli bir çaba oluşturmaktadır. 2. Gereçler ve yöntemler 2.1. Makromolekül üretimi 2.1.1. PD1-GCN4 Hsf alanı PD1, iki GCN4 bağlantı proteini arasında klonlandı. GCN4, doğal haliyle sargı bobini dimerini oluşturan iyi tanımlanmış bir maya transkripsiyon faktörüdür. Bununla birlikte, hidrofobik çekirdeğindeki spesifik kalıntıların mutajenezi GCN4'ün çeşitli oligomerik durumları benimsemesine olanak tanır. Bu nedenle, kararlı oligomerizasyonu kolaylaştırmak için füzyon proteinleri için ortak olarak GCN4 varyasyonları sıklıkla kullanılır. Bu durumda, fikir, HsfPD1'in dengeli trimerleşmesini kolaylaştırmak için hem N- hem de C-terminusuna iyi karakterize edilmiş trimer oluşturan bir GCN4 varyantı eklemek olmuştur (Hernandez Alvarez ve diğerleri 2008 (Hartmann ve diğerleri 2012 Koiwai ve diğerleri 2016 ) Lupas grubunun başarıyla kullandığı gibi. Bu füzyon proteini, PD1-GCN4, restriksiyonsuz (RF) klonlama kullanılarak üretilen bir pIBA-PD1-GCN4tri-His 6 plazmidinden eksprese edildi. PD1 geni, bir pET-16b- hsf polimeraz zincir reaksiyonu ile, 1-2414 plazmid. Primerler, hedef vektör olan pIBA-GCN4tri-His 6 (19459034) (Tamamlayıcı Tablo S1) tamamlayıcı çıkıntıları olan PD1 genini içeren bir 'megaprimer' üretmek üzere tasarlandı. 6 XhoI (New England Biolabs) ile restriksiyon sindirimi ile lineer hale getirildi ve PD1 genini (bunun içinde bulunan PIBA-GCN4tri-His 'Megaprimer') plasmid içine sokun. PD1-GCN4 ekspresyonu, 4 saat süreyle 8.6 μl M nihai konsantrasyona bir anhidrotetrasiklin hidroklorürün eklenmesiyle 0.6 OD 600 de indüklendi. Hücreler 193 K'de gece boyunca saklanan santrifüjleme (2000 g ile 10 dakika süreyle 277 K'de) ile toplanmış ve 50 m M 'den oluşan tampon [NaH 4 500 m NaCl, pH 8.0, 500 m . Hücreler sonikasyon ile parçalanmış ve süpernatanlar santrifüjleme (1600 g ile 10 dakika 277 K'de) ile toplanmıştır. Protein, immobilize metal iyon-afinite kromatografisi (IMAC) ile saflaştırıldı. PD1-GCN4 ihtiva eden temizlenen süpernatant, daha önce tampon A (2 x 6 ml; üç kolon hacmi) ile dengelenen bir Ni-NTA agaroz sütunu (GE Healthcare) üzerine tatbik edildi ve ajitasyon ile 1 saat süreyle bağlanmasına izin verildi. Proteinler, 50 m

NaH [500.04] NaCl'den oluşan tampon B ,% 10 gliserol, 300 m imidazol pH 8.0. Saflaştırılmış proteinin kalitesi, çok açılı bir lazer ışığı saçan (SEC-MALLS) aparatına (Şekil 1) bağlanan boyut uzaklaştırma kromatografisiyle değerlendirildi a ). SEC-MALLS, 50 m'lik Tris, 500 mM'lik NaCl, 50 mM Tris, 1 mM NaCl ve 1 mM NaCl'den oluşan tampon C ile dengelenmiş bir Superdex 200 5/150 …

Devamını Oku »

Dünyanın En Güzel 10 Plajı Deniz, güneş, kum, sörf, hepsi bu plajda bulunur. Ama sizce o da sizce dağılsın mı güzel midir? Okyanuslar, denizler, göller yönünden zenginleşiyorlar. Güzel plajlar ve daha seçkin hale gelmektedir. İşte National Geographic'e dünyanın en güzel 10 plajı : 1. Playa del Amor, Marietas Adaları, Meksika

" "" Saklı Plaj "olarak isimlendirilen Playa del Amor, güneş ve gökyüzünden denize ayıran halka biçimli bir kaya ile bir doğa harikası. Burada bulunan [19459009 2. Anse Kaynak d'Argent, La Digue, Şeyseller.

Devamını Oku »