17 Aralık 2017,Pazar
Anasayfa » Tag Archives: Hâlâ

Tag Archives: Hâlâ

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Akıllı otoyollarda acil durum sığınma alanları hala sürücülerin gizemi

İngiltere'deki 'akıllı' otoyol sayısındaki artış, yeni rakamların sürücülerden yarısından azının nerelerde Acil durumlarda emniyetli bir şekilde çekin. RAC'den yeni rakamlar, acil bir sığınma alanının akıllı bir otoyolda olduğunu sürücülerin% 52'sinin bilmediğini göstermektedir. Karayolları İngiltere halihazırda mevcut otoyolları tıkanıklığı azaltmak ve seyahat sürelerini azaltmak için sert bir omurgayı ilave bir şerit ile değiştiren 'akıllı' otoyollara dönüştürmekle meşgul olmakla birlikte rakamlar, sürücü …

Devamını Oku »

Ben tarihli bir erkekle hala en iyi arkadaşım ve ben …

Tanrı ve Adam "Sizin için iyi değil" Bunu hayatımı yaşayan deneyimlerden öğrenmelisiniz. Oh bekle … "Zehirlidir" Teşekkür ederim, ama bu yeryüzünden parçalanacak kadar yararlı psikoanaliz için teşekkürler. "Gerçekten bunda iyi mısın?" Benimle tanıştın mı? Ben kimsenin kurbanı değilim. "Bunu asla yapamadım." Benimle ilgili komik olan şey senin olduğumun beni ilgilendirmediği. Tamam, anı sıkıştığımda oyun oynamak her zaman keskin değil – …

Devamını Oku »

Tüccar, Teksas eyaletindeki Kanton üzerinden gözyaşları dökülen anahtar ve arabaları hala arıyor ve arıyor Bayi

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Bir kasırganın yeni bayiliğini moloz haline getirmesinden birkaç gün sonra, Randall Noe ve I20 Chrysler-Dodge-Jeep-Ram'daki işçileri hala çok sayıda 275 otomobilin anahtarlarını arıyordu. ] Heck, hala arabalar arıyorlardı. "Orada bir gölet var," Genel Müdür, Scott Fitzgerald bayinin bir ucundaki çimenli bir alana işaret ettiğini söyledi. Noe, kot pantolon …

Devamını Oku »

Neden Chevy'nin 'Gerçek Kişiler' reklamları hala yayınlanıyor

"En kötü ihtimalle, teknoloji çok karmaşık ve hantal olabilir, en iyisi tüketicilerin hayatlarını basitleştirebilir." Paul Edwards Markanın ABD pazarlama başkan yardımcısı Paul Edwards, Chevrolet'in çok yönlü "Gerçek Kişiler değil Aktörler Değil" kampanyası iki yaşındasınız ancak hala çok sayıda hayat kaldığını söylüyor. Reklamlar gerçek insanlar kullanma konseptinde eğlenceli taklit eden taklitçilere ilham kaynağı olmasına rağmen, Chevy onlarla yapışıyor. Chevy'nin Malibu'nun teknolojisini …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

Galaxy S7 serisi hala popüler!

Galaxy S7 Galaxy S7 kenarı akıllı telefonlar hala başarılı bir satış grafiği çiziyor Yeni bir araştırmaya göre, 2016 yılının amiral gemileri . Peki, çıkan çıkan oğlu rakamlar ne oluyor? Samsung Galaxy S7 serisi 55 milyonu geçti! Pazar araştırma şirketi Stratejik Analiz Samsung Galaxy S7 serisinin toplamdaki satışına bu yılın ilk çeyreği öndeıyla 55 milyonu geçtiğini açıkladı. Akıllı telefonlar, bu yılın …

Devamını Oku »

Mink Mingle Sevdiğim birisi derinden beni çağırıyor. Kalbi kırıldığını söylüyor, bana geri kazanmaya çalıştığını söylüyor, ona ihtiyacı olan şeyi, nasıl güvenini kazanabileceğini, doğru şeyleri yapmak için neler yapabileceğini soruyor. Dinliyorum. Ona değerini hatırlatırım. Ve sonra sinirlenirim. Çünkü yardım edemem ama neden bu adamın bir milyon ve bir şeyi denemediğini merak ediyorum. Neden çiçeklerini almadı? Her sabah ve her gece ve hatta gün boyunca onu neden düşünüyor olduğunu göstermek için neden ona mesaj atmadı? Neden ona bir mektup yazmadığı ya da onu yemeğe götürmediği ya da en sevdiği şeker çubuğunu alıp çantasına sokmadığı ya da bir rölyefle rengarenk bir battaniye üzerinde sergileneceğini sorup durmadığını sordu. yıldızlar? Yoksa onu tekrar tekrar hatırlattı, nasıl berbat ettiğini ve onu kaybetmek istemediğini mi? Dinlediğimde, onu geri getirmek için sahip olabileceği bir milyon ve bir fırsattan geçtim, onun endişeli zihnini hafiflettiği söylenebilecek tüm sözleri, ona göstermek için yapabileceği tüm küçük şeyler Önemli olan, katlanarak, ona. Ağlıyor Diye bağırıyor bağırıyor. Neye ihtiyacı olduğunu söyledi, bana neden korktuğunu, nasıl incildiğini, kalbinin güvensizlikten ve kırılmasından nasıl acı çektiğini ve hiçbir şey yapmadığını söylediğini söyledi. Ona sadece ona ihtiyacı olan şeyi gösterebileceğini, kendisini sevmenin yollarını söyleyebileceğini istiyor olduğunu söyledi. Yardım edemem ama bunun yanlış olduğunu düşünüyorum. Çünkü bu adama onu nasıl seveceğini söylemek zorunda kalmamalı, işleri doğru yapmalı. Ona nasıl zarar verdiğini görmesine izin vermemeli, kırık olanı nasıl düzeltebileceğini ona göstermeliydi. Hiçbir şeyi açıklamak zorunda kalmamalı, çünkü onu sevilen biri olarak zaten biliyor olmalıydı. Sözünü dinlerken, kendi ilişkilerimi düşünüyorum. İlk aşkım olduğu için bana nasıl bakacağından emin olmadığı için ya da çok duygusal olduğum için, güvenime ne kazandığından emin olmadığı için ya da benim güvenimi kazandığımdan emin olmadığına inandığım insanlardan bahsediyorum. Hassas ve inatçı olduğum için sevmeyi zorladım. Mazeretlerim var. Aklıma getirdim. Sorun olduğunu düşündüm. Ben, çok fazla kaleyi seven, o adamların beni nasıl seveceğini bilmediğini sanıyordum. Fakat birileri seni seviyorsa seni seveceklerdir. İhtiyacınız olan her şekilde sizi seveceklerdir. Nasıl yapacaklarını bildikleri her şekilde seveceklerdir. Seni sevecekler ve bu sevgiyi defalarca kanıtlayacaklar, çünkü seni kaybetmek istemiyorlar. Gerçek aşk bu. Hepimiz kusuruz, ama birisi gerçekten mahvederse, onu doğru yapmak için her şeyi yapıyor olacaklar. Beklentileri çok yüksek tuttuğunuza inanmak için sizi suçlamaya çalışmazlar. Senaryoyu ters çevirmezler ve sadece zaman çizelgesinde onları bağışlamadığınız için yanıltıcı olanınız gibi davranırlar. Onları kol uzunluğunda tutmak için kendinizi kötü hissettirmezler, çünkü hala inciniyorsunuz. İhtiyacınız olduğunu düşündükleri ya da ne istediklerini algılarlarıyla eşleşmediğinden, ihtiyacınız olan şeyi görmezden gelmeyeceklerdir. Sorunlar olduğunda bir arka koltuk almayacaklar ve onlarla nasıl başa çıkılacağına dair ipucu olmayacak. Bakın, biri sizi sevdiğinde ne yapılacağı söylenemez. Nasýl bakým, nasýl hazineden geçirileceði, kayıp zamanın veya bencil eylemlerin telafi edileceği konularında söylenecekleri yoktur. Seni öpmek, nasıl tutmak, özür dilemek ya da takdir etmek ya da istediğini hissettirmek gibi neden söylenmesi gerekmiyor. Seni seven biri seni gerçekten seviyor, seni düzeltmek için elinden geleni yapıyorlar, ne yaparsan yap, elinden geleni yapabileceklerinden emin olman için elinden geleni yapıyorlar. Sana neye ihtiyaç duyduğunu özel olarak anlatmamalarını istiyorlar. Adım adım açıklamanı beklemeyecekler. Hayır, her zaman doğru yolu bulamıyor olabilirler, ancak

deneyebilirler

Devamını Oku »

Anksiyete beni hala küçük bir çocuk gibi hissettiriyor

Tanrı ve Adam Yalnız başıma gitmek istemiyorum . Bir partiye davet edildim, orada bir arkadaşıyla birlikte olmak istiyorum, bu yüzden tek başıma yürümek zorunda değilim. Bir köpek gibi takip edebileceğim birini istiyorum, biraz daha rahat hissetmemi sağlayacak birini. Tek başına herhangi bir yere gitmek – özellikle daha önce hiç ziyaret etmediğim yeni bir yer – bana korkunç geliyor. Açıkçası, her …

Devamını Oku »

AAA Çalışması: Düşük Gaz Fiyatlarına rağmen Tüketiciler hala EV'lerden İlgileniyor

AAA, EV'lerin güçlü geleceğini öngörüyor Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi …

Devamını Oku »

Yine Dayalı Yine Göre Neden hala Sabit değilsiniz …

Jesse Herzog Çünkü etrafında dolaşarak kimsenin hayatını iyileştirmenin bir yolunu bulursunuz. En yaşlı çocuklar düzelticidir. Yardımcı olamayan ancak iyileştirme yapılabilecek yerleri görmek ve her şeyi kolaylaştırmak, her şey daha pürüzsüz, daha iyi herşey yapmak için girebilecek tür insanlar. Yaşlı bir çocukken, bu kaçınılmaz olarak partner hayatınıza dalmaktadır. Eşinizin hayatını kolaylaştırmak için doğuştan gelen bir yeteneğiniz var … daha iyi. O …

Devamını Oku »

Merak etmeyin, Shelby GT350 veya GT350R'yi Hala Satın Alın »AutoGuide.com News

Ford, yasal olarak üretilmiş en iyi yolu Mustang'ın ürettiği 2018 model yılı için ilan edecek. Duyuru Ulusal Mustang Günü şerefine geliyor ve 2018 Ford Shelby GT350 ve GT350R Mustang showroom'larda bu sonbaharda başlayacak. Yeni modeller 2017 model yılından değişmeyecek, ancak Ford üç yeni dış renk seçeneği ekliyor: Orange Fury, Kona Blue ve Lead Foot Grey. Bu, spor otomobilin 526 beygir …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

Hatta w sürüş sırasında metin için hala kötü bir fikir …

                                                                                                          Kredi: Steffen Thoma / Public Domain      Sürücüler, seyircilerin yanında gezinirken veya diğer insanlarla iletişim kurarken ikincil görevlerini yerine getirirler; bu da dikkati dağılmış sürüşe atfedilen yaralanma ve ölüm sayısını önemli ölçüde artırmıştır. Giyilebilir teknolojideki gelişmeler, özellikle de ses kontrolü ve ekran görüntüsü (HUD) işlevleri bulunan Google Glass gibi cihazlar, bu cihazların araçlarda kullanıldığında …

Devamını Oku »

(19459000) Noah Hinton Baştan başlamak güzelliği, baştan başlamanın güzelliğidir. Geçmişte kim olduğunuzu bırakın.Seni tuttuğunuz şeyin elinden vazgeçersiniz ve sıkıştığınızı düşündüğünüzde sizi ya da yanlış kişiyi yanlış yere düşüren sizi aşağılayan tüm şeyleri bırakın. Baştan başlamak güzelliği, 'u seçmenize neden oluyor. Kimsenin olmaması gerektiğini ve bunu nasıl yapman gerektiğini söylemeden bu sefer olmak istediğin kişiyi seçeceksin. Yaşam farklı şekilde yaşamak için yeni bir şans verildi. Hayatı farklı bir renk renkte görmek için yeni bir objektif verildi ve kendinizi düzeltmek ve kendiniz kurmak için bir şans daha verdiniz; her zaman istediklerinize bir adım daha yaklaşın. Olmak Başlamak güzelliği, sonları kutlamaları bulmanıza yardımcı olması. Hoşunuza giden veda ve korkunun öbür tarafında yatan şey, konfor bölgesin ötesinde büyü ve hayat arayan hayat, aramaya karar verdiğinde size sunmak zorundadır. Farklı bir yola çıkmaya karar verdiğinizde, sizi korkutan bir şey yaptığınızda ve sizi tuttuğunuz bir şeyi veya bir şeyi bıraktığınızda – ne kadar acıyor olursa olsun, ne kadar önemsiyorsanız edin, bazen uçmanız gerektiği zaman geri çekilirler ve bazen kükreme vasıtasıyla sesinizi susturdular. Baştan başlamak güzelliği, her zaman yerleşmek zorunda kalmadığınızı öğreneceksin. Her zaman üzgün ya da incinmeden kalmanız gerekmez. Baştan başlayabilirsin ve hâlâ gurur duyduğun bir hayatla, sizi heyecanlandıran bir hayatla ilham veren

bir hayat yaşayabilirsiniz. Tekrar başlayabilirsiniz. İşi bitirip tekrar başlayabilirsiniz . Üzerinde başlama güzelliği, herhangi bir kuralının bulunmaması, el kitabına uymanızın gerekmemesi. Kendin yap. Ateşleri çağırırsın. Kimsenin kalemi tutmadan veya dikte etmeden kendi yeni başlangıcını yazacaksın. Rania Naim, burada mevcut olan yeni kitabın Söylenmesi Gereken Tüm Sözcüklerin bir şairi ve yazarıymış . Tüm kelimeleri-ben-söyledim-kompozit-promosyon "width =" 786 "height =" 524 "/> …

Devamını Oku »

Bazı bayiler için gazeteler hala yayınlanıyor

       Bob Mann, bir müşterinin yakın bir tarihte hastaneden doğrudan arabasına binip bir araba aldığını söyledi. Mann bayii için bir reklam içeren bir gazeteyi gördüğünde, müşteri eşi test ederken bekleme odasında oturuyordu. Calil, Gil-roy'deki South County Chrysler-Dodge-Jeep-Ram'daki yönetici ortağı Mann, "Kendiliğinden ve öngörülemeyen satış gerçekleşiyor" diye belirtti. Mağazası, her şeyin merkezi olan Silikon Vadisi'nden kabaca yarım saat uzaklıkta olmasına rağmen …

Devamını Oku »

Gerçek Kuzey: Otomobil Üreticileri hala Elektrifikasyonda Bahis Yapıyor – Büyük Resim

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Yeni iPhone ile Trump hâlâ bilgisayar korsanları için hedef

                                                                                                          Mobil cihazlar, bir saldırganın telefonun mikrofonuyla dinlemesine, kameraya erişmesine, coğrafi konumunu izlemesine veya hatta ahizeyi uzaktan devralmasına izin vermek için saldırıya uğramış olabilir      Başkan Donald Trump yeni bir telefona sahip. Bir iPhone.                                                                                 Bu normalde habercilik değil, ancak verimli Beyaz Saray tizeterinde saldırı tehditleriyle ilgili güvenlik endişeleri göz önüne alındığında, vardiya …

Devamını Oku »

Volkswagen Golf R: Hala Kalan Halo Otomobillerini Sürüklemenin Keyfini Çıkarın

Volkswagen Golf'un beş yaşındaki halo modelinin 2017 versiyonu olan Golf R, bir sürücü otomobilidir ancak sadece 25 kilometre uzaklığa ulaşır. Galon, bu yüzden özellikle "sürdürülebilir" hiçbir şey yok. Çok büyük değil, bu yüzden içinde pek çok şey taşıyamazsın. Ancak sürmek kesinlikle eğlenceli. Kaynak

Devamını Oku »

'VW'yi kurtarmak hala mpg üzerinde daha açık olmalı'

Volkswagen Group, son iki yıl içinde değirmenden geçti ancak geçen hafta düzenlediği basın toplantısında bildirdiği üzere, 10.3 2016'da milyon araba, Dieselgate'den sonra geri döndüğünü gösteriyor. VW yönetim kurulu, firmanın muhteşem kurtarma konusundaki tebriklerini teyit ederken seyirci içindeydim – ancak skandal tasarısı şu an neredeyse 20 milyon avroya ulaştı (ve sayım yapıyor) hala birazcık acıyor olmalıydı. Takım elbiseli erkeklerin sorularını yanıtladığı …

Devamını Oku »

Daha Büyük Bir Dört Kollu McLaren Hala Üzerinde »AutoGuide.com News

Dört kişilik McLaren spor otomobilini henüz ekarte etme. McLaren'i çevreleyen vınlamaların çoğu yeni 720S modelinin başlangıcını içeriyor, ancak şirket gelecekteki modelleri için karbon fiber küveler inşa etmek için İngiltere'de yeni bir fabrika açacağını da açıkladı. Bu yeni bir supercar kadar ilginç olmayabilir, ancak marka diğer otomobil üreticileri gibi ölçeklenebilir bir mimariye dönüştüğü için gelecekteki McLaren modelleri için farklı boyutlara uyum …

Devamını Oku »

AAA Çalışması: Çoğu Sürücü Hâla Kendinden Tahrikli Araçlardan Korktuğu

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GDC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Endüstrinin rekor seviyesi hala ayaklıdır

       Geçmişteki otomobil endüstrisi için toksik bir kombinasyon olan büyük indirimler ve yüksek stoklar, bugün daha az tehlike oluşturuyor; çünkü sağlıklı bir ekonomi, ABD satışlarını rekor hızda tutuyor, analistler söylüyor. Şubat, endüstri için artan tüketici güveninin ve hisse senedi piyasalarında uzun süren kazançların artması nedeniyle, yıllık aralıksız satış oranının ikinci bir ayda 17.57 milyon seviyesinde kalmasına yardımcı olan Ocak ayının …

Devamını Oku »

Hâlâ güçlü gidiyor: İngiltere'nin en eski garajını ziyaret ediyoruz

1909'dan beri pek az işletme var. Bir ya da iki saatçi, bazı otomobil markaları ve birkaç banka belki ama garaj kadar küçük bir şey mi? Kesinlikle hayır. İnan iyi olur. Nitekim, Greater London, Chislehurst'teki Western Motor Works, yüzyılı aşkın süredir kapılarını açık tutmakla kalmadı, aynı zamanda İngiltere'nin ilk amaca uygun araç garajıydı ve aynı binadan hala çalışıyor. Şu anda Vauxhall'a …

Devamını Oku »

Jaguar XJR-15 hala bugün etkilemektedir

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Jaguar XJR-15'i hatırlamıyorsanız endişelenmeyin. Çoğu insan bilmiyor. Yaklaşık 53 otomobilin sınırlı kullanımı, çoğu yerinde İngiltere'de yaşayan, durumunu kıt hale getirmiştir. Reddit kullanıcısının, XJ220'nin dikkat çeken şeylerin çoğunu aldığı düşüncesiyle otomobilin varlığına şaşkınlık yaratması şaşırtıcı değil. Araba geçmişi büyüleyici. XJR-9 ve XJR-12 yarış arabalarından teknoloji kullanarak geliştirilen XJR-15, 6.0 …

Devamını Oku »

£ 120m aşağı, UK.gov hala çok uzun bir yol olduğunu buluyor …

                                  Birçok olağanüstü mülkiyete sahip olan Graphene, İngiltere hükümetinin fonlarında £ 120m civarında yuttu ancak gelişme ve ticaret dünyası, işkenceyle yavaş yavaş hayal kırıklığı yaşıyor.                  Geçen yılın ilerleyen aşamasında, ilerleme eksikliği olan milletvekilleri, ilgili konuyu Avam Kamarası Bilim ve Teknoloji Komitesi aracılığıyla bir dizi duruşma yaptıklarından endişeliler.                                                    Milletvekilleri üç endişeli figürle karşılaştı: Baroness Neville-Rolfe, Enerji …

Devamını Oku »

Araştırma, sandığın hala en iyi öngörücüsü olduğuna işaret ediyor …

                                                                                                          Kredi: Karen Arnold / public domain      Donald Trump'in Birleşik Devletler başkanı olarak şaşırtıcı seçimi, bazı insanlar tarafından, seçim yoklamasının artık çalışmadığına dair kanıt olarak görülüyordu, ancak araştırmacılar, küresel yoklama verilerini kullanarak doğru tahmin edebilecek modeller geliştirdiklerini bildiriyorlar Seçim sonuçlarının yüzde 90'ı dünya çapında.                                                                                 [2] [2] [2] [2] Bilim dergisinde yayınlanan …

Devamını Oku »

Global Motors: Otomobil İşi İçin İyi. Amerika için hala iyi mi?

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin, Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Hâlâ Yarımadayla Tanışabiliriz ve Başlayabiliriz

Hâlâ boş bir yolun ortasında rasgele bir gün buluşabilmeyi umuyorum, çünkü ikimiz de farklı yönlere yöneliyoruz ve duruyoruz Bir süre birbirleriyle konuşmak; Belki de ilk tanıştığımız gibi kahve almaya gidebiliriz ya da belki sadece şehirde dolaşabiliriz, o zaman senin mahallemini gösterdin ve birkaç saat konuştuk. Hâlâ elimizdeki son konuşmayı hatırladığınızı hatırlıyorsunuz, bu yüzden onun hakkında konuşmaya devam edebiliriz, bu yüzden …

Devamını Oku »