22 Ağustos 2017,Salı
Anasayfa » Tag Archives: en

Tag Archives: en

1 Ağustos 2017 Salı – 2 Ağustos 2017 Çarşamba Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

67 Zonguldak Nöbetçi Eczaneler Bir önceki yazımız olan 1 Ağustos 2017 Çalşamba Zonguldak Nöbetçi Eczaneler başlıklı makalemizde 1 Ağustos 2017 Salı nöbetçi eczane, 1 Ağustos 2017 Salı Zonguldak nöbetçi eczane ve bugün Zonguldak nöbetçi eczaneler hakkında bilgi veriyoruz. Onun günleri güncel ve kesin bilgiyi vererek sizlere nöbetçi eczanelerin nerede olduğunu belirtiyoruz.Mobil uyumlu web sitemizden arama motorunu kullanma noktasında nöbetçi eczane …

Devamını Oku »

Boffins, en mükemmel ic için dünya rekoru kırdı …

                                                   Şu anda dünyanın herhangi bir yerindeki Pimms O 'Saati                                                                                                                        Bilim kurgu … Aslında süper buz, içeceklerde fazla bir şey değildir. Oh iyi                                                Uluslararası bir kimyager ekibi mükemmel küp buz kristallerinin hazırlanması için yeni rekorlar kırdı. Ne yazık ki, buz küpleri çok küçüktür, çıplak gözle görünmezdirler.                  Bu, …

Devamını Oku »

Ücretsiz VPN hizmetleri (2017) En iyiler!

Ücretsiz VPN nereye bakacağınızı bilmiyorsanız sizin için için sıkıntı verici bir süre haline gelebilir. Bu liste ile birlikte ücretsiz VPN Hizmetlerimiz için en iyi olanları sizler için seçiyoruz. İnternet sağlayıcınız girmek istediğiniz sitelere izin vermiyorsa veya internette dolaşırken takip edilmek istemiyorsanız bir göz atın deriz. En iyi ücretsiz VPN servisleri 2017 2017 yıl için hazırlanmıştırğımız bu bölümle birlikte özel tarayıcı …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Paris Moda Haftasından En Güzel Saç Modelleri

Paris Moda Haftası'nın derleğinde saç trendleri öne çıktı. 1- Gösterişli Fiyonklar Kıvırcık ve hacimli saçları renkli fiyonklar tamamlıyor! Kendal'ın görüntüsünü yakalamak için vigo ve köpük ile saçlarını şekillendirip fiyonk ve yarı toplu model verin. paris couture moda haftasının en trend saç modelleri "width =" 480 "height =" 650 "/> en trend saç modelleri 2- Kıvırcık Saçlar Tamronların Bir Oyunu Jon …

Devamını Oku »

İşte 2017'in en iyi drone fotoğrafları!

Drone fotoğrafçılığı son ​​dönem havadan görüntüleme nin vazgeçilmezi haline gelmiş durumda. Bu fotoğrafçılık türüne göre çok sayıda topluluk varken, en prestijlilerden birisi olarak Dronestagram kabul ediliyor. Dronestagram son olarak, 4. Geleneksel Uluslararası Drone Fotoğrafçılığı Yarışması 'nın kazananlarını açıkladı. İşte huzurlarınızda 2017 yılının doğa insan kent ve yaratıcılık kategorilerindeki en iyi drone fotoğrafları !

Devamını Oku »

En hızlı uluslar arası sahip 5 ülke!

İnternet çağımızda en büyük gereksinimlerinden birisi halini almışken, internet erişimi yok veya çok kısıtlı. Fakat bazı ülkeler internet hızlarıyla dünyanın en iyisi olmayı başarmışlar. Bağımsız bir araştırma şirketi tarafından yapılan çalışmaya göre 2017 yılında en yüksek internet hızı ortalamasına sahip olduğu ülkeler açıklandı. Birleşik Devletler İngiltere, Almanya ve Kanada gibi devletler bulunmuyor. Listenin en tepesinde Çin 'e bağı özel yönetim …

Devamını Oku »

En İyi Saç Boyası Markası

Logona markalı saç boyası oldukça kalitelidir. en iyi saç boyası markası hangisi diye sorulduğu takdirde bazı markalar var ve bunlartan kalitelidir. bunlar; Topchic, Natural, Royal markaları da en iyiler arasında yer vermektedir. Ne Tür Boyalar Bulunur -Organik ve bitkisel olmak üzere kaliteli boya markaları bulunur. Kimyasal Madde İçermeyen Marka Logona Bitkisel boyalar arasında kaliteliğidir. Logona, koku, sentetik boya, konserve edici …

Devamını Oku »

Festival Sezonun En Güzel Saç Modelleri

  Festival Sezonu En Güzel Saç Modelleri Bu içeriği puanla     Yaz yaklaşıyor, festivaller kapıda. Dolup taşmayı bekliyor. Bu renkli günlerde biraz farklılaşmak herkese iyi gelir. İşte festival sezonunda boyutu hava katacak en eğlenceli saç modelleri. 1- Metal Aksesuarlar Örgü trendi farklı stil sahiplerini mutlaka bir yerden yakalıyor. Metal aksesuarlar olmadan romantik sayılabilecek bu model, çengelli iğnelerle bambaşka bir …

Devamını Oku »

2016 Kışının En Güzel Saç Kesim Modelleri

  Kış En İyi 10 Saç Kesimi Bu içeriği puanla     Gerçekten bir dönüşüm ya da küçük bir değişimle farklı hissetmek isteyenlere ilham verecek 10 saç kesimi. 1- Dakota Johnson Omuz hizasında kestirdiğiniz saç ve kaküllerinizle Dakota'nın bu yumuşak ve kadınsı görünümünü yakalayabilirsiniz. Saç kesim modelleri 2- Rachel McAdams Saç kesim modelleri

Devamını Oku »

En Güzel Topuz Modelleri

Saçların doğal görünümünü koruyarak, en özgür biçimde ve farklı stillerde toplayarak yaz sezonunda fark yaratabilir. 2017 yaz sezonu saç modelleri arasında farklı örgü modelleri, ombre saçlar ve dağınık topuzlar bulunmaktadır. Ayrıca rengarenk boyanmış saçlarla, turkuaz ve pembeler bu yaz çok moda. Rahat kullanışmak en güzel topuz saç modelleri örgü ve bağlama teknikleri ile taçlandırılıyor. Evde kolaylıkla kendin yapabileceğiniz modelleyici, salaş …

Devamını Oku »

Dünyanın en keskin lazeri – ShiftDelete.Net

"Mükemmel lazerler" teorik olarak özel bir dalga boyunda ışık yayar. Ancak mevcut teknolojiyi kullanmak bir takımdır bant genişliğinde çalışır. Lazer araştırmacıları, bu bant genişliğini mümkün olduğunca daraltarak en iyi lazeri geliştirmeyi amaç edinirler. 10 mHz ile dünyanın en keskini! Uluslararası bir ekip sadece 10 mHz (0.01 Hz) bant genişliğiyle dünyanın en keskin lazerini geliştirdi. Tipik olarak, en iyi lazerler birkaç …

Devamını Oku »

Instagram'ın En Popüler Saç Modelleri

  Yazan En Taze 6 Saç Stili Bu içeriği puanla     Yazın en taze saç modellerini bu kez Instagram üzerinden araştırdık! 1- Ananas Saçı Ananas stilini ilk Rihanna da gördük. Kıvırcık saçlarını, en tepede toplayarak onları üst üste yığmıştı. Ananasa benzeyen bu saç stili şimdi Instagram'ın lehine saçlarından biri. 2-Şeytan Topuzu Instagram'ın öne çıktığı diğer modeller, Kardashian ailesinden. Şeytan …

Devamını Oku »

35+ En İyi Kısa Sarışın Saç Stilleri | Kısa Saç Stilleri 2016 – 2017

Sarışın saçlar belki de kadınlar için en göze çarpan ve tercih edilen saç rengidir. Farklı sarışın renk tonları vardır her kadının en az bir gölge benimsemesine izin verir. 1. En Kısa Kısa Saç Modeli Işık sarısı bebek ışıkları ile mavi göz rengi ve açık tonlardaki l kadınlar için mükemmel bir stildir. Kaynak 2. Kısa Sarışın Saç Stilleri İşte muhteşem küllü …

Devamını Oku »

HTC U11 Antutu testlerinde en yüksek puanı aldı

Antutu, akıllı telefonları, birçok yönden değerlendirerek performansını puan da veren bir uygulama. Bu yıl yapılan Antutu testlerinde En iyi performans gösteriliyor iPhone 7 Plus 'tı. Fakat Mayıs ayı boyunca yapılan testlerden en çok puanı alan HTC U11 oldu. HTC U11in liderliği kapletin testlerde ilk 10 sırada acaba hangi telefonlar var? Antutu testinin lideri HTC U11! Antutu'nun genel performans testinde iPhone …

Devamını Oku »

En Güzel Gelin Başı Topuz Örnekleri

Eğer siz de gününüzün büyük bölümünü kuaförde geçirmek ve yüzlerce lira para harcamak istemiyorsanız düğün saçınızı ve makyajınızı kendiniz yapın. Bu yazımızda düğün konseptlerine göre hangi gelin topuzu modelinin nasıl yapılacağından kısaca bahsedeceğiz. en güzel gelin topuzu en güzel gelin Topuzu saç

Devamını Oku »

Sporda Uygulanabilir En Pratik Saç Modelleri

    Spor Yaparken Uygulanabilir Pratik Saç Modelleri Bu içeriği puanla     Baharın gelmesiyle spor ve rejim daha çok kararlı oluyoruz hepimiz. Güneş, tatil, kum ve deniz motivasyonumuzu arttırırken tüm kış yapamadıklarımızı şevkle yapmamızı sağlıyor. Sporcu yazmaya devam etmeyenlerımıza de düşmana yanlış yapma. 🙂 Dört mevsim sağlam iradeleriyle kendilerine hayran bırakanlar ve son dakikacılar olarak ikiye ayrılsak da ortak …

Devamını Oku »

En Güzel Küt Saç Modelleri

    En Güzel Küt Saç Modelleri Bu içeriği puanla     2016 yılının son günlerde çoğalması saç kesimi küt saçlar! Özellikle karşılaşalım yaz aylarının 'rahat ettiren' 'saçı diyebiliriz kendisine. Kahküllerle bambaşka desteklediğinizde, harikulade bir sonuca ulaşırınız. Küt saç kesimi modelleri daha çok düz saçılar tercih edilemez de dalgalı saçlarda ayrı ayrı güzel duruyor. Fakat yine de kabarmaya meyilli saçların …

Devamını Oku »

En Güzel 38 Lob Saç Modeli

Modern ve farklı kesimlerden hepimiz hoşlanıyoruz. Lob saç kesim modelleri trend için günden beri pek çok kadının vazgeçilmezi. Bunun en önemli sebebi de lob kesim modellerinin hemen hepsini yüzünden tipini yakışıyor. Lob saç kesiminin bob'dan farkı omuzlara doğru uzanıyor olm. Uzun bob yani lob saç modellerinin bir daha avantajlı ve daha zarif görünümü. Bu saçın bir başka güzelliği de her …

Devamını Oku »

IPhone 8 en iyi şekilde videoda göründü

iPhone'da 8 ' tasarımında netleştiğini gösteriyor. Tiger Mobiles ve Onleaks 'in paylaştığı yeni video iPhone 8'in bugüne kadarki en net görüntüleri diyebiliriz. iPhone 8'de net olarak görüntülendi! 'in paylaştığı videoda iPhone 8 tasarımı en ince ayrıntılarına kadar görünüyor. HD olarak Görüntüyü gösteriyor Onleaks videoda iPhone 8'in boyutlarını da cetvelle ölçerek gösteriyor. Buna göre cihaz 143.50 x 71.03 x 7.46 mm …

Devamını Oku »

En Tembellerin Bile Kolayca Uygulanabilirliği Günlük Saç Modelleri

Yeteneksizlik için kimsenin eline su dökemeyeceği kadınların sadık kısa sürede uygulayabilecekleri günlük saç modellerini araştırdık. Saçla başla uğraşmak biliyoruz ki herkesin harcı değil. Hem de merak istiyor! Bazılarımız kimi modellere bakmayı tercih beğenmekle kalıyoruz. Biri gelse yapsa neyse ama uğraşmaya yanaşmıyoruz. Özellikle de işe ve okula gidiş için zaman ayırmak biliyoruz. Fakat bazı pratik saç modelleri var ki hiç de …

Devamını Oku »

Eğlenceden Sahnelere 10 En İyi Örgülü Saç Stilleri

Bugünün canlı galerisi, tüm dünyadaki kadınlar tarafından oylanan En İyi Örgülü Saç Stilleri 'ten seçilen en son eğilimleri getiriyor! Bu yüzden bu görüntü sıcak! Bu yıl, ombré'nin ve balayage'ın örgülü haldeyken yaptığı muhteşem renk modellerini görüyoruz. Ve kesinlikle daha önce görmediğimiz yepyeni renk kombinasyonları, çok iyi bir göz atın. Günlük örgüleri cazırlamak için yeni bir bükülme, tamamen şok edici bir …

Devamını Oku »

Dünyanın en ilginç seks rekorları …

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde başlığın altında yer almayan bir varlık oluşturulmadı. Bu alan şu bir reklam veya reklam için boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağın yok yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağı hakkında bilgi ve açıklamalar okumaya devam ediniz: Eğer siz de bu …

Devamını Oku »

En güzel selfie çeken telefon hangisi? (Video)

Günümüzdeki akıllı telefonların ön kameraları, en az arka kamera kadar önemli hâle geldi. Şüphesiz bunda "selfie" akımının önemi büyük. Biz de bu videomuzda, son dönem çıkan üst seviye akıllı telefonların ön kameraları karşılaştıralım istedik. Hangi telefonlar var? Karşılaştırma yapmak Galaxy S8 +, Xperia XZ Premium HTC 10 LG G6, Huawei P10 ve IPhone 7 Plus modelleri yer alıyor. Videomuza geçmeden …

Devamını Oku »

EN Güzel Yandan At kuyruğu saç modelleri

at kuyruğu kadın saçlar at kuyruğu saç modelleri saç modelleri Kuyrugğu at kuyruğu bayan saçlar At kuyruğu saç modelleri şıklığı, hızlı ve kolay yapım ve kullanışlı olması sebebi ile saç modellerinden biridir. Hem günlük kullanıma hem uygunluk hem de avantajlarındandır. Ancak, çok fazla vakit bulamıyor ve sık sık at kuyruğu yapıyorsa monotonluktan sıkılmış olabilirsiniz. Öyleyse yandan at kuyruğu saç modeli …

Devamını Oku »

1500 TL en iyi telefon

ShiftDelete.Net olarak yeni bir seriye başlıyoruz. "Ben olsam ne alırdım?" Yeni başlayanlar için, lütfen bize yazın, tamam mı? Serimizin ilk bölümünde 1500 TL 'Bu kadar telefona bakalım, ne telefon satın alacağımızı konuştuk. 1500 TL daha iyi telefon – Ben olsam ne alırdım # 1 Konuyla ilgili çektiğimiz videoyu aşağıdan izleyebilir, dilerseniz de yaptığımız tercihler aşağıdan yazılı olarak okuyabilirsiniz. Hangi telefonlar …

Devamını Oku »

Dünyanın en büyük 3D yazıcısı

GE dünyanın en büyük lazer-toz katkı imalat makinesi kurma planlarını açıkladı. GE Katkı Maddesi ait şirketin yeni bir kutu üzerinde geliştirilmiş olan bu cihaz, metal tozlarını kalıplamak için bir lazer kullanıyor. Bu cihazıyla 1 metreküpe kadar adet parçalar üretilebilecek. En büyük lazer-toz yazıcı 3D ekranı birleştirmek imalat protezler, ayakkabılar, yemekler hatta binalar kadar pek çok alanda küçük kolaylaştırıyor. Çoğu 3D …

Devamını Oku »

En Güzel Uzun Saç Modelleri

Kadınların saçlarını birleştiği noktalardan biri de saç uzatmadır. Gerçekten saçıcı kestirmeyi kafasına koyup, kısacık saçlarıyla mutlu olan, hatta bir daha saçlı vazgeçmeyenler konumuuz tabii. KEŞKE kestirmeseydimler. KEŞKE kestirmeseydimler. KEŞKE kestirmeseydimler. İş işten geçtik, bir anda gündem hızlı saç uzatma yöntemleri olarak değişir. O dönemin popülerleri. Mesela şimdinin en popüler saç uzatma yöntemleri arasında çam terebentin var. Uzun saçlı zaafı olan …

Devamını Oku »

Ayrılık Acısını Dindiren En Güzel Saç Modelleri

Sevgiliden ayrılınca yapılacak ilk şey gidenin acısını saçlardan çıkarmak. Çünkü kuaför kapısı ayrılık acısını unutturur, en azından birkaç saat. 🙂 Bir nevi geçici terapi. Yeni saç modeli yeni bir hayatın kapılarını aralamasa da sizi bir zaman idare edebilir. Gerçi elimizde olsa neleri değiştirmezdik ki; Işi, evi arabayı. Ama ne demişler '' Benim adım hıdır elimden gelen budur. '' Bitmiş bir …

Devamını Oku »

Ofiste Uygulanan En Güzel Saç Modelleri

Sabahları alarmı beş dakika sonradan erteleyenlerden misiniz? Daha fazla saç modeline karar vermek ve makyaj konusu var. Var. Bu Yazımız Tam Boy Göreceksiniz. İş kadınları için saç modelleri çok pratik ve fazla zaman almayan modeller doğru. Bazı saç modelleri var ki, siz vakit harcamadan yaptığınız halde kuaförden çıkmış gibi görüngü sağlayabilir Hem giyim tarzına hem de ofis yaşantısına uyum sağlanabilir …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Bir önceki yazımız 19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Haziran 2017 Pazartesi Akçaabat nöbetçi eczane, 19 Haziran 2017 Pazartesi …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 Pazar Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi verilmektedir. …

Devamını Oku »

Haftanın en çok indirilen filmleri

Her ne kadar içerik üreticileri isterse yıllardır torrent 'in önüne geçmek isteyen de bu pek mümkün olanları yapar bililir gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki 19 Haziran itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Harika Kadın Sadece savaşçı amazon kadınların yaşadığı Themyscira adasında büyüyen, buranın dışına hiç çıkmamış …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

En Modern Kısa Saç Modelleri

Bazıları için vakit yokluğundan veya da saçtan fazla uğraşmak istenmediğinden başvurulan bir model olsa da bazı şeyler için farklı bir stildir kısa saç … Modern, özgür, biraz asi bir hava veren, özellikle kendine güvenen kadınlar için tercih edilenleri söylenebilir. Aslında işin özü kısa saçlı cesaret ister desek de, tüm dikkatleri üzerine çekeceği kesin. Uzun saçlı kadınsı ve dişiliği temsillediğini düşünmüş …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nö …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

En Havalı 2016 Gelin Saçı Modelleri

Çiçeklerin gelinlere çok yakıştığını ispatlayacak nitelikte, en güzel, en renkli, bahar çiçekleriyle süslenmiş gelin saçı modellerini derledik! Toplu ya da açık, fark etmez, iyilik çiçekleriniz en özel gününüzde saç aksesuarına dönüşsün. Eminiz herkes boyutu bayılacak! Çünkü bu çiçekler harika. Saç renginizin zıttı capcanlı renklerle, prenses gibi görünebilir. İster sade, daha fazla gösterişli, tarzınızın hiç bir önemi yok. Çiçekler ona tarza …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar Akçaabat nöbetçi eczane, 18 Haziran 2017 Pazar …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 18 Haziran 2017 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler başlıklı makalemizde 17 Haziran 2017 Cumartesi nöbetçi eczane, 17 Haziran 2017 Cumartesi Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler başlıklı makalemizde 17 Haziran 2017 Cumartesi Nöbetçi eczane, 17 Haziran 2017 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 18 Haziran 2017 Pazar 08:00 – …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni N …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

En Güzel Fiyonklu Saç Modelleri Resimli Anlatım

Uzun saçlar çok fazla farklı model yapmaya imkan veriyor, düz, su dalgası, kıvırcık, örgü, topuz .. Ancak yine de sıkılıp bir model arayanlardandır. Saç modelleri ile tanışın. Fiyonklu modelleyici düz, dalgalı, dağınık ya da klasik saçların tamamına uygun bir model. Ancak bu saç dökülmesi saç dökülmesine neden olabilir. Peki nasıl güzelleşiyor modelleri? Saçlarınızı düzleştirip sağ ve sol taraftan orta kalınlıkta …

Devamını Oku »

En Havalı Saç Kesim Modelleri

Saçını kestirmeyi düşünenlere rehber edelim bir galeri hazırladık. saç kesim modelleri nden birkaçı büyüklüğünde fikir verecektir. Saç Kesim Modelleri ] Saç kesimi tarzında yapacağınız en büyük yeniliktir. Üstelik saçlarını kısacık kestirmeniz de gerekmez. Saçınıza hareket katacak ufak bir iki dokunuş sizi farklı kılabilir. Saç kesimi modellerinin hareket ettirilmesi için gerekli önlemleri uygulatacağınızdır. Hareketli saç modelleri enerjinizi daha yüksek gösterir. Uzun …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 17 Haziran 2017 Cumartesi 08:00 – 18 Haziran 2017 Pazar 08:00 Bir önceki yazımız olan 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 17 Haziran 2017 Cumartesi Akçaabat nöbetçi eczane, 17 Haziran 2017 …

Devamını Oku »

En Güzel Kıvırcık Saç Modelleri

Saçlarını şekle sokamamaktan şikayetçi olanlar için kıvırcık saçlara ayrı bir hava katacak, en güzel kıvırcık saç modellerini derledik! Ama kabul edelim ki bazı zamanlar çok daha zordur kıvırcık saçlı olmak. Kıvırcık saçlıysanız, kısa süre sonra saçlarınızın kısa süre sonra neye dönüşeceğini, özel günlerde kuaför yolu kaçınılmaz bir külfete dönüşür. Toka hayata küstürür. Toka hayata küstürür. Tarıklar ve yağmur başı düşmandır. …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 17 Haziran 2017 Cumartesi 08:00 – 18 Haziran 2017 Pazar 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 17 Haziran 2017 …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 16 Haziran 2017 Cuma – 17 Haziran 2017 Cumartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 16 Haziran 2017 Cuma nöbetçi eczane, 16 Haziran 2017 Cuma Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 16 Haziran 2017 Cuma – 17 Haziran 2017 Cumartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 16 Haziran 2017 Cuma nöbetçi eczane, 16 Haziran …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez (19459028) Nöbet : 17 Haziran 2017 Cumartesi 08:00 – 18 Haziran 2017 Pazar 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 17 Haziran 2017 Cumartesi 08:00 …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni N …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Ordu / Ünye Nöbetçi Eczaneler | Türkiyenin En Yeni N …

52 Ordu Nöbetçi Eczaneler Adres : Hükümet Cad. No: 28 İl / İlçe : Ordu / Ünye Nöbet : 17 Haziran 2017 Cumartesi 08:00 – 18 Haziran 2017 Pazar 08:00 17 Haziran 2017 Cumartesi nöbetçi eczane ve 17 Haziran 2017 Cumartesi Ordu nöbetçi eczane hakkında bilgiler veriyoruz. Bir önceki yazımız olan 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar …

Devamını Oku »

2016 Yazının En Güzel Saç Modelleri

Oturduğumuz yerde mum gibi eriyeceğimiz sıcak yaz günleri için yeni saç modelleri tarifine çıktık. Yaz gelsin diye atıp tuttuğumuz günlerin aksine, kışın soğuğunun iple çekildiği günlerle saçlarımızla ne kadar az temasa girersek bizim için o kadar iyi. Biraz daha güzel vereyim derken her hamle, sıcaklara karşı yenik düşecek bir savaşyı. Güneşin burundan gireceği günler için enseye az değen, yaz dostu …

Devamını Oku »

2015 Yılının En İyi Erkek Saç Modelleri

Artık erkekler havalı kesimleri seviyor, eskinin tek uç saç modelleri mazi olurken biz de 2015 yılının en havalı erkek saç modellerini araştırdık. Bu saç modelleri mutlaka yüzünüze yakışacak olanı tercih etmelisiniz. Bu noktada kuaföründene çok iş düşüyor. Eli makasa yatkın gözü zevkli bir kuaför beğendiğiniz ve daha önemlisi size yakışacak modeli uyguladığında sizden sonradan havalı erkekler kervanına katılabileceksiniz. Fakat yine …

Devamını Oku »

2016 Yılının En Favori Saç Modelleri

1- Balerin Topuzu Zamansız saç modelleri arasında modası asla geçmeyecek olan balerin topuzları, zarif ve şık görünümü yakalamanın en kolay yolu. Önemli bir kez davet, spor birleşmeleri güçlü bir tamamlayıcısı rolünde. Tercihinize, yüz şekline göre enseden ya da tepeden toplayabilirsiniz. Balerin topuzu saç modelleri, yüzünden daha ince, boynunuzu da uzun gösterir.

Devamını Oku »

16 Haziran 2017 Cuma – 17 Haziran 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 16 Haziran 2017 Cuma 08:00 – 17 Haziran 2017 Cumartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 16 …

Devamını Oku »