18 Aralık 2017,Pazartesi
Anasayfa » Tag Archives: de

Tag Archives: de

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

EBF3'teki De Novo Mutasyonları …

Özet Erken B hücre faktörü 3 (EBF3), atipik bir transkripsiyon faktörüdür ve bu faktör, Serebral korteksin laminar oluşumu. Burada, EBF3 'deki de novo mutasyonların kompleks bir nörogelişimsel sendroma neden olduğunu bildirmekteyiz. Mutasyonlar, iki büyük ölçekli sıralama projesinde tanımlandı: İngiltere'de Deşifre Edici Gelişim Bozuklukları (DDD) çalışması ve Sıralı Hizmet ve Olarak Değerlendirme Hizmeti'nin (CAUSES) Faydalılığının Kanada Klinik Değerlendirmesi. Çekirdek fenotip orta …

Devamını Oku »

Endoplazmik retikulum-mitokondri karşılaşma yapısı (ERMES), mitokondriyal dış zar ile ER'yi birbirine bağlar . ERMES'e, mitokondriyal morfolojinin, protein montajı ve fosfolipid homeostazının sürdürülmesi de dahil olmak üzere çoklu fonksiyonlar bağlandı. Mitokondriyal dağılım ve morfoloji proteini Mdm10, hem ERMES hem de mitokondriyal sıralama ve montaj makinelerinde (SAM) mevcut olduğundan, ERMES işlevlerinin moleküler düzeyde nasıl bağlandığı bilinmiyor. Burada, Mdm10 β-varilin karşıt taraflarındaki korunan yüzey alanlarının sırasıyla SAM ve ERMES ile etkileşime girdiğini bildiriyoruz. Molekül ve fosfolipid homeostazından (ERMES) protein montajını (SAM) ayırmak için nokta mutantları ürettik. Çalışmamız, Mdm10'un β-varil kanalının farklı fonksiyonlara hizmet ettiğini ortaya koymaktadır. Mdm10, SAM'de α-sarmal ve β-varil proteinlerinin biyogenezini arttırır ve SAM-aracılı protein montajının ER-mitokondriya temas bölgelerinden farklı olduğunu gösteren ERMES'in entegre membran ankoru olarak işlev görür.

Mitokondri aslen başlangıçta ATP üreten yarı özerk organel olarak işlev gördü, ancak hücrenin geri kalanından büyük ölçüde bağımsızdı. Mitokondriyanın çok sayıdaki metabolik yolaklardan protein ve lipid biyogenezine, sinyal süreçlerine, kalite kontrolüne ve apoptozise kadar, merkezi hücresel fonksiyonlara derinden entegre olduğu bulunmuştur, bu görüş radikal bir şekilde değişmiştir. 2 ] 3 4 . Son çalışmalar, mitokondrianın hücresel homeostaz ve organizasyona geniş …

Devamını Oku »

Regülasyonda De Novo'nun Silinmesi …

Kompleman faktörü H ( CFH ) ve tamamlayıcı faktör H ile alakalı ( CFHR1-CFHR5 ) genler Kromozom 1q32 () üzerindeki kompleman aktivasyon (RCA) kümesinin düzenleyicilerinde 360-kb bir bölgede bulunur. 1 Bu genomun birkaç büyük genomik kopyasından kaynaklanan bir alandır 3 ve bu düşük kopyalı tekrarlar bu bölgede genetik istikrarsızlığa neden olabilir. ] RCA kümesindeki 6.3 kb'lik bir silinme, yeni bir …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Berfin'e ben de öfkeleniyorum

* Neden "İsimsizler"? – "İsimsizler" in çok önemli bir misyonu var: Terörle mücadele. Bizi parçalamaya çalışan güçlerin çirkin oyunlarını gözler önüne seren, gücünü gerçeklikten alan ve izleyiciyi bilinçlendiren bir dizi. Kin, nefret, savaş oğlu bulsun ve kimse bizi birbirimize düşüremesin diye dediler var var bir dizi. İşte tam da bu yüzden "İsimsizler". * Berfin, bir karakteri canlandırması zor. Tekliften önce …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Oppo R11 de Geekbench'te göründü!

Oppo'nun önekideki haftanın tanıtacağı yeni akıllı telefon R11 için Geekbench test skorları da yayımlandı. Görünüşe Göre R11'in Snapdragon 660 İşlemcisi Bir Hayli İyi Göster Gösteriyor. Not 7'nin fiyatı belli oldu! Snapdragon 660 etkisi! 11 Haziran tarihinde Oppo tarafından resmi olarak tanıtılacak olan R11 hakkında bilmediğin hiçbir şey kalmadı desek yanlış olmaz. Zira cihazın tasarımından teknik ayrıntılarına kadar tüm bilgiler sızdırıldı. …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Xiaomi Mi 5 de indirimde! – ShiftDelete.Net

Xiaomi Mi5 modelinin geliştirilmiş sürümü ve fiyatının performansı açısından iyi bir seçim Xiaomi Mi5s modeli indirimde. Dilerseniz ilk olarak telefonun özelliklerini hatırlayalım. Xiaomi Mi5s özellikleri gümüş beyaz ve Gül Altın altın ] Renk seçenekleriyle geliyor. 5.15 inç boyutlu ekrananda Full HD çözünürlük esas telefon, IPS panel kullanıyor ve [n 600 nits parlaklık seviyesi sunuyor. 2,45 GHz saat hızında çalışıyor Snapdragon …

Devamını Oku »

Lenovo PHAB Plus hem tablet hem de telefon LetsGoMobile

L Enovo, bir akıllı telefonun taşınabilirliğiyle, bir tabletin tümü eğlencesini bir araya getirdi. Lenovo, IFA'da tanıttığı ürünü Lenovo PHAB Plus'ı, tek elle kullanım için için uygun hale getirdi. Lenovo PHAB Plus, 6.8 inçlik ekran, eğlence özellikleri, internet hızı ve tüm gün süren batarya ömrüyle sınıfının en iyisi hazır dikkat çekiyor. Lenovo PHAP Plus, küçük boyutlu tabletlerle birlikte büyük ekranlı pahalı …

Devamını Oku »

Sıvı helyum yok, ama yine de son derece havalı

                                                                                            Sae Woo Nam (solda) ve Vincent Kotsubo yeni kriyo soğutucusunun prototipini inceliyorlar. Kredi: Ulusal Standartlar ve Teknoloji Enstitüsü      NIST bilim insanları, daha önce gösterilenlerden çok daha küçük, birçok ileri teknoloji araştırma için süperiletken nanotel tekli foton dedektörlerini (SNSPD) soğutmak için yeni bir hibrid sistem geliştirdiler Sıvı helyum gibi klasik kriyojenlerin gereğini ortadan kaldırır.                                                                          …

Devamını Oku »

Akio Toyoda hem ana sürücü hem de geç bloomer

       ÖYLEYİCİNİN NOT: Yarışa derinlemesine bakmak ve otomobil endüstrisinde oynadığı kilit rol için otoyolda autonews.com/racing'e gidin. Bu hikaye bu bölümün bir parçası olacaktır. TOKYO – Akio Toyoda, yarış pistleri için çamurda ev eğirme çöreklerinde ya da bir Camry stok arabasını bükük bir oval çevresinde düz şekilde iterek, Toyota'nın sürüş CEO'su olarak yeniden isimlendirildi. Fakat geç bir bloomerdi. Toyota Motor Corp'nun …

Devamını Oku »

Dünyadan; … Corcovado dağ, Rio de Janeiro, Brezilya …

                     2017-05-19 10:41:00                                                              Corcovado dağ, Rio de Janeiro, Brezilya Dünyaca ünlü Mesih Kurtarıcı Heykeli'nin bulunduğu Corcovado dağının doruk noktasında, Rio'nun canlı bölgesi olan sıra Sugarloaf Dağı'nın da eşsiz, heyecan verici bir perspektifini yaşayabilirsiniz.                                           0                      0                      0                                                                                                                                       Kaynak

Devamını Oku »

Basit ama parlak, bunlar hem de evde hem de işyerind …

                     2017-05-18 11:04:00                                                              Basit ama parlak, bunlar hem de evde hem de iş yerinde faydalı olacak.Bardak mandalı                                           0                      0                      0                                                                                                                                       Kaynak

Devamını Oku »

Asena'ya şok! Arabalar da servet de gitti

                     2017-05-17 11:54:00                                           Asena Atalay, eski eşi Caner Erkin'in menkul, gayrimenkul ve futbol kulüpleri için tedbir alınacak konulmasını istedi. Mahkeme, Atalay'ın açtığı davayı reddetti. Ünlü futbolcu Caner Erkin ve Asena Atalay, geçen yıl Ocak ayında İstanbul 2. Aile Mahkemesi'nde anlaşarak boşandı. 6 yaşındki çocuklarının velayeti de annede kaldı. Mahkeme, tarafların imzasına göre tarihsiz boşanma protokolünü tasdik etti. Ancak …

Devamını Oku »

Soyutlama Cinsel üreme, her kromozomun yalnızca bir kopyası ile haploid gametlerin (sperm ve yumurta) üretimini gerektirir; Döllenme sonraki nesildeki diploid kromozom içeriğini geri yükler. Genetik içeriğindeki bu azalma, iki tur kromozom ayrışmasının DNA replikasyonunun tek bir turunu izlediği, mayoz olarak adlandırılan özel bir hücre bölünmesi sırasında başarılır. İlk mayot bölünmeye hazırlanırken, homolog kromozomlar çift ve sinaps, çapraz rekombinasyon olaylarının oluşumunu teşvik eden bir bağlam yaratır. Bu geçitler, kız kardeş kromatid bağlılığı ile bağlantılı olarak, iki homolojiyi birbirine bağlar ve ilk mayoz bölünme sırasında karşı kutuplara ayrılmalarını kolaylaştırır. Mitoz benzer ikinci mayos bölünme sırasında, kız kardeş kromatidler ayrı; Sonuçta üretilen ürünler gamet haline gelen haploid hücrelerdir. In C. Elegans (ve birçoğu ökaryotların çoğunu) mayooz sırasında uygun kromozom kalıtımı için homolog eşleştirme ve rekombinasyon gereklidir; Dolayısıyla, bu olayların düzgün şekilde yürütülmesini sağlamak için mayoz olayları sıkı bir şekilde koordine edilmektedir. Bu bölümde, mayoz bölünme olaylarını gözden geçiriyoruz: homolog kromozomların eşleştirilmesi; Kromozomların mayoz döneminde geçirdiği kromozom yapısındaki değişiklikler; Mayotik rekombinasyon olayları; Homolog kromozom çiftlerinin Meizoz I'de uygun kromozom ayrımı için optimize edilmiş yapılara ayrılması; Ve mayotik bölünmeler sırasında kromozomların nihai ayrımı. Ayrıca, I. evre boyunca bu mayotik olayların koordineli yürütülmesini sağlayan düzenleyici süreçleri de gözden geçirdik.

1. Genel Açıklama Cinsel üreme, mezozun uzmanlaşmış hücre bölüşümü programı aracılığıyla diploid öncülerden haploid gametlerin üretilmesini gerektirir. Ploidy'deki bu azalma döllenmeyle ilgili olarak diploidyondaki restorasyonun sağlanması için gereklidir ve birkaç önemli olayı tamamlamayı gerektirir (). Erken evre (leptoten ve ziggoten evreleri) sırasında, her kromozom, uygun homolog eşleştirme partnerini bulmalı ve tanımalı ve buna uyumlu olmalıdır. Ziggoten safhasında, homologları bir arada …

Devamını Oku »

Ayrıca annenin yiyen de siz mısınız? Farklı prote …

Int J Obes (Lond). 2015 Ağustos; 39 (8): 1325-1328. Bir Manousopoulou, 1, 2 J Woo, 2 2 2 2 2 1, 3 Bir Singhania, 2 C Hawkes, 2 SD Garbis, 1, 2, 3, 4, * ve RO Carare 1 Proteomik Araştırma Merkezi, Yaşam Bilimleri Enstitüsü, University of Southampton, Southampton, Birleşik Krallık 3 2 2 Klinik ve Deneysel Bilimler, Southampton Üniversitesi, …

Devamını Oku »

Lipoprotein ile ilişkili ve Apolipoprotein ile Ortaya Konan De …

Lipoprotein ile ilişkili veya apolipoprotein hedefli nanopartiküllerin farmasötik taşıyıcılar olarak entegrasyonu yeni terapötik açıdan Ve nanotıp alanındaki teşhis yolları. Konsept, insan dolaşımındaki apolar lipidlerin ve yağın doğal transpozitifi olarak lipoprotein parçacıklarının özsel özelliklerini kullanmaktır. Ayrık lipoprotein birleşimleri ve lipoprotein tabanlı biyomimetik, özel tıbbi uygulamalar için manipüle edilebilen ve ayarlanabilen çok yönlü bir nanoparçacık platformu sunmaktadır. Bu makale, ilaç yüklü, yeniden …

Devamını Oku »

En büyük kale de korsana yenildi!

Aşılamayacağına inanılan bir şifreleme yöntemi daha korsanlara karşı yenik düştü. Şifreleme yöntemiinin kırılmasıyla birlikte 4K Ultra HD Blu-Ray filmler internet üzerinden indirilebilir hale gelecek . 4K Ultra HD Blu-Ray filmlerdeki AACS 2.0 koruması aşıldı Koruması kırılarak iyi bilinen bir torrent izleyicisi üzerinden indirmek için yüklenen ilk 4K Blu-Ray filmi, 2013 yapımı Şirinler 2 (Şirinler 2) olmuş durumda. Ilk kez neden …

Devamını Oku »

Toyota Patent, hem Turbo hem de Süper Şarj Cihazını Kullanan Yeni Sistemi Açıkladı »AutoGuide.com News

Toyota, bir elektrikli süper şarj cihazı ve bir turboşarja sahip zorlanmış bir endüksiyon sistemi üzerinde çalışıyor. Toyota, özel bir rulman tasarımı için bir önceki patent başvurusunda elektrikli süper şarjör geliştirdiğini biliyoruz, ancak AutoGuide.com içten yanmalı bir motora uygulanan bir süper şarj sistemini ayrıntılarıyla anlatan bir patent keşfetti. Sistem, aşırı şarj aleti elektrikle çalışırken, motorun egzoz gazı ile çalışan bir turbo …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

PI3Kδ ve primer immün yetmezlikler – Avrupa PMC … Özet Birincil immün yetmezlikler, immün sistemin kalıtsal bozuklukları, Genellikle lenfosit gelişimi için gerekli genlerin mutasyonu ve Aktivasyon. Son zamanlarda, çeşitli çalışmalar, fonksiyon kazanım mutasyonları tespit etmiştir Fosfoinositid 3-kinaz (PI3K) genlerinde PIK3CD (ki P1106'yı kodlar) ve PIK3R1 (p85α'yı kodlar) Aktif olarak adlandırılan kombine bir immün yetmezlik sendromuna neden olan PI3Kδ sendromu (APDS) veya p1108-aktive edici mutasyona neden olan Yaşlı T hücreleri, lenfadenopati ve immün yetmezlik (PASLI). Paradoksal, Hem fonksiyon kaybı hem de bu genleri etkileyen fonksiyon kazanım mutasyonları Farklı mekanizmalar yoluyla olsa da, immünosüpresyona neden olur. Burada, Adaptif bağışıklıkta PI3Kδ'nın rolleri, klinik bulguları tanımlar Ve APDS'deki hastalık mekanizmalarını incelemek ve PI3Kδ'ya yeni bakış açıları vurgulamak Bu hastalardan elde edilen bulguların yanı sıra Klinik tedavi. Giriş Aktif PI3Kδ sendromu (APDS; PASLI olarak da bilinir), Içinde yeni tanımlanmış primer immün yetmezlik (PID) sendromlarının giderek artan sayısı Nedensel mutasyonlar, yeni nesil dizileme ile tanımlanmıştır. The APDS'nin klinik bulguları çeşitlidir ve heterojendir (Kutu 1), ancak hastaların çoğunluğu Tekrarlayan solunum yolu enfeksiyonlarıyla, sıklıkla hava yolu skarlasması ile birlikte görülen (Bronşektazi) ve kulak ve sinüs hasarı, ki bu antikorun (B hücresi) eksiklik. Herpes aile virüsleri ile şiddetli, tekrarlayan veya devam eden enfeksiyonlar, Kusurlu T hücre fonksiyonunu gösteren, bu durumda da sık görülür ve Bazı etkilenen bireylerde erken ölüm neden olur. Birçok hasta benign gelişir Hepatosplenomegali ile sıklıkla ilişkili olan lenfadenopati ve APDS ile ilişkili B hücre lenfoma riski önemli ölçüde artmıştır (Kutu 1). Viral duyarlılık artışı Enfeksiyon ve hafıza T hücrelerinin zayıf geri çağırma tepkileri APDS'yi ayırt eder İzole edilmiş hipogammaglobulinemi 1 – 4 dolayısıyla APDS kombine edilmiş olarak düşünülmelidir Bağışıklık yetersizliği 5 . 100'den fazla hasta APDS ile bugüne kadar bildirilmiştir, ancak kesin insidans henüz bulunmamaktadır. . Kutu 1 APDS'nin klinik özellikleri 6 APDS'li hastalar hem bağışıklık yetersizliği hem de bağışıklık özellikleri sergilerler Disregülasyon: Nükseden akciğer, kulak ve sinüs enfeksiyonları (kapsüllenmiş bakterilerle Olarak Haemophilus influenzae ve Streptokoklar Etkili olabilmek için opsonizasyona ihtiyaç duyan pneumoniae Öldürme) yakın evrenseldir ve yüksek bir insidans ile ilişkilidir Işitme bozukluğu ve bronşektaziyi içeren organ hasarı Havayolu korkutması) 1 4 . Herpes aile virüsü ile şiddetli, tekrarlayan veya kalıcı enfeksiyonlar Yaygın, özellikle kronik EBV veya CMV viremi ve HSV ve VZV Enfeksiyonlar 1 3 – 7 . Bazı solunum yolu virüslerinin sık izolatları 1 Fırsatçı enfeksiyonlar seyrek olmakla birlikte, birkaç hastada (örn., Adenovirüs ve echovirus) Tekrarlayan viral siğiller veya molluskum kontagiosum deneyimli Enfeksiyonlar 49 . Apse oluşumu, lenfadenit ve selülit insidansında artış Gram pozitif bakterilerle (çoğunlukla Staphylococcus Aureus ) ve mikobakterilerin hatalı öldürülmesi APDS'li bir hastadan izole edilen makrofajlar, Doğal bağışıklık 64 . Benign lenfoproliferasyon (lenfadenopati, hepatosplenomegali ve fokal Nodüler lenfoid hiperplazi) tüm hastalarda ortak özelliktir Bugüne kadar incelenmiş olan APDS Etkilenmiş hastalardaki lenfoid dokunun histopatolojik analizi Manto zayıflaması ile atipik folliküler hiperplaziyi gösterir APDS1'deki bölgeler ve APDS2'deki küçük B hücreli folliküller. Germinal merkezler Her ikisinde de T hücrelerini infiltre ederek (çoğunlukla PD1 pozitif) bozuldu APDS1 ve APDS2 APDS ile bağlantılı yüksek oranda bir lenfoma var ve bunları kapsıyor Geniş bir histopatolojik şekil yelpazesi 1 2 7 67 İmmün sitopenias (trombositopeni, hemolitik anemi ve nötropeni) Ve otoimmün benzeri katı organ koşulları (juvenil artrit, Glomerulonefrit, tiroidit ve sklerozan kolanjit) de var 7 66 ,% 34'lük bir frekansta APDS1'li 53 hastanın kohortu 7 Hafif gelişimsel gecikmeler hem APDS1 hem de APDS2'de görüldü. APDS2 olan 36 hastadan oluşan bir kohortta 7 Büyüme (Büyüme) Retardasyon APDS2 olan hastalarda yaygındır 6 73 74 ancak görünmemektedir Özelliği, APDS1'in heterozigot SHORT sendromlu (kısa boylu, boy kısalığı, Eklemlerin hiperekstansibilitesi, fıtı, oküler depresyon, Rieger anomali Ve diş çıkarma gecikmesi) 88 91 APDS heterozigot kazançtan kaynaklanır (GOF) mutasyonları Hiperaktivasyona neden olan PIK3CD veya PIK3R1 Sırasıyla protein ürünleri p1108 veya p85a, 1 – 4 . P85a düzenleyici altbirim ve p110δ katalitik altbirimi Birlikte heterodimerik lipid kinazı PI3Kδ oluşturur; B hücresi reseptörü de dahil olmak üzere bağışıklık sistemindeki hücrelerdeki çoklu reseptörler (BCR) ve T hücre reseptörü (TCR) yanı sıra sitokin ve kostimülatör Reseptörler. Bu aynı altbirimlerde homozigot işlev kaybı (LOF) mutasyonları neden olur İnsanlarda immün yetmezlikten oluşan belirgin ve daha seyrek bir şekil 8 – 10 ve bu belirgin ikiye bölünme, birlikte Etkilenen hasta gruplarının klinik özellikleri, anlayışımızı bildirmiştir. Bu derlemede, PI3Kδ hakkında bilineni özetleyeceğiz, odaklanacağız. Uyarlamalı bağışıklık tepkileri düzenlemesi üzerine. Bu bilginin büyük kısmı Gen hedefli fareler kullanarak yapılan çalışmalar. Ardından, şüphelenilen iki olguyu özetleyeceğiz Insanlarda PI3Kδ eksikliği bildirildi, daha önce tanımlanmadan önce APDS'nin klinik ve immünolojik belirtilerini ayrıntılı olarak açıklar. Sınıf I PI3K'lara genel bakış Sınıf IA PI3K'ler, Pı10a, pı10p veya pı108 katalitik altbirimi oluşturucu olarak Bir p85 düzenleyici altbirimi ile ilişkilidir; IB PI3K sınıfı, Bir p101 veya p84 düzenleyici alt-birim ile etkileşen p110γ katalitik altbirimi (). Pı10a ve pı10p Büyük ölçüde ifade edilirken, p110γ ve pl108 baskın olarak Lökositler tarafından ifade edilir. Fazlalık için önemli bir potansiyel olsa da Katalitik altbirimler arasında, her bireysel p110 izoformu için benzersiz roller var Farklı ifade şekillerini yansıtan ve aynı zamanda Kendi reseptörleri tarafından angaje edilirler 8 , 11 . Örneğin, p110a, Insülin benzeri reseptörler tarafından aktive edilir ve büyümeyi, metabolizmayı ve Angiogenesis 11 oysa p110β Metabolik sinyallemeye katkıda bulunur ve Fare nötrofilleri bağışıklık komplekslerine 12 , 13 . P110γ, Miyeloid hücreler ve kemotaktik tepkilere katkıda bulunur, ayrıca reaktif oksijen Nötrofillerdeki tür (ROS) üretimi 14 . P110δ ile birlikte, p110γ, pre-T hücresi sırasında da önemlidir Timusta gelişim 15 . P1106, Bu derlemenin odak noktası olan hemodiyaliz, hem lenfositlerde hem de Miyeloid hücrelerdir ve antijen reseptörleri, ko-uyarıcı reseptörler, Sitokin reseptörleri ve büyüme faktörü reseptörleri 8 PI3K altbirimleri ve APDS mutasyonları Sınıf Sınıf I PI3K'ler, PtdIns (4,5) P 2'nin fosforilasyonunu katalize eder. ila Bir membran görevi gören PtdIns (3,4,5) P 3 (PIP 3 ) üretirler Pleckstrin homolojisi (PH) alanları olan hücre sinyal proteinleri için ip. Göze çarpan Bunların arasında PDK1 ve AKT, bunlar gibi substratları fosforile edecek şekilde hareket ederler FOXO transkripsiyon faktörleri (inaktive hale gelir) ve regülatörleri MTOR kompleksi 1 (aktive olur). Bu nedenle, sınıf I PI3K'lerin aktivasyonu FOXO transkripsiyon faktörlerinin inaktivasyonu ile sonuçlanır. Lenfositlerde BTK ve İTK PIP 3 – Aktifleştirmeye katkıda bulunan tepki veren tirozin kinazlardır. Fosfolipaz C-gamma (PLCγ) ve diğer indirgeyici sinyal proteinleri (,). Lipid fosfataz PTEN, PIP 3 'i PtdIns'e (4,5) P 2 8'e dönüştürür. Sınıf IA PI3K düzenleyici altbirimler üç farklı gen tarafından kodlanır ( PIK3R1 PIK3R2 ve PIK3R3 ) (). PIK3R1 P85α, p55α ve p50α'yı kodlar (her biri bir alternatiften Transkripsiyon başlangıç ​​sitesi), PIK3R2 p85β'yı kodlar ve PIK3R3 p55γ 16 kodlar. Bu düzenleyici altbirimlerin SH2 etki alanları vardır ve bu bağlar Hücre yüzeyi reseptörlerinin fosforile YXXM motifleri ve membrana bağlı Proteinler. P85α, p55α, p50a ve p85β her yerde bulunur Ifade ederken, p55γ esas olarak beyinde ve testislerde 16 ifade edilir. Sınıf IA PI3K düzenleyici herhangi biri Altbirimler belirgin olmadan p110α, p110β ve p1108'e bağlanabilir seçicilik. PI3Kδ'nın, en iyisi, p85α'yı P1108, ancak p110δ ile diğer sınıf IA PI3K düzenleyici altbirimler de mümkündür. Ayrıca şunu da bilmek önemlidir: P85α birçok p110δ'dan bağımsız işlevlere sahiptir, çünkü aynı zamanda bağlayabilir P110α ve p110β 16 . Sınıf IA PI3K düzenleyici altbirimleri p110 katalitik altbirimlerini etkiler Üç şekilde 17 : proteolitik P110'un bozunması; P110 katalitik aktivitesini inhibe eder; Ve p110'u işe alıyorlar Altbiriminden plazma zarındaki tirozin fosforile proteinlere dönüştürülür. P85α'nın SH2 domenleri fosfotirozinler tarafından tutulduktan sonra, P110 ile inhibitör kontaklar hafifletilir 17 . Böylece, PIK3R1 genindeki mutasyonlar, PI3K aktivitesini, P110δ'nın parçalanmasına veya işe alımının azaltılmasına izin vererek Reseptörler ( PIK3R1 null veya LOF mutasyonları durumunda) veya tarafından P85α'nın p1108 üzerindeki inhibe edici etkisinin serbest bırakılması (durumda PIK3R1 GOF mutasyonları). Düzenleyici alt birimlere ek olarak, P110α ve p110δ RAS'ı bağlayabilir ve p110β, RAC'yi veya CDC42'yi bağlar. Bu küçük GTPazlar p110 altbiriminin membrana bağlanmasına yardımcı olur 17 18 . PI3Kδ ve bağışıklık: fareden alınan dersler APDS tanımından önce, rolü hakkındaki bilgilerin çoğunun Bağışıklık ve enfeksiyonda PI3Kδ, genetik ve farmakolojik Fare modelleri kullanılarak yapılan çalışmalar. APDS'ye neden olan GOF mutasyonları geçtiğimiz günlerde Artmış bazal ve uyarılmış PIP 3 seviyelerine ve PIP 3 – hastadan türeyen bağımlı sinyal iletim dizileri Lenfositler 1 – 4 ve bu hastaların incelenmesi bize yeni bilgiler verebilir PI3Kδ aktivitesinin dengesi bağışıklık hücresi işlevlerini nasıl düzenler. İşte, biz Farelerdeki bu çalışmaların bize ne öğrettiğini özetleyin, önce Mutasyon geçiren insan hastaların immünolojik fenotipleri PIK3R1 Veya PIK3CD

Fare B hücrelerinde PI3Kδ fonksiyon kaybı Farelerde, kemik iliğinde erken B hücresi gelişimi sadece hafiftir 19 – 23 p85α veya p1108'in kaybından etkilenir. Buna karşın p110α ve p110δ kombine kaybı, Pro-B hücresi safhasında 24 yakınlarında yakın komple geliştirme bloğu . Bununla birlikte, p85α veya p1108'den yoksun fareler Altbirimlerin foliküler B hücreleri daha az, marjinal bölge (MZ) B hücrelerinden yoksun ve …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Apple, İngilizceye de imzasını attı!

Apple, kurulduğu dönemden bu yana diğer şirketlerin yanında her biri farklı bir kitleye sahip olmayı başarmış, başarılı bir şirket Bulunduğu sektörlere ilham vermesiyle tanıdığımız Apple, şimdi de İngilizceye ilham vermiş gibi gözüküyor! Köklük sözlük köprüleri Merriam-Webster internet sözlüğünde yeni bir kelime ekledi. kelepçe koyun (koyun) ve insanlar (insanlar) kelimelerinin birleşmesi ve beraberinde kandırılan, kullanılan maddeye gelen. Ayrıca Merriam-Webster bu sözcüğe …

Devamını Oku »

Apple Watch'ın garantisi de uzuyor! – ShiftDelete.Net

Apple, Birlikte verilen akıllı saatte pazarlama girişimi birinci jenerasyon Apple Watch serisiyle ilgili yeni bir karar aldı. Apple Watch'un garantisinin uzatıldığı ortaya çıktı. Apple, batarya şi me problemiyle karşılaşan birinci jenerasyon Apple Watch'ın garanti süresini üç yıla çıkarttı. Apple Watch'ın batarya şişme problemi uzun zamandır Apple Destek Forumu veya Reddit gibi forumlarda tartışılıyordu ancak çok yaygın bir sorun yerimi almamıştı. …

Devamını Oku »

Seat de Meo, İspanyol markasının güçlü yönlerini oluşturmak istiyor

OTOMOTİV HABERLERİ AVRUPA AYLIK DERGİ Luca de Meo: "Güçlü olduğumuz şu ki, Avrupa'daki en genç alıcılar, yüksek bir fetih oranıdır. Hem giriş bölümlerinde hem de güney Avrupa'da uzun süredir varolan bir durumdadır. "       Luca Ciferri             Otomotiv Haberleri Avrupa 30 Nisan 2017 06:01 CET Koltuk CEO'su Luca de Meo, kronik para kaybeden İspanyol markasını ebeveyn …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

O günler de gelecek

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın doğru olduğu ve önereceğiniz bilgiler. Açıklamaları okumaya devam ediniz: Eğer siz de bu konuda reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Mikro RNA'lar, hem hayvanlarda hem de bitkilerde önemli genetik düzenleyicilerdir

MikroRNA'lar önemli bir genetik düzenleyicidir. Gelişim, farklılaşma, büyüme, metabolizmayı ve hastalığı kapsayan bir dizi işlevleri vardır. Yeni nesil sıralama teknolojilerinin ortaya çıkması, bu moleküllerin ve dizilim yoluyla göreli ifadelerinin saptanması için nispeten basit bir görev yaptı. Yatırılan veri kümeleri ile çok sayıda yayınlanmış çalışma bulunmaktadır. Bununla birlikte, şu anda, bu verileri kullanarak, miRNA'ların özelliklerini, dağılımını ve biyogenezini daha iyi anlamak …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

'Beni de kovun' diyen Şevket Çoruh'un akıbeti çan …

                     2017-04-08 12:03:00                                           Herkes, İrfan Değirmenci'nin kovulmasının ardından "Ben de hayır diyorum, beni de kovun" diyen Şevket Çoruh'un, Arka Sokaklar'dan ayrılacasını konuşurken, Çoruh'un diziden ayrılmayacağı netleşti. Türk televizyon tarihinin en uzun soluklu dizilerinden biri olan Arka Sokaklar'ın geçen haftasında yayınlanan 435'inci bölümünde Mesut Komiserin vurulmuş, ameliyathaneye girmek düşmanı Gümüş, alnına silahı dayamıştı. Mesut komiserin öylece tahmin et, Mesut …

Devamını Oku »

Kumbaram dolsun Benim De Bir Kitabım Olsun

"Kumbaram dolsun Benim de Bir Kitabım Olsun" Malatya Valiliği Koordinatörlüğünde Malatya Büyükşehir Belediyesi İl Milli Eğitim Müdürlüğü ortaklığı Ile ettik Düzenlenen ve Malatya Büyükşehir Belediyesi Kültür A.Ş. Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Birleşmiş Milletler Genel Sekreteri Paylaşım alanı oluştan bu yıl …

Devamını Oku »

Kocam dadıyı bıraktı, kürtaj için de vadelere …

         Bir dönemin "baharat kızlarından" Mel B'nin mutlu görünen hayatının üzerinde meşhur kara bulutlar dolaşıyormuş. Ünlü kadınların korkulu rüyası bir kez daha gerçekleşti. Bİr zamanların ünlü grubu Spice Girls'ün (Baharat Kızlar) üyeleriİngilizce bir ay önce boşanma davası açtığı kocası Stephen Belafonte'nin kendisini çocuklarının dadısıyla aldattığını ileri sürdü.

Devamını Oku »

Fahriye Evcen'in başı hem selülitleri hem de varis …

                     2017-04-05 19:40:00                                           Fahriye Evcen, katıldığı davette cesur elbise giydi. Mini elbisesiyle göz oynamaya güzel oyuncunun bacaklarındaki selülitleri ve varisleri değişmek herin dikkatini çekti Güzel oyuncu Fahriye Evcen, önceki gün katıldığı bir etkinlikte mini elbisesiyle ilgili bakışları üzerinde topladı. Ancak evcen'in bacaklarındaki görüntü hem basın mensuplarını hem de diğer davetlileri şaşırttı. TOPLARDAMAR GENİŞLEMESİ Zaman zaman kilo sorunlarıyla gündeme …

Devamını Oku »

Batı G de bulunan ağaç yengeçlerinin yeni türleri …

                                                                                                          Kani maranjandu yengeç. Kredi: Yazarlar      The Crustacean Biology Dergisinde (19459013) yakın tarihli bir araştırma makalesi, Güney Hindistan'ın Kerala kentinde yeni bir cins ve yeni tür ağaç yengeçini ortaya çıkarmaktadır. Bilimsel olarak "Kani maranjandu" olarak bilinen, diğer eşanjörlerden önemli ölçüde farklıdır. Ayırt edici karakterleri arasında: Sert üst kabuğunun yapısı, ayrıca erkek karın yapısı ve …

Devamını Oku »

Örümcek! Buick Regal Wagona Merhaba de ki

Yeniden donatılan Opel Insignia wagon ABD topraklarında yakalandı Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren …

Devamını Oku »

'Benim için tehlikeli ama yine de istiyorum'

                     2017-03-27 18:03:00                                           Rap şarkıcısı Kanye West ile evli olan Kim Kardashian, üçüncü çocuk istediğini açıkladı. Gerçeklik şov programı Kardashians'ta Bir Çocuk Sahibi Olmak İçin Daha İyi Olsun Bir Tavist Olsun 36 Yaşındaki Yıldız, Doktorların Kendisine Yeni Bir Hamileliğin Güvenliğinden Olmayacağınız Üzerine Bir Söyleyeceğinize Unutmadınız mı? "Bir bebek sahibi olmaz daha deneyeceğim" diyen Kardashian, "Çocuklarımın bir kardeşleri daha …

Devamını Oku »

Bir kuantum yarışında herkes hem bir kazanan hem de bir …

                                                                                                          Bir foton hareketine üst üste binme ilkesinin uygulanması aynı anda iki farklı yönde yol açabilir. Her bir yolda farklı bir işlem sırası uygulanırsa, bu, gerçek anlamda belirsiz bir işlem sırası oluşturmak için kullanılabilir. Kredi: Jonas Schmöle, Viyana Üniversitesi, Fizik Fakültesi      Dünyayı anlamamız, çoğunlukla temel algılamalar üzerine kuruludur; olaylar birbirlerini iyi tanımlanmış bir sırayla …

Devamını Oku »

Dünya'nın çekirdeğindeki son element de tanımlandı

Dünya'nın içkisine çekirdeğinin büyük çoğunluğuüzerinde (yaklaşık% 85) oluştuğu iyi biliniyor. Nikel miktarı% 10 civarlarında seyrediyor. Ancak geriye kalan% 5'lik kısım gizemini koruyor. Japon Araştırma ekibi üzerinde Yıllardır bu kayıp elementi arıyor ettik bu kısmın silisyum olduguna inaniyor. Araştırma ekibi, Amerikan Jeofizik Birliği (San Francisco), Sonbahar Buluşmaları'nda Sundu. Dünya sonuçlarını 'Nın katı çekirdeği yüzeyden 3000 km derinde ve 1200 km'de yarıçapının …

Devamını Oku »

DS 3 Ines de la Fressange özel baskısında ortaya çıktı

DS, başka bir özel baskı otomobiliyle geri döndü; bu sefer DS 3 supermini serisine "bahar / yaz koleksiyonu" ek olarak satışa sunulacak Mayıs ayında İngiltere'de. DS 3 Ines de la Fressange olarak adlandırılan bu modüler, en son moda trendlerinden esinlenen 200 farklı örnek ve özellik ile sınırlı ve içe kapanacak özelliklerle sınırlı olacak. • En iyi superminis satışı 2017 Gövde …

Devamını Oku »

18 Mart Çanakkale Zaferi 102 Yaşında! Ülkeyi ve kutsal değerleri, aziz şehitlerimizi, uğurda fedakarları canlarını feda eder, Çanakkale Zaferi'nin 102. yıl dönümünde bir kez daha rahmet , Minnet ve şükranla anıyoruz. Metrekareye 6 bin merminin düştüğü ve 6 milyonda bir ihtimalle mermilerin havada çarpıştığı bu destan unutulmayacak, Çanakkale Türküleri büyük destanı asırlar boyu hafızalarda diri tutacak. Kimse unutmasın ki Çanakkale geçilmez! Pencereden baktığınızda güneşi esirgemiyorsa gökyüzü, birileri yaşadığınız günlerin bedelini ödediği içindir. Bizim, sokakta top kavgasına düştüğümüz yaşlarda vatan kavgasına giden çocuk şehitlerimizi asla unutmayacağız. Başta Mustafa Kemal Atatürk'ün Çanakkale zaferininin de bulunduğu 102. Yılında tüm şehitlerimizi Rahmetle anıyoruz. Ruhunuz şad olsun ..!

Egitimhane.com ] Kaynak

Devamını Oku »

Metanobaktiğin ve Bakır ile Bactanın Bağlantısı … Özet Methanobactins (mbs), düşük molekül ağırlıklı (<1,200 Da) bakır- Birçok metan oksitleyici bakteri (metanotrof) tarafından üretilen bağlayıcı peptidler veya chalkophores. Bu moleküller belirli demir bağlama sideroforlarına benzerlikler gösterir, ancak bakır sınırlamasına yanıt olarak eksprese edilir ve salgılanır. Yapısal olarak, mbs, bakır koordinasyon bölgesini oluşturan ilişkili tiyoamit gruplarına sahip bir çift heterosiklik halkayla karakterize edilir. Halkalardan biri her zaman bir oksazolondur ve ikinci halka bir oksazolon, bir imidazolon veya bir pirazindion parçasıdır. Mb molekülü, (i) halka oluşumu, (ii) bir lider peptid dizisinin bölünmesi ve (iii) bazı durumlarda bir sülfat grubunun eklenmesi de dahil olmak üzere bir dizi posttranslasyonel modifikasyona uğramış bir peptid öncüsünden kaynaklanmaktadır. İşlevsel olarak, mbs bakır alım sisteminin hücre dışı bileşenini temsil eder. Bakır alımındaki bu rolü ile tutarlı olarak, mbs bakır iyonları için yüksek afiniteye sahiptir. Bağlandıktan sonra, mbs hızla Cu 2+ 'i Cu 1+ e indirir. Bağlayıcı bağlamaya ek olarak, mbs çoğu geçiş metalini ve geçiş metaline yakın bağlar ve ana metanotrof yanı sıra diğer bakterileri toksik metallerden korur. Mbslere, başta redoks ve metal bağlayıcı özelliklerine dayanan diğer birçok fizyolojik fonksiyonlar atanmıştır. Bu derlemede, bu yeni metal bağlayıcı peptit tipinin mevcut durumunu inceliyoruz. Potansiyel uygulamalarını, mbslerin çoklu metallerin biyoyararlanımını nasıl değiştirebildiğini ve mbs'lerin metanotrofların fizyolojisinde nasıl oynayabileceğini de keşfediyoruz. GİRİŞ Methanobactins (mbs) ilk önce aerobik metan oksitleyici bakterilerde (metanotroflar) tanımlandı. Bu göze çarpan bakteri grubu, karbon ve enerjinin tek kaynağı olarak metan kullanarak büyüyebilir. Oksijen ve metanın bulunduğu ortamlarda bulunurlar ve biyosferde üretilen metanların çoğunun tüketilmesinde önemli bir rol oynarlar ve böylece küresel ısınmaya olan etkilerini azaltıyorlar (1, -4). Metanogenezis (5) yoluyla üretilen, ucuz, kolay bulunabilen ve yenilenebilir karbon kaynağı ile üretildikleri takdirde, metanotrofların toplu ve ince kimyasalların üretimi için ve çevre kirleticilerin biyolojik olarak temizlenmesinde önemli bir potansiyeli vardır (2, 6 , -8). Metan üzerinde yetişen bir bakterinin ilk raporu, 1906'da Hollanda'da Delft'te bulunan Beijerinck'in laboratuvarında çalışan Söhngen tarafından yapıldı; bu gaz, 1906'da Bacillus metanicus'un izolasyonunu Su bitkileri ve gölet suyu (9). 50 yıl sonra bu mikropun yeniden izole edildiği ve adı değiştirildi Pseudomonas metanica (10, 11). İkinci metanotrof, Metilokokus kapsülatus (Texas türü), 1966'da izole edildi (12). Methanotrof biyolojisindeki bir dönüm noktası, Whittenbury ve meslektaşları tarafından çeşitli karasal ve tatlı su ortamlarından izole edildiğinde ve metan üzerinde büyüyen 100 yeni aerobik metanotrofu anlatan 1970'de geldi (13). Daha sonra bu metanotrofların metan üzerinde yetişebilme yeteneği, karbon asimilasyonunun yolakları, istirahat evreleri (kistler ve sporlar) oluşumu, morfoloji, kompleks intrasitoplazmik zarın bulunduğuna dayanarak tip II'ye karşı tip II sınıflandırması geliştirdiler. Düzenlemeler ve DNA'ların mol yüzdeleri G + C içeriği. Daha sonra, Bowman ve meslektaşları çeşitli ortamlardan benzer sayıda metanotrof izole etti ve bunları Whittenbury ve meslektaşlarının programına ve 16S rRNA filogenezine (14, 15) göre sınıflandırdılar. O sırada hiçbir DNA sıralamasının yapılmamış olmasına rağmen, Whittenbury ve arkadaşlarının genel sınıflandırma şeması bugün metanotrofların gruplandırılmasında sağlam ve kullanışlı bir yöntem olmaya devam etmektedir. Buna göre şu anda 15 jenerat metanotrof bulunmaktadır Gammaproteobakteri sınıfının Methylococcaceae ve 3'ünde Methylothermaceae ailesi bulunmaktadır. Metilobakter Metilokaldum Metilokokus Metilogea Metiloglobulus Metilomagnum ] Metilomarinat Metilpomfurus Metilfosfamid Metilfosfat, Metilpomkarboksilik Asit Metanol, Metilokarboksilik Asit Metilpomkarboksilik Asit Metilpomkarboksilik Asit Metanol (19459016, Metilosarkin (19459016) ve Metilovüum ailesi metanotroflarıdır ve Metilohalobius Metilomarinovum , Ve Metiltermermus Metiltothermaceae familyasındaki metanotroflardır (16, -21, 227). Methylocystaceae familyasında ve Metilocella familyasında Alphaproteobacteria cins Methylosinus ve Methylocystis , Metiloferula ve Metilokapsa 'nın ailesi Beijerinkiaceae'de . Son 15 yılda, çoğul bileşiklerini büyüme için kullanabilen Metilokolella Metilokapsa ve Metilokistis cinslerinde fakültatif metanotroflara ilişkin raporlar artmaktadır Metan (22, -26). Günümüzde ayrıca, Crenothrix ve Clonothrix gibi diğer cinslerden filamentli metanotroflar ve yüksek sıcaklıklarda büyüyen ve düşük sıcaklıklarda yetişen cins Methylacidiphilum'un nonproteobakteriyel (verrucomicrobial) metanotrofları PH da yakınlarda keşfedilmiştir (27). Son olarak NC10 filumunun bir üyesi olan "Candidatus Metilomirabilis oksifizasyonu" zorunlu anaerob olmasına rağmen metan oksidasyonu için dioksijen ürettiğini gösterdi (28,29). Birlikte ele alındığında, bu veriler gezegenimizin birçok ekosisteminde metanotrofik bakterilerin yaygın doğasını açık bir şekilde göstermektedir. Metanotrofların fizyolojisi ve biyokimyası Metanotroflar metan'ı bir enerji kaynağı olarak kullanabilir ve ayrıca (6, 30, 31) için karbon sağlamaktır. Metanın metanole ilk oksidasyonu metan monooksigenaz enzim (MMO) tarafından katalize edilir. Aynı moleküler metan oksidasyon problemine (32, -37) evrimsel olarak bağımsız çözümler üreten MMO, membrana bağlı veya partikülat MMO (pMMO) ve sitoplazmik veya çözünür MMO (sMMO) olmak üzere iki yapısal ve biyokimyasal açıdan farklı formlar vardır . SMMO, aynı zamanda sınıf I ribonükleotid R2 alt-birimi için homolog olan çözünebilir di-demir monooksigenazlar (SDIMOs) (38) olarak bilinen geniş bir bakteri hidrokarbon oksijenaz grubuna ait olan üç komponentli bir bin nuclear demir aktif merkez monooksigenazdır Redüktaz. Methylococcus capsulatus (Bath) (39, -43) ve Methylosinus trichosporium OB3b (44, -47) 'den elde edilen iki çok benzer sMMO sistemi ayrıntılı olarak incelenmiştir. SMMO altı genli bir operon, mmoXYBZDC tarafından kodlanır ve üç bileşene sahiptir: (i) bir α-hidroksilazokinaz ile bir 250-kDa hidroksilaz (19459022) α alt birimlerinin (MmoX) substrat oksijenasyonunun meydana geldiği yerde çift çekirdekli demir aktif merkezini içerdiği yapı, (ii) flavin adenin dinükleotidli 39-kDa NAD (P) H bağımlı redüktaz (MmoC) FAD) ve Fe (19459022) 2 2 protez grupları ve (iii) protein B olarak bilinen bir 16-kDa bileşenini (MmoB) veya protez grupları içermeyen kuplaj / geçitlendirme proteini veya Metal iyonları (39, 48). Protein B için (39, 53, 54) hidroksilaz bileşeni (49, -52), nükleer manyetik rezonans (NMR) -tabutulan yapılar için X-ışını kristal yapıları vardır ve bu bileşiğin flavin alanı için bir NMR türetilmiş yapı vardır Redüktaz (55). Üç bileşen tarafından oluşturulan kompleks, küçük açı X-ışını saçılım analizi ve biyofiziksel olarak elektron paramanyetik rezonans spektroskopi, ultra-santrifüjleme ve kalorimetrik analiz ile yapısal olarak incelenmiştir (56, 57). SMMO'nun katalitik döngüsü kapsamlı bir şekilde incelenmiş ve çift-çekirdekli demir merkezindeki oksijen ve hidrokarbon aktivasyon mekanizmasının anlaşılmasına yönelik mükemmel ilerlemeler yapılmıştır (45) (45, 58, -62). Bununla birlikte, pMMO, bakır ve muhtemelen demir içeren membrana bağlı enzimdir (6, 37, 47, 63, 64). Tip I metanotroflardaki veziküler disklerin şeklini alan sıradışı intrasitoplazmik membranlar ve tip II organizmalarda eşleştirilmiş periferik tabakalar ile ilişkilidir (65, -75). İntrasitoplazmik membranlar pMMO'da zenginleştirilir ve sukroz yoğunluk gradyanlarında sedimantasyon hızı temelinde sitoplazmik membrandan fiziksel olarak ayrılabilir (76). PMMO'nun yapısı ve mekanizması hakkında bir anlayış, enzim çözünürken aktivite kaybından dolayı sMMO için olana göre daha yavaş ortaya çıkmıştır. PMMO, genler pmoCAB tarafından kodlanan yaklaşık 49, 27 ve 22 kDa'lık üç polipeptitten oluşur (77). Metanotroflarda genellikle bu pmo genlerinin birden fazla kopyası vardır (78, 79). Son yıllardaki araştırmalar, doğal pMMO'nun, hidroksilamin oksidoredüktaz ve amonyak monooksigenaz redoks çiftleri (82, -85) için bulunana benzer şekilde, pMMO'ya elektronlar (80, 81) sağlayabilecek metanol dehidrojenazı (MeDH) ile kompleks oluşturduğunu göstermiştir ). Bazı metanotroflar, mesela M. Kapsülatus (Banyo) ve M. Trichosporium OB3b, her iki MMO formunu üretebilir. En bilinen metanotroflar yalnızca pMMO'ya sahiptir, örneğin Metilomonas metanika Metilomikrobiyum album BG8, Metilokistis parvus OBBP ve verrukomikrobik ve NC10 metanotroflar. Beijerinckiaceae ailesindeki, örneğin Metilasella silvestris ve Metiloferula stellata içindeki sadece birkaç metanotrofun sMMO'ya sahip olduğu, ancak pMMO'ya sahip olmadığı (21, 86) MMO tarafından üretilen metanol, bir kalsiyum veya nadir toprak bağımlı pirroloquinoline quinone (PQQ) içeren MeDH (87, -91) ile formaldehite oksitlenir. Formaldehit, metanotrofik metabolizmanın metabolizmasının önemli bir koludur ve bir karbon (C 1 ara ürününün enerji elde etmek için CO 2'ye oksitlenebildiği veya asimile edildiği noktayı temsil eder Biyokütleye dönüştürdü. Formaldehid toksik olduğundan, metanotroflar bu metabolik ara maddenin birikimine karşı kendilerini korumalıdırlar. Formaldehit metabolizması için çoklu yollar metanotroflarda bulunur (2, 26, 92, -96). Örneğin, formaldehitin oksidatif dissimilasyonu, boya bağlı membrana bağlı (93) yoluyla ya da NAD + yoluyla tetrahidrometanopterine (H 4) [97,98] konjügasyonuyla ortaya çıkabilir ] Bağımlı (95, 96, 99) formaldehit dehidrogenazlar. Formül, formaldehidin formaldehit dehidrogenazlar tarafından oksidasyonundan kaynaklanır ve daha sonra metan, biyosentetik reaksiyonlar ve enerjinin oksidasyonu için NADH üreten bir NAD + [bağımlıformatdihidrojenazilekarbondioksit'eoksitlenirHücreiçinesil(100-102)Metanotroflaraynızamandaalfaproteobakteriyelvegammaproteobakteriyelmetanotroflardaaktifolanformaldehitinbiyokütleyeserinveribulozmonofosfat(RuMP)döngülerinefiksasyonuiçinikiyolasahiptirMetanotroflardakikarbonfiksasyonyolaklarıkapsamlıolarakgözdengeçirildi(bkzÖrneğinreferans6) Metanotroflardaki "Bakır Anahtar" Metan karakterizasyonu için erken teşebbüsler MMO'nun hücresel konumu hakkında farklı raporlar vasıtasıyla oksidasyon karmaşıktı. MMO'lar, suşuna ve bazı suşlar için raporlama laboratuvarına bağlı olarak çözünebilir veya membran ile ilişkili olarak tanımlanmıştır. Çeşitli gruplar başlangıçta partikül veya zar fraksiyonunda aktivite bildirdiler (103, 104), buna karşılık diğer gruplar çözünür fraksiyonda aktivite saptamıştı (105, 106). Sonraki çalışmalar hücresel konumun ekim koşullarına göre değiştiğini gösterdi. Oksijen kısıtlamasının çözünür fraksiyonda metan oksidasyonunu indüklediği bildirildi M. Trikosporium OB3b (36, 107). Bununla birlikte, oksijenin düzenleyici faktör olmadığı ve membrana bağlı ve çözünen aktiviteler arasındaki geçişin biyokütle konsantrasyonuyla ilişkili olduğu gösterildi (108). Bu "geçiş" in keşfedilmesinde tanımlayıcı an, Dalton ve meslektaşlarının M büyümeye çalıştıkları zamandı. Parvus OBBP, kemostat kültüründe yüksek hücre yoğunluklarına. M. Parvus OBBP, nispeten düşük hücre yoğunluklarında metan, hava ve nitrat mineral tuzları (NMS) çözeltisiyle birlikte verildiğinde büyümeyi durdurdu. Bununla birlikte, ek eser element çözümü eklendiğinde, kültürler derhal büyümeye başladı. İz element solüsyonundaki "gizli içerik", bakır iyonlarına indirgenmiştir (108). Daha sonra, M. Parvus OBBP, yalnızca bakır iyonlarına yüksek gereksinim getiren pMMO içeriyordu ve M ile o sırada gözlenen aynı yüksek hücre yoğunluklarına ulaşmasına izin verecek bir sMMO içermiyordu. Kapsülatus Banyo ve M. Trichosporium OB3b, bakır sınırlaması altında. Aynı suşlarla karşı karşıya kalındığında, suşlar sMMO'nun ifadesine geçti ve büyümeyi sürdürdü (35, 109). İlginç bir şekilde, bakırın daha önce sMMO içermeyen metanotrof olan Methanomonas margaritae 'nın büyümesini arttırdığı gösterildi, ancak bu orijinal gözlemler hiçbir zaman daha fazla araştırılmadı (110) Dalton ve arkadaşları Gözlemlerini detaylı bir şekilde incelediler ve bu "bakır geçiş" in varlığını kurdular, yani, iki farklı MMO formunun, hem sMMO hem de sMMO'ya sahip olan metanotrof kültürlerinin bakır-to-biyokütle oranına yanıt olarak metanotroflardaki ifadesinin düzenlenmesi PMMO. Metanotrofların metal bağımlı büyümesi üzerine daha önceki gözlemlerin birçoğunu açıklamalarını sağladı. Örneğin, M. Kapsülatus Banyo, sMMO'nun ekspresyonu yalnızca ortamdaki bakır iyonları tükendiğinde yüksek hücre yoğunluklarında gözlemlenirken, fazla bakır iyonlarının ilavesi bu metanotrofun aktif pMMO'yu ifade etmesine izin vermiştir. Daha sonra, Murrell ve meslektaşları moleküler seviyede, düşük konsantrasyonlarda bakır iyonlarıyla büyümenin altında sMMO ifadesi, sMMO gen kümesinin yukarı akışında σ 54 promotöründe başlatıldığını gösterdi ( mmoXYBZDC ). Tersine, yüksek bakır büyüme koşulları altında, sMMO ekspresyonu bastırılmış ve pMMO kodlayan genlerin yüksek seviyelerde ekspresyonu ( pmoCAB ) her ikisine de izin vermiştir. Trichosporium OB3b ve M. Kapsülatus Banyo, pMMO (34, 111, -113) kullanılarak büyüyecektir. Daha ileri araştırmalar bakırın metanotrofik fizyolojiyi ve gen ifadesini daha geniş ölçüde etkilediğini ortaya koymuştur. Örneğin, metanotroflardaki intrasitoplazmik zar içeriğinin büyüme ortamında bakır arttıkça arttığı bulundu (66, 109, 114). Bununla birlikte, bu tamamen beklenmedik değildi: pMMO'nun intrasitoplazmik zarlarda lokalize olduğu göz önüne alındığında, pMMO'nun daha fazla ekspresyonu ve aktivitesi bu zarların mantıksal olarak daha fazlasını gerektirir. Bununla birlikte, daha şaşırtıcı bir şekilde, pMMO'nun ve mxa operon tarafından kodlanan PQQ'ya bağlı MeDH'nin, intrasitoplazmik membranlara sabitlenmiş bir süper kompleks oluşturduğunu ve elektronun, PQQ-bağlantılı MeDH'den pMMO'ya In vivo metan oksidasyonunu tetikleyebilir (80,81). Son bulguyu destekleyerek yakın zamanda, pmo genlerinin ekspresyonu arttıkça arttığını değil, mxa operonundaki genlerin çoğunun da arttığını bulduk ) Proteomik yöntemle, metanın karbondioksit ile oksitlenmesindeki ilave basamaklar, lipid, hücre duvarı ve membran sentezinde rol oynayan proteinler gibi bakır kullanımının artmasıyla aşırı eksprese edildiği de gösterilmiştir ( 66, 115). Tersine, metanotrofların karbonu metandan poli-3-hidroksibutirat'a yöneltme yeteneği, bakırın bulunabilirliğini azaltarak artar (66, 116), bu da metanotrofların enerji metabolizmasının bakır tarafından kontrol edildiğini düşündürmektedir. Böyle bir sonuca Dalton ve arkadaşları daha önce ulaşmıştı ki metanotroflardaki metanotroflardaki biyolojik kütle verimi ve karbon dönüşüm etkinliği, bakır arttıkça, yani metanotroflar sMMO ifade ederek pMMO'yu ifade etmeye geçtiğinde (117) arttığını gösteriyordu. Dış zarın dış yüzeyindeki "yüzeysel" veya proteinler, bazı metanotroflarda bakır bulunması ile de kontrol edilir. Bakır alımına dahil olduğuna inanılan çok sayıda çoklu sitokrom ve proteinin ifadesi de bakırın bulunabilirliği arttıkça değişir ve çoğu durumda azalır (118, -123). Metanotrofların bakırı nasıl tuttuğu üzerine ilave bilgiler, yeni bir bakır depolama proteini ailesinin Csps'in keşfedilmesiyle sağlandı . Trikosporyum OB3b (124). Bu metanotrof, üç Csp'ye sahiptir: Csp1 ve Csp2, ikiz arginin translokaz hedefleme sinyal peptidlerini öngörmüşlerdir ve bu nedenle katlanmanın ardından sitosolik Csp3'den sonra ihraç edildiği düşünülmektedir. Csp1, paketin çekirdeğini gösteren Cys kalıntıları vasıtasıyla 52 Cu 1+ iyonuna kadar bağlanabilen dört heliks demetinin bir tetramerini oluşturur. SMMO'ya geçiş, vahşi türe göre, Δ csp1 csp2 mutantında hızlandırılmış olup, bu proteinlerin pMMO için bakır depolamada rol oynadığını ve bakır sınırlandığında bir dahili bakır kaynağı temin ettiğini düşündürmektedir. Bu koşullar altında, tüm Cu 1+ 'i Cspl'den kolayca kaldırabilen ve dolayısıyla Csp1 bağlı bakırın kullanılmasına yardımcı olan bir rol oynayabilecek mb üretilmektedir. ] Bir bakıra özgü alım sistemi öneren kanıtlar Bakır özgül alım sistemi ve hücre dışı bir bakır bağlama ligandının üretilmesi için ilk kanıt, yapıcı sMMO mutantlarının (sMMO ) fenotipik karakterizasyonu sırasında ortaya çıktı. C ) M. Trikosporyum [1958016] OB3b (125, 126). Phelps ve ark. (126), beş sMMO C mutantını M kültürleyerek izole etti. Trikosporium diklorometan mevcudiyetinde OB3b, metan monooksigenaz ile formetil klorüre dönüşümü için kometabolik dönüşümü takiben bir mutajen olarak işlev görür. SMMO C fenotipine ek olarak, sMMO mutantları bakır alımında kusurluydı (125, 127, 128). Kültür ortamında çözünür olmayan bakır karşısında sert bir artış da gözlendi ve Fe'ye benzer bir ekstraselüler Cu 2+ kompleks yapıcı ajan (lar) üretimine ilişkin spekülasyonlar teşvik edildi Fe 3+ Komplike siderophores (127). Sonraki çalışmalar düşük molekül kütleli bir bakır bağlama ligandının varlığını ortaya çıkarmıştır, ancak bu bileşiğin kimliğini belirlememişti (125, 127). Methanobactin'in İlk Tanımlanması ve İzolasyonu (Bir Bakır Bağlayıcı Bileşik veya "Chalkophore") Biraz paradoksal olarak, "bakır bağlayıcı ligand" veya "bakır bağlayıcı bileşik" önce M'den izole edildi. Kapsülat pMMO'nun arıtılması sırasında ve dolayısıyla yüksek bakır konsantrasyonlarında (73) banyo. Bu bakır bağlayıcı bileşiğin pMMO'dan ayrılması, düşük molekül ağırlıklı bir sarı-flüoresan bakır ihtiva eden molekülü ortaya çıkarmıştır. Bu molekülün renk ve flüoresan özellikleri, düşük bakır ortamda kültürlenen hücrelerde görülen suda çözünebilen pigmentinkine benzerdi (73). Bu suda çözünür pigmentin karakterizasyonu, pMMO ile birleşmiş bakır bağlayıcı bileşik ile özdeş olduğu ortaya çıktı (73, 128). Methanotroflarla suda çözünen pigmentlerin üretimi, birçok tip suşun ilk izolasyonu sırasında 40 yıl önce kaydedildi ancak düşük demirli ortamda kültürlenen hücrelerle ilişkilendirildi (13). Bakır bağlayıcı bileşik, molekülün Gram pozitif bakterilere karşı antimikrobiyal etkinliğine dayanılarak sonuçta metanobaktin (mb) olarak adlandırıldı (129, 130). Tanımlandıktan sonra, bu bakır bağlama bileşiği, bir dizi farklı metanotrofda izole edildi veya tanımlandı; bunlara aşağıdakileri içeren metil bromür albumin BG8 (131), Metiloksisit soyu SB2 (132), Metiloksisit (133), (197) Methylocystis hirsuta Methylocystis M türü (133) CSC1 (133) ve (suş SV97). Mb'lerin kristal yapıları M. Trichosporium [1358.016] OB3b (134,135), M. Hirsuta CSC1 (133) ve Metiloksisit suşu M (133) saptanmıştır. Ayrıca, Methylocystis suşu SB2 (132) ve Mbr'lerin kimyasal yapıları. Rosea (133) çıkarıldı. Bu yorum farazi mbs sıralı genomları ile Methanotroph anlaşılabilir sağladı bu mbs üzerinde durulacak. Methanobactins olarak Chalkophores İşlevsel olarak, mbs siderofor benzer. Sideroforlarda olduğu gibi, düşük bakır koşullarında (125, 126, 128, 136, -138) bakteriler tarafından üretilen düşük moleküler kütleli (<1,200-Da) bileşiklerdir. Yunancadan demir taşıyan ya da demir taşıyan siderophores'in adlandırılmasından sonra, mbsler chalkophores (bakır taşıyan ya da bakır taşıyan) (134, 139). Mbs şu anda bu grubun bilinen tek temsilcisi. Bir bakır alım sisteminin hücre dışı bileşeni rolü ile tutarlı olarak, mbs bakır iyonları için bilinen en yüksek bağlanma afinitelerine sahiptir (2, 131, 135, 138, 140, 141) (19459000) mb'lerin metal bağlayıcı afiniteleri ( K ). [PubMed] TABLO 1 "başlık =" Tablo 1 "/> Trikosporium Metil sistein M türü Methylocystis hirsuta methylcystis CSC1, Metilkistis Methylocystis rosea ve Methylocystis streyn SB2 bir Her ne kadar chalkophores ve siderofor Bir dizi özellik paylaştığında, bu iki metal bağlayıcı bileşik grubu çeşitli şekillerde ayrılabilir. Fitoziderofor domoik asit (142) haricinde, sideroforlar demir sınırlaması altında eksprese edilirken, chalkophores bakır sınırlaması altında eksprese edilir. Birçok siderofor bakır bağlar ve chalkophores demir bağlayabilir (142, -148); Bununla birlikte, farklı metal bağlama sabitleri iki grubu karakterize eder ve bu farka göre ayırt etmek için kolorimetrik analizler geliştirilmiştir (138, 149, 150). Yapısal olarak chalkophores, tipik heterosiklik halkalar ve ilişkili tiyoamit grupları (ve) ile siderophores'den farklıdır. Farklı halka sistemleri, molekülün metal bağlama özelliklerini (131, 133, -136, 138, 148, 151) tanımlamak ve karakterize etmek için kullanılabilen karakteristik UV-görünür emiş, dairesel dikroizm (CD) ve floresan spektral özelliklere sahiptir , -153). Uyarılma enerjisi transferi, ışık toplama komplekslerinin (155, -157) kromoforları için gözlemlendiği gibi mb'deki (136, 154) iki halka arasında meydana gelir ve bu da mbs'nin floresan özelliklerine neden olur. Örneğin, mbs emisyon yoğunluğu halkalardan birinin seçici hidrolizi ile artmakta ve metal eklenmesinin ardından emisyon yoğunluğu sıklıkla artmaktadır (132, 136, -138, 141, 148, 154). Yine, bu özellik hem mbs tanımlamada hem de karakterizasyonu için kullanılabilir Tam uzunlukta mb-OB3b'nin (135 (133) (C), mb- (133) (D) ve mb-SB2 (132) (A), mb- (E). yıldızlarla hepsini olmasa da bazı örneklerde görülmektedir ile Amino asitler işaretlenmiş. ve Çekirdek özellikleri Mbs. AA, amino asit (ler). R grupları Arg, Ile, Met veya Pro olabilir Ancak, açıklanan özelliklerin tamamı mbs'leri tanımlamak için yeterli değildir. Örneğin, Clostridium cellulolyticum mbs'lere (158, -160) benzer bir molekül kütlesi olan bir bakır bağlayıcı sekonder metabolit olan klosthioamid üretir ve benzer mbs'ler, closthioamid tiyoamid gruplarına sahiptir, Cu 2 + ila Cu 1+ 2+ 1+ 1+ 1+ ). Closthioamine ayrıca mb üretimini taramak için kullanılan sıvı veya plaka bir analiz olan bakır-krom azural S (Cu-CAS) tahliliyle pozitif çıkacaktır (138, 149, 161). Bununla birlikte, klosthioamid spektroskopik olarak mbs'den ayırt edilebilir; Örneğin, klostihoamid, altı tiyoamit kısmı ile ayrılmış iki karakteristik fenolik grubundan kaynaklanan, 270 nm'de maksimum tek bir UV-görünür emme mukavemeti gösterir. Dahası, klostihoamit bir dinükleer Cu 1+ kompleksi oluşturabilmektedir. Ayrıca, mbs'lerin aksine, klostihoamid sentezi bakır tarafından düzenlenmez ve mbs'nin aksine, molekülün bir poliketit sintazı ile üretildiğine inanılır (aşağıya bakınız). Benzer şekilde, düşük bakır koşullarında , Paraküs denitrifikalılar aynı zamanda, bakır alımında rol alan düşük molekül ağırlıklı bir 716.18-Da porfirin, kopoporfirin III üretirler (162). Ne yazık ki, ilk yayında bakır bağlanma özellikleri bildirilmemiştir ve herhangi bir takip çalışmalarının farkında değiliz. Coproporphyrin III, tipik bir heme UV-görünür emilim spektrumuna sahiptir ve heme grubu tarafından koordine edilen metale bağlı olarak farklı γ, α ve β maksimumlarını gösterir ve bu mülke dayanan mbs'den ayırt edilmesini sağlar. METAL BAĞLAYICI ÖZELLİKLERİ Bağlama ve İlköğretim Metal indirgenmesi, Bakır mb bağlayan hem Cu 2+ ve Cu 1+ ve mb ile bağlanma pH'ya (135, 172) ve Cu 2+ / Cu'ya 1 + ila mb'ye 136, 141, 172) (). Aşağıda tartışıldığı gibi, mb Cu 1+ ve Cu 2+ 'in çözünür ve çözünmez formlarını kompleks yapabilir. Mb-OB3b ve mb-SB2'ye (136, 141) Cu 2+ ilavesi üzerine termodinamik, spektral ve kinetik çalışmalar yürütülmüştür. Bu çalışmalar (136, 141, 172) mb'nin hızla Cu 2+ 'i Cu 1+ ' e indirgemesi ile karmaşıktır. Cu 2+ 'in apo-mbs'ye eklendiği deneyler için yüksek bağlanma sabitinden sorumlu bakırın oksidasyon durumu bilinmediğinden, bu oksidasyon durumlarının bir karışımının, "Cu 2+ / Cu 1+ " Bu noktadan itibaren. Cu düşük oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b başlangıçta Cu 2+ / Cu 1+ [bağlar oligomer / tetramer olarak (136, 141). Kararlı halden önceki kinetik veriler, metalin ilk bağlanmasının yalnızca halkaların birinde ve buna bağlı tiyoamid üzerinde olduğunu göstermektedir. Mb-OB3b'de başlangıç ​​Cu 2+ / Cu 1+ koordinasyonu oksazolon A'ya ve ardından kısa (8 ila 10 ms) gecikme periyoduna ve daha sonra Oksazolon B (141). Cu yüksek oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b 2+ / Cu 1+ [19459008Cukoordinatları]Bir dimer olarak dimer olarak eklenir ve bunu takiben, mb-OB3b için 0.5 Cu'nin üzerinde 2+ / Cu 1+ ila-mb- OB3b. Mb-SB2, bakır-mb oranına bağlı olarak benzer bir tetramer-dimer-monomer bağlanma dizisini izlemektedir. Mb-SB2 için, Cu 2+ / Cu 1+ 'in ilk bağlanması imidazolon halkasına ve bunu takiben oksazolon halkasına (154) koordine edilir.

Mbs () için metal bağlanma afinite sabitlerini belirlemek için çeşitli yöntemler kullanılmıştır. Cu için afiniteler 1+ banyookuproin disülfonat gibi kromoforik ligand ile iyi kurulmuş bir yaklaşımı (173, -175) kullanarak rekabet çalışmaları ile belirlenebilir. Cu-mb'nin indirgeme potansiyeli ölçümü, daha sonra Cu 2+ afinitesinin hesaplanmasını sağlar. Bu yaklaşımı (133, 135) kullanarak analiz edilen tüm mbsler için Cu 1+ afinitesi ~ 10 M …

Devamını Oku »