24 Kasım 2017,Cuma
Anasayfa » Tag Archives: daha

Tag Archives: daha

Daha güvenilir ve daha güçlü bir lityum-iyon piller

Araştırmacılar, dizüstü bilgisayarlar, güneşli kalpler ve cep telefonları dahil olmak üzere birçok dünyanın elektronik cihazına güç sağlamak için kullanılmış piller iletmek ve emniyetini artırmak için çalışıyorlar. Virginia Commonwealth Üniversitesi, Beşeri ve Toplumsal Bilimler Bitirme Örgütü Puru Jena "Lityum iyon pillerin, bir pil elektrotuyla diğerine şarj edilmesine yardımcı olan sıvı haldeki elektrolitlerden kaynaklanan kararsızlığı bilim insanlarının önleyebileceği bir tehlikedir" dedi . …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Meizu Pro 7 bir kez daha görüntülendi!

ve ve Meizu Pro 7 Plus modelleri hakkında ve Meizu Pro Her gün yeni iddialar ortaya atılıyor. Cihazın ikinci ekranının dışında MediaTek'in yeni Helio X30 çipsetini kullandırmak da bu iddialardan biri. Yine bir ön kayıt dönemi! Pro 7 modelinin yaklaşık 409 dolar, Pro 7 Plus modelinin ise 555 dolar gibi bir olduğu bir fiyat etiketiyle ön siparişe uygun hale gelmiş …

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Twitter polisten daha iyi! – ShiftDelete.Net

Twitter popülerliğini korumaya devam ediyor. Günlük hayatımızın vazgeçilmezleri arasında yer alan Twitter ile kişilerin dünyada yaşananları hızlı bir şekilde takip edebilmek. Twitter olayları keşfetmede, polislerden daha hızlı! Cardiff Üniversitesi tarafından yapılan araştırmaya göre Twitter, şiddetli veya benzeri olayların keşfedilmesi konusunda polislerden daha iyi ortaya çıktı. Yapılan araştırmalar sonucu analizciler, 2011 yılında Londra 'da yaşanan toplumsal ayaklanmalar ile ilgili 1.6 milyon …

Devamını Oku »

IPhone 8 bir kez daha göründü!

iPhone 8 hakkında yeni sızıntılar gelmeye devam ediyor. iPhone 8 'in içinde iddia edilen çerçevesiz ekranın tekrardan gözler önüne serildi. iPhone 8 hakkında yeni sızıntı haberi! Apple'ın bu yılki yeni telefonu ile karşımıza çıkmaya hazırlanıyor. 'in maketi bir kez daha göründü. iPhone 7s Plus ve bambaşka bir tasarım anlayışı ile kullanıcıların huzuruna sunulacak olan iPhone 8 çerçevesiz ekrananıyla farklı bir …

Devamını Oku »

Ölümcül ısı dalgaları daha sık olacak

Nature İklim Değişikliği yayınlanan bir araştırmada, ölümcül ısı dalgaların önünü daha sıkılacak öngörüyor. az 20 gün boyunca hayatı tehdit edici bir sıcaklık yaşadığını tespit etti . 2100 yılına kadar yüzde 74'e yükselebilir. Ölümcül ısı dalgası vakaları artacak Manoa'daki Hawaii Üniversitesi araştırmacıları, 1980 ile 2014 yılları arasındaki yayınlanan hakemli makaleleri ve 900'den fazla veri içeren ölümcül ısı dalgaları örneğine rastladı. Toplamda …

Devamını Oku »

Daha fazla yap! 1.5.0 Android Para Hile MOD APK indir

Yazar: Gökhan Öğütcü Kategori: Android Hileli Oyunlar, Android Macera Oyunları 19 Haziran 2017 377 Görüntülenme 1.5.0 Android Para Hile MOD APK indir Daha Fazlasını Öğren. Oyunda sizin için çeşitli görevleriniz olacaktır. Oyunun amacı, siz de etkileşimde bulunmaktır. Sizde bu eğlenceli oyun oynamaktan aşağı linklerimizden oyunu indirip oynamaya başlayabilirsiniz. İyi eğlenceler. Kaynak

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Eleştirilere daha Fazla Dayanamadı

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir reklam. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Yeni iPad Pro'lar Macbook Pro'dan Daha Hızlı!

Apple'ın geçtiğimiz günlerde düzenlediği etkinlikle iPad Pro ve MacBook Pro modellerini daha hızlı işlemciler ve çeşitli performans iyileştirmeleriyle yenilediği biliniyor. Fakat iş arkadaşlığın tarafı şirketin yeni iPad Pro'ları direkt olarak PC'lerin yerini alması için tasarladığım. Yeni kral iPad Pro! Görünüşe göre bu iddialarında da haksız sayılmazlar. Zira iPad Pro 'yeni modeli, GeekBench testlerinde önceki nesil Macbook Pro modelleri geride bırakmayı …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Google Drive, çok daha gelişmiş bir hale geliyor!

Güneş Enrğı Bulut Storage Hizmetlerinden Birisi olan Google Drive kullanıcılara sunduğu sınırsız fotoğraf ve video yedekleme imkanı ile onun geçen gün daha fazla kullanıcı tarafından tercih ediliyor. Google, 850 milyonun üzerinde kullanıcıya ve 2 trilyondan fazla dosyaaya ev sahipliği yapan Drive'ı çok daha gelişmiş bir hale getiren, Yedekleme ve Senkronizasyon isimli üyemiz çevrimdışıdır. [Da] yeni bir aracı duyurmaya hazırlanıyor. 28 …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Siri IOS 11 ile birlikte daha çok uygulama destekleyecek

Apple'ın yeni mobil işletim sistemi iOS 11 'de Siri önemli yeniliklerin uzmanları bekleniyor. Reuters'in haberini göre Siri, iOS 11 ile birlikte daha fazla üçüncü parti uygulama desteğine verir. Yeni iOS 11 konsepti yayınlandı! Siri'nin kullanım alanı genişliyor! fotoğraf araması ödemeler İma Şartları IOS 10 VoIP çağrısı ve Egzersiz – Uygulamalı Siri ile entegre olmasına izin vermişti. Bu, sanal asistanın doğru …

Devamını Oku »

50 Yıllık Mazda Rotary Motorları: '67 Cosmo Sport ', 93 RX-7, '01 RX-8 ve daha fazlası

Sürüş Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Kadillak Chevrolet Chrysler Kaçma Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Cip Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MİNİ Mitsubishi Nissan Porsche Ram Rolls …

Devamını Oku »

CDK Auto / Mate'i satın alıyor, daha küçük bayilere erişim

       CDK Global Inc.'in bu ayki geliri sırasında CEO Brian MacDonald, yazılım şirketinin küçük mağazalardan bayilik yönetim sistemi işini kaybettiğini itiraf etti. Ancak MacDonald, CDK'nın "pazarın alt ucundaki" konumunu güçlendirmek için harekete geçtiğini belirtti. Üç hafta sonra planı gerçek oldu: CDK, DMS pazarında, iş modeli CDK ve diğer DMS lideri Reynolds ve Reynolds'dan gelen müşterileri kepçeye dayandırmaya dayanan daha küçük …

Devamını Oku »

EVler, on yıl içinde benzinli modellerden daha ucuz görünüyor

Jessica Shankleman Bloomberg 26 Mayıs 2017 12:12 CET LONDRA – Elektrikli otomobiller, konvansiyonel benzin araçlara kıyasla yakında daha ucuza satış yapacak ve sürücüler için anında tasarruf sağlayacak, yeni araştırma şovlarını gösterecek. Renault'dan Tesla'ya olan otomobil üreticileri, elektrikli otomobillerin daha ucuz yakıt ve işletme maliyetlerini, sıfır emisyon araçlarını satın aldığında sürücülerin ödediği yüksek piyasa fiyatlarının yerini almasına yardımcı olmak için uzun …

Devamını Oku »

Ford'un üst kattaki değişiklikleri daha hızlı karar vermeyi amaçlıyordu …

                                                                                                          Jim Hackett, 22 Mayıs 2017 tarihli bu Pazartesi günkü dosya fotoğrafında, Dearborn, Mich. Hackett'de Ford Motor Company CEO'su ve şirket başkanı Bill Ford olarak tanıtıldıktan sonra, otomobil üreticisinin kendisini yeni liderlik haline getirme planları hakkında Associated Press'e seslendi. Ve son kalite sorunlarını gidermek. (AP Fotoğrafı / Paul Sancya, Dosya)      Bu hafta başlarında, Ford …

Devamını Oku »

BA olarak Heathrow kaosu daha kurtarmaya çalışıyor …

                                     Bir Bilişim Teknolojisi sisteminde bir arıza sonrasında British Airways Londra'nın Heathrow Havaalanı'ndan yaklaşık 40 sefer iptal ettiği için binlerce yolcunun Pazar günü başka bir kaosa maruz kaldı.                                                                                 Havayolu, uçak ve mürettebat dışı olmak üzere planlara "çarpma bozucu" nun bulunması için savaştığı için, saat 14.00'den (1200 GMT) önce Londra'nın önemli merkezinden ayrılmak üzere Pazar uçuşlarının yaklaşık dörtte …

Devamını Oku »

Fungal enzimler daha etkin bir şekilde darma için ekip kurarlar …

                                                                                                          Neocallimastix californiae'nin, neocallimastigomycetes'in bir temsilcisinin, taranmış bir elektron mikrografısı (SEM), iyi araştırılmayan erken ayrılan mantar soylarının bir kümesi. Nature Microbiology'de UC Santa Barbara'dan araştırmacılar tarafından yönetilen bir ekip, erken mantar türlerinin, bitki biyokütlesini bozucu enzim kompleksleri oluşturabileceğini ilk kez keşfetti. Ekip iki US Department of Energy (DOE) Bilim Ofisi Kullanıcı İmkanlarının yeteneklerini kullandı: DOE …

Devamını Oku »

Mark Fields'ın beş nedeni daha görevden alındı ​​

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Mark Fields'ın devrilmesinden bu hafta başlarında Ford Motor Co.'nun CEO'su olarak çok şey yazıldı. Fields, Temmuz 2014'te devralındığından beri konuşanların çoğunluğu şirketin hisse fiyatına yaklaşık yüzde 40 oranında odaklandı. İş dünyasından basın ve Wall Street analistlerinin çoğu bu sayıya baktı ve Tesla'nın hisse fiyatıyla karşılaştırdı – şu anda, …

Devamını Oku »

Elektrikli otomobiller on yıl içinde benzinli modellerden daha ucuza gelecek

Akülü arabalar yakında konvansiyonel benzinli araçlara kıyasla daha ucuza geçecek ve sürücüler için anında tasarruf sağlayacak yeni araştırmalar gösterilecek. Renault SA'dan Tesla A.Ş.'ye olan otomobil üreticileri, uzun zamandan beri, sıfır emisyon araçlarını satın aldığında sürücülerin ödediği yüksek piyasa fiyatlarının yerini değiştirmeye yardımcı olan elektrikli otomobillerin daha ucuz yakıt ve işletme maliyetlerini ileri sürdü. Şimdi Bloomberg New Energy Finance'in araştırması, pil …

Devamını Oku »

Japon laboratuvarının 'değer bilincine sahip' SSD'leri daha uzun sürüyor …

                                  Japonya'nın Takeuchi Laboratuarı, görüntülerin rakiplerinden daha hızlı tanıdığı ve disklerin çalışma ömrünü de uzattığını söylediği "değer farkında" bir yarı iletken disk önerdi.                  Katı hal diskleri yaşlandıkça bozulur, çünkü silisyumun kendisi zarar görmeden ve daha çok hataya eğilimli hale gelmeden önce katılan yarıiletkenleri çok fazla sarsabilir. Sürücüler denetleyicileri bunu bilir ve bir hücrenin güvenilmez hale gelmeye başlayacağını bildiren …

Devamını Oku »

Daha mutlu biri olmanızı sağlayacak 5 sağlıklı değ …

                     2017-05-25 19:01:00                                                                      Tüm insanlık olarak çağımızın en büyük sorunsalı mutlu olmak. Öyle ki mutlu olmak peşinde koşarken mutlu olduğumuz zamanların safra farkında olmayıp, üzerinden atlıyoruz. Oysa mutlu olmak belki de bir sonuç değil, bir süretir. Bu yazıdaki mesajlar kendi içerikleriniz arasındadır. 1- Kendinizi değiştirin. Günlük hayatta birçok olay ve uyarana maruz kalıyoruz. En yakınımızdaki insanlardan, …

Devamını Oku »

En Güzel Boyfriends, Küçük Hareketleri Daha Fazlası Görür …

@criene En iyi sevgililer sizinle ilgili yorum yapan kişilerdir. Instagram resimleri. Önemli olduğu için değil, fakat sizi sevdikleri ve yaptıklarını bildiklerini hatırlatmak istedikleri için. En iyi sevgililer, sizinle kendi kendine yetişmeye istekli kişilerdir ve sen, mutlulukla "kendi şeyini yap" için zaman ayırıp, aileni etkilemek istemektedir. Etiketlerini gömleğinin içine sokacak olan onlar, bir takvim günü her defasında planlayacak olanlardır. Gecenin bir …

Devamını Oku »

Yirmi binde / kenar boşluksuz resim Bizi nasıl kurtaracağımıza kalp kırıklığı. Herkesin bize aşık olabileceğini anlamayan olanlar. Güzelliğimizi, kusurlarımızı, derinliklerini ve kalanları görüyoruz. Yeniden hazır olmamızı bekleyen olanlar bize hak ettiğimiz sevgiyi, yoksun olduğumuz aşkı ve verebileceğimiz sevgiyi gösterebilirler. Ağlamamızda bile, başarısız olduğumuzda bile, kendimizden hoşlandığımız tek bir şeyi bulamayacağımız zaman bile güzel olduğumuzu söyleyen kişilere. Yavaş yavaş bizi tekrar inandıranlar; Hayatta, sevgide ve potansiyelimizde. Bilmeden bizi sadece bizi dinleyip dinleyerek ve orada hiçbir yere gitmemelerini sağlayarak rahatlatarak orada olmak suretiyle hayata döndürenler. Rüyalarımızı, görüşlerimizi ve planlarımızı değiştirmemize rağmen, hayatlarımızda anlam bulmak için uğraştığımızda bile kendimizi anlamadığımızda bile bizi anlamaya çalışanlara. Herkes uzaklaştığında yanımızda olanlara. Bizi mutlu ve eğlenceli olmayı beklemeyenler, acı çekmemiz veya acı çekmememiz için bizi suçlamayanlar. Aşkın gerçekte ne olduğunu bize gösterecek kişilere. Çubuğu çok yüksek kılan, metinlerimize zamanında cevap veren ve konuşmayı sürdüren olanlar, meşgulken bile bizi görmeye çalışan olanlar, gerçekten sordukları için derin sorular soran olanlar Bizi tanımaya ilgi duyuyoruz, mazeret bulamayan ya da bir şeyler ters gittiğinde çok kolay vazgeçenlere ve bizi gerçekten isteyenler bizimle olmak için ne gerekiyorsa yapacaklarını hatırlatanlara Sonsuza dek kalamayacakları halde, sevilmeyi hak ettiğimizi ve fazla talep etmediğimizi anlamamız için [19459109] iyileştirmek için bizim için yeterince uzun kalmış olanlara. Kalplerimizi kıranların bize karşı doğru olmadığını, bize saygı duymadığını, bizi takdir etmediklerini ve bize nasıl davranacaklarını bilmediklerini göstermek için hayatımıza girenler. Sana gerçekten ihtiyaç duyduğumuz zaman geldiğiniz için teşekkür ederiz. Sevgiye layık olduğumuzu ve istediğimizden daha büyük bir sevgiyi gösterdiğiniz için teşekkürler. Bize umut verdiğiniz için teşekkür ederiz. İnancımızı yenilediğiniz için teşekkür ederiz. Korkusuz olduklarından ve diğerlerinin korktuğu her şeye çok teşekkür ederim. Bize yarı sevgi ya da neredeyse ilişkiler ya da mazeretler ya da maybes için yerleşmemenizi hatırlattığınız için teşekkür ederiz. Bize öncelik verilebileceğimizi göstermiş olduğunuz için teşekkür ederiz. Bizi sevenlerin hep bizi ilk tercihte bulunduklarını hatırlattığı için teşekkür ederim. Bizi gülümsettiğiniz için teşekkür ederiz. Bizi güldürdüğün için teşekkürler.

Devamını Oku »

Güneş pilleri, yeni malzemeler sayesinde daha verimli …

                                     İsveç'teki Lund Üniversitesi'nden ve Çin'deki Fudan Üniversitesi'nden araştırmacılar, gelecek vaat eden güneş pilleri materyali olan perovskiti kullanarak yeni bir yapısal organizasyon başarıyla tasarladılar. Çalışma, güneş enerjisi hücrelerinin, materyalin kenarda durarak kendi kendine organize olma kabiliyetleri sayesinde etkinlikte arttığını gösteriyor.                                                                                 Günümüzdeki araştırma çalışması, güneş hücreleri bağlamında yeni ve umut verici bir materyal olan perovskite ile ilgilidir. Bununla …

Devamını Oku »

Apple: "Hayat iPhone'la daha kolay!"

     Android 'den iOS ' bir geçmişi isteyen başlatmak için hazır web sayfalarında güncelleyen Apple bu sayfada Android kullanıcılarına seslendi. "Hayat iPhone'la daha kolay Bu, telefon açtığınız andan başlıyor" yazısı, güncellenen web sitesinde gösteriliyor. iOS'a geçiş sayfası güncellendi Güncellenen web sitesinde aşağıya doğru inedede "Neden iPhone" sorusuna verilen birbirinden farklı yanıtı görüyoruz. Bir bir bölümde Mesajlar uygulaması anlatılırken, bir bölümde …

Devamını Oku »

Farley'in daha geniş rolü, Avrupa'da başarı için bir ödüldür

Farley, zorlu bir Avrupa pazarında Ford'a istikrarlı bir kâr sağladı. Fotoğraf kredisi : Bloomberg İlgili Öyküler Ford'un Avrupa operasyonlarının başında oldukça başarılı iki yıl geçtikten sonra Jim Farley, otomobil üreticisinin Dearborn'daki ABD karargahına büyük bir sorumluluk dizisi ile geri dönüyor. Ford, Pazartesi günü bir bildiride 54 yaşındaki Farley'in denetleyeceğini söyledi: • Ford'un Amerika'sı; Avrupa, Orta Doğu ve Afrika ve Asya …

Devamını Oku »

Android'de hangi kilit daha çok kullanılıyor?

Güvenlik sözcüğünün kime ait bazı zamanlarda gerçekleri de göz önüne seriyor ya da akıllı aygıtların sunduğu güvende olduğu gibi sahte düşüncelere kapılabiliyoruz. iPhone 6S'te NFC aktif oldu! Android'de şifreleme oranları Fakat bu normal bir durumuşarak standart bir akıllı telefon kullanıcısı direkt olarak uygulamalardan faydalanmak, arkadaşlarıyla iletişimde olmak ve güvenlik gibi önemli konular pek de düşünmemek istiyor denebilir. Bunu Google'dan G …

Devamını Oku »

Nadir Apple-Ben beklenenden daha az Almanca alıyorum …

                                                                           için                                1976'dan bu yana sekizden birinin çalıştığı bir antika Apple Computer 1, açık artırmada 180.000 ila 300.000 avro arasında tahmini fiyatın altında 110.000 euro getirdi      Steve Jobs'ın dünyaca sarsan şirketlerinden 40 yıl önce üretilen ilk bilgisayar olan nadir bir Apple-1, cumartesi günü Almanya'daki açık artırmada beklenenden az satıldı.                                                                       Dünyada sadece sekiz …

Devamını Oku »

Daha iyi yönetim vasıtasıyla mavi karbonu atmak …

                                                                                                          Utah State University ekolojisti Trisha Atwood, bitki örtüsüyle kaplı kıyı yaşam alanlarında mavi karbonun tutulmasını araştırıyor. Kredi: Peter Macreadie, Deakin Üniversitesi      Bitki örtüsü bulunan kıyı alanları içerisinde karbon depolarının yönetimine odaklanmak, küresel ısınmanın bazı yönlerini hafifletmek için bir fırsat sağlar. Quinney Doğal Kaynaklar Koleji ve Ekoloji Merkezi'nden Utish State Üniversitesi Su Havzaları Bilimleri …

Devamını Oku »

Teknik ve Otomobil Üreticileri Arasındaki İşbirliğini Artırmak Herkes İçin Daha İyi

Silikon Vadisi ile otomobil endüstrisi arasında bir savaş ortaya çıktığına dair bir anlatım yapılmıştır. Teknoloji endüstrisinde kullanılan hype makinesi, dünyanın sansasyonel sermayenin desteklediği girişimlerin, asırlık görevdeki görevlileri rahatsız eden ve yok eden bazı sihirli teknolojiyle birlikte görüneceğine inanmasını istiyor. Kaynak

Devamını Oku »

Spotify daha akıllı olacak! – ShiftDelete.Net

Spotify hakkında önemli gelişmeler yaşanıyor. Milyonlarca kullanıcısı olan Spotify şirket, Al Teknolojisinde önemli bir yere sahip Niland ile birlikte önemli bir ortaklığa imza atacağını duyurdu! Spotify daha akıllı olacak! Yapılan bu hamle ile birlikte şirket yetkilileri, kullanıcılara dinledikleri müzik zevkine göre daha sağlıklı önermeler ile karşımıza çıkacak. 2014 Paris 'te kurulan Niland kullanıcıların kişisel zevklerine uygun müzik önerileri ön plana …

Devamını Oku »

Tüketiciler ödüllendirmeden daha fazla risk görüyorlar …

                                                                                                          Gizli ikna tekniklerini inceleyen uzmanlardan Chang-Dae Ham, Illinois Üniversitesi'nden reklam profesörü olan Chang-Dae Ham, çevrimiçi olarak bizi takip eden kişiselleştirilmiş reklamcılığın, risk algılamalarını ve gizlilik kaygılarını ortaya çıkarma biçiminde "çok özel bir tür" olduğunu söylüyor. Kredi: L. Brian Stauffer, Illinois Üniversitesi Haber Bürosu      Kişiselleştirilmiş reklamlar artık çevrimiçi olarak bizi takip ediyor ve içeriği …

Devamını Oku »

Normal yazdan daha sıcak daha geliyor

                                                                                                          Ed Tirone, 18 Mayıs 2017 Perşembe günü Hoboken, NJ'de yüzünün üzerinde ıslak bir bezi silmek için iskele üzerinde okumaktan bir ara veriyor. Muhabirler, eyalet çapındaki sıcaklıkların Perşembe günü 90 derecenin üzerine çıkabileceğini ve trendin Cuma gününe kadar devam et. (AP Fotoğrafı / Seth Wenig)      ABD. Forecasters, Texas'ın Montana'ya kadar uzanan bir dizi ülkedeki …

Devamını Oku »

MOF'ler suyun gazdan alınması için daha iyi bir yol sağlar

                                                                                                          Metal-organik bir çerçeve ile elde edilen enerji verimli gaz kurutma. Kredi: © 2017 Mohamed Eddaoudi      Suya dayanıklı metal-organik çerçevelerin üretilmesinde bir gelişme, suyun gazlardan verimli bir şekilde çıkarılmasını sağlar.                                                                                 Metal organik çerçevelerin (MOF) suda dengeli olamayacağı konsepti, suyun kuru gaz akışlarına seçici ve etkili bir şekilde adsorbe olabilen bir MOF'ın …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

Uçakta dizüstü bilgisayar yasağı konulu görüşmeler yasaklanmadı, daha fazlası …

                                                                                                          Bu 11 Ağustos 2006 dosya fotoğrafında, Londra'ya giden yolcular, Fransa'nın güneybatısındaki Biarritz havalimanında dolaşıyorlar. ABD ve Avrupalı ​​yetkililer, 17 Mayıs 2017 Çarşamba günü ABD'den uçaktaki dizüstü bilgisayar ve tabletlerin Avrupa'daki uçakları dahil edecek şekilde genişletilmesini planlıyor. (AP Fotoğraf / Bob Edme, Dosya)      ABD'li uçuşlar için önerilen ABD dizüstü bilgisayarları ve tablet yasağı Çarşamba …

Devamını Oku »

Yeni hesaplama araçları daha hızlı ve ucuza olanak tanır …

                                     Finlandiya'nın VTT Teknik Araştırma Merkezi liderliğindeki SEMTEC projesi ile daha hızlı, daha doğru ve çevik hesaplama araçları ve yöntemleri geliştirildi. Bu, elektromekanik endüstride pahalı ve zaman alan prototip fazın ortadan kaldırılmasını sağlayacaktır. Finlandiya sanayii, daha düşük maliyetle piyasaya girecek elektrik motorları, jeneratörler ve transformatörlerin daha hızlı geliştirilmesi sayesinde rekabet avantajı elde edecektir. Proje ayrıca daha sessiz ve daha enerji …

Devamını Oku »

Bilim adamları akıllıca daha iyi akü sistemi öneriyor …

                                     Akıllı evlerin akıllı akülere ihtiyacı var. Mevcut sistemler aşırı güç kullanırlar; bu da pillerin ve güç sağladıkları aygıtların ömrünü kısaltabilir. Gelecekteki piller, sorunu hafifletmek için istihbarat desteğini alabilir.                                                                                 Pekin, Çin'de bulunan ortak araştırma ekibi pillerdeki güç tüketimini optimize etmek için yeni bir programlama çözümü önerdi. Otomasyon Enstitüsü, Çin Bilimler Akademisi ve Pekin Bilim ve Teknoloji Üniversitesi'ndeki …

Devamını Oku »

Toplumsal bağlar hayvanlara daha uzun yaşama yardımcı olur

                                                                                                          Rhesus makak bir anne (sağda) yetişkin kızı (solda) ve yavrularıyla. Kredi: Lauren Brent      Büyük aileler ve güçlü sosyal bağlar hayvanların daha uzun yaşatılmasına yardım ediyor, yeni araştırmalara göre.                                                                                 Kadın rhesus makakların büyük bir çalışmasında, Exeter Üniversitesi'nden bir bilim adamı, yakın akraba yakınlarının ortalama ömrünün daha iyi olduğunu tespit etti. Bununla …

Devamını Oku »

Amerikan kestane kurtarmaları başarılı olacak, ancak daha yavaş …

                                                                                                          Olgun kestane ağaçları genelde 50 fit için düz ve branşsız büyümüş ve yer seviyesinin birkaç metre üzerinde 14 feet'lik bir gövde çapıyla 100 fit yüksekliğe kadar büyüyebiliyordu. Üç yüzyıl boyunca Appalachian Dağları yakınlarındaki ahırlar ve evler Amerikan kestane ağacından yapıldı ve ağaçlar vahşi hayat ve insanlar için tonlarca ton gıda tedarik ettiler. Kredi: Amerikan …

Devamını Oku »

Bitkiler rekabet edince daha fazla gen devreye girdi

                                                                                                          Bir yonca potansiyel olarak dünyadaki bitki etkileşimleri üzerindeki sırların kilidini açabilir. Kredi: Michigan Eyalet Üniversitesi      Bazı insanlar şarap için kuzey California'ya seyahat ediyor. Bununla birlikte, Michigan State Üniversitesi bitki biyologu Maren Friesen, yonca için Altın Devlet'e doğru ilerliyor.                                                                                 Ekoloji Dergisi'nin (19459017) özel sayısında yer alan bitki çeşitliliği ve rekabette alınan …

Devamını Oku »

'Fi'de ateşli bir sahne daha

                     2017-05-14 12:07:00                                           Dijital ortamda yayınlanmış 'Fi' dizisinin 8 ve 9'uncu bölüm fragmanları yayınlandı. Yeni bölümde Serenay Sarıkaya ve Mehmet Günsür'ün cesur sahnesi dikkati çekti. 'Fi' dizsinin yeni bölüminde 'Duru' karakterine hayat veren Serenay Sarıkaya, 'Deniz' karakterini canlandıran Mehmet Günsür ile cesur sahnelerde yer aldı. Güzel oyuncu, daha önce açıklama, sevgilisi Kerem Bürsin bu sahneleri kıskanmadığını söylemişti. 'Duru'nun,' …

Devamını Oku »

Fizik, zorlu işlemler için daha hızlı çözümler getirebilir …

                                                                                                          Eduardo Mucciolo, Central Florida Üniversitesi Fizik Bölümü Profesörü ve Başkanı. Kredi: Central Florida Üniversitesi      Kaynak

Devamını Oku »

"Yeni otomobil markaları kurmaktan daha para kazanmanın daha kolay yolları var"

Milyar meraklıları nadiren ama daha hızlı büyüyor. Sekiz yıl önce, toplamda 2 trilyon dolar değerinde, 800'den daha az kişi vardı. Bugün, yaklaşık 2 milyar dolar var, toplamda 8 trilyon dolar değerinde. Enerji, mali, mülkiyet, ilaç, teknoloji ve diğer 'geleneksel' alanlarda bol miktarda var. Ardından, milyarlarca doları soya sosu, kaşmir, domuz yetiştiriciliği veya bezler gibi daha tüylü ürünlerden üretenler de var. …

Devamını Oku »

Galaxy S8 nasıl daha hızlı şarj edilir?

Samsung Galaxy S8 ettik Galaxy S8 Artı birçok Android cihazda Olduğu gibi Hızlı Şarj Özelliği ile Birlikte geliyor. Tabii ki Galaxy S6 ve Galaxy S7 modelleri Galaxy S8 hızlı şarj özelliğini bazı durumlar altında aktif hale getirmiyor. Öte yandan bataryanızı oğluyla doldurmak için ufak bir ipucu var . Galaxy S8'in hızlı bir şekilde şarj olması için gerekli olan gerekenler! Galaxy …

Devamını Oku »

Vesivirus 2117 capsids daha fazla cl …

J Gen Virol. 2017 Ocak; 98 (1): 68-76. Michaela Conley, 1 Edward Emmott, 2 Richard Orton, Daniel G Carneiro, 1, ‡ Kazuyoshi Murata, 3 3 2 Grant S Hansman, 3, § ve David Bhella ] 1 Tıbbi Araştırma Konseyi – Glasgow Üniversitesinde Virüs Araştırma Merkezi, Sir Michael Stoker Binası, Garscube Kampüsü , 464 Bearsden Yolu, Glasgow G61 1QH, İngiltere 2 …

Devamını Oku »

Bir otomobil sigortacılığına bağlılığınız, 10 yılda 1,400 santim daha kötüye gitmesini sağlar

Otomobil sigortası sağlayıcılarını değiştirmede başarısız olan sürücüler, etrafında dolaşanlara kıyasla on yıl içinde 1,400 pound fazla ödeme yapmıştır. Araştırma ajansı Consumer Intelligence tarafından 9 bin sürücünün denetlenmesi, ilk otomobil sigortacısıyla aynı otomobil sigortacısına sadık kaldıklarında, sağlayıcıları değiştirenlere kıyasla ortalama £ 63 kaybetti. Araştırmacı, aynı tedarikçiyle 10 yıl boyunca kalan sürücülerin £ 1,400 kaybedeceğini tespit ettikçe, daha uzun sürücüler aynı sağlayıcıda …

Devamını Oku »

Gelişmekte olan tamamlayıcı metal oksit yarı iletken (CMOS) tabanlı, yüksek yoğunluklu mikroelektrod dizisi (HD-MEA) Cihazlar, subselüler seviyede yüksek mekansal çözünürlük ve çok sayıda okuma kanalları sağlar. Bu cihazlar, çok sayıda elektron tarafından tespit edilen her nöronla çok sayıda nöronun ekstraselüler aktivitesinin aynı anda kaydedilmesine olanak tanır. Kaydedilen sinyalleri analiz etmek için, spike olayları, "sivri uçlu sıralama" olarak adlandırılan bir süreç olan bireysel nöronlara atanmalıdır. Bir dizi kaynak sinyalinin doğrusal bir karışımı olan gözlemlenen sinyaller grubu için bağımsız bileşen (IC) Analiz (ICA) verileri körü körüne demixlemek ve bireysel kaynak sinyallerini çıkarmak için kullanılabilir. Bu teknik, nöronal kaynakları ayırmak için denetlenmeyen bir yöntemi temsil ettiği için HD-MEA kayıtlarındaki başak sıralama sorununu hafifletmek için büyük bir potansiyel sunmaktadır. Ayrılan kaynaklar veya IC'ler, daha sonra, tek nöron sinyallerinin tahminlerini oluşturur ve IC'ler üzerindeki eşik algılama, sıralı başaklanma sürelerini verir. Bununla birlikte, ekstraselüler nöronal kayıtların ICA gerekliliklerini ne derece karşıladığı bilinmemektedir. Bu yazıda, ICA'nın HD-MEA kayıtlarının sivri olarak sınıflandırılmasına uygulanabilirliğini değerlendiriyoruz. Yüksek zaman-zamanlı çözünürlükte kaydedilen hücre dışı sinir sinyallerinin analizi, kaydedilen verilerin tamamen doğrusal bir karışım olarak modellenemediğini ortaya koymaktadır. Sonuç olarak, ICA nöronal sinyalleri tamamen ayıramaz ve HD-MEA kayıtlarında başakta sıralama için tek başına bir yöntem olarak kullanılamaz. Simüle veri kümeleri kullanarak ICA'nın demixleme performansını değerlendirdik ve performansın nöronal yoğunluk ve başak amplitüdüne kuvvetle bağlı olduğunu bulduk. Ayrıca, ICA'nın en ciddi sınırlılıklarının üstesinden gelmek için postprocessing tekniklerinin nasıl kullanılabileceğini gösteriyoruz. Anahtar Kelimeler: sivri ayırma, çoklu birleştirme, çoklu elektrod. Bu çoklu boyutlu nöronal kayıtların hızlı bir şekilde şiddetlenmesini kolaylaştırmak için bu ileri işlem teknikleriyle birlikte ICA, uygulanabilir bir yöntemdir.

nevrofizyoloji araştırması sinir aktivitesinin ekstraselüler kayıtları, hücrelerarası etkileşimi incelemek ve fizyolojiyi daha iyi anlamak için desenler atmak için önemli bir araç haline gelmiştir Ve nöronal ağların bilgi işlemesi. Çok birleşimli kayıtlarda elektrotlar, çok sayıda bireysel nöronun eşzamanlı aktivitelerini izler. Analiz için, bireysel nöronların başak eğrileri daha sonra kaydedilen veriden çıkarılmalıdır; bu süreç genellikle "başak toplama" olarak adlandırılır (Lewicki, 1998). Genellikle, …

Devamını Oku »

VW CEO, maliyet tasarrufuyla ilgili daha fazla sendika çatışması görüyor

Matthias Mueller: "Şüphesiz yolumuz zor." Andreas Cremer Reuters 10 Mayıs 2017 12:05 CET HANOVER, Almanya – Volkswagen Group'un üst düzey yönetimi, dizel emisyon skandalını takiben stratejik bir değişikliğin finanse edilmesine yardımcı olmak için otomobil üreticisi bir verimlilik sürücüsü önermesi nedeniyle emek liderleriyle maliyet tasarrufu konusundaki tartışmalarını bekliyor, CEO Matthias Mueller sözü geçen. Mueller, Çarşamba günü yapılacak yıllık ortak toplantı toplantısında …

Devamını Oku »

Okulların Şampiyonları Takımları Belli Oldu! Avanos, Nevşehir'de düzenlenen ve 51 KKTC'den 121 takım, 594 sporcunun yarıştığı Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Düzenlenen ödül töreniyle sona erdi. Spor Genel Müdürlüğü Okul Sporları Şube Müdürlüğü'ne, Türkiye 2007 yılından bu yana, Satranç Federasyonu ve Türkiye İş Bankası'nın destekleyicileri ile birleştiğinde Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Avanos Atatürk Spor Salonu'nda gerçekleştirilecek ödül töreni ile sona erdi. 3 Mayıs 2017 akşamında final yarışmasının ödül töreni; Nevşehir Valisi İlhan Aktaş, Gençlik Spor İl Müdürü Mustafa Ünlüer, Türkiye İş Bankası Kurumsal İletişim Müdürü Suat Sözen, Türkiye Satranç Federasyonu Başkanı Gülkiz Tülay, Avanos Gençlik Hizmetleri ve Spor İlçe Müdürü Kerem Yılmaz, TSF Başkan Vekilleri Prof. Dr. Yusuf Doğruer ve Aşkın Keleş , Yönetim Kurulu Üyesi Ümit Şifaver, Nevşehir Okul Sporları Şube Müdürü Aslan Uçar, Okul Sporları Şefi Hüseyin Karatut, Türkiye İş Bankası Kurumsal İletişim Birim Müdürü Müge Nevşehirli Veziroğlu, TSF Nevşehir İl Temsilcisi Birsen Babacan Çengel, antrenörler, öğretmenler, veliler, sporcular ve çok sayıda Davetlinin katılımıyla gerçekleşti. Spor Genel Müdürlüğü'ne düzenlenen Eğitim Takvimi, Satranç Türkiye Birinciliği'ni, Türkiye İş Bankası'nın destekleyicisi ve öğrencilere verdikleri hediyelerle ilgili daha fazla bilgi almak TSF Başkanı Gülkız Tulay, okul Larda satranç sporunun daha fazla yerinde alması ve öğrencileri bu sporla buluşturmayı çok önemsedikleri açıklama bulundu. Tüylü sözleşmeyi şöyle sürdürdü: "51 ilimiz ve KKTC'den 121 takım ve 594 öğrencimiz centilmence ve dostça hamle yaptılar 7 tane tur boyunca. Öğrencilerimiz okullarını zirveye çıkarmak için yarıştılar and 경쟁in birlik ve beraberlik ile iç içe geçtiği bir final heyecanı yaşattılar bizlere. Bu yazıda, yazarların yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, Açılış konuşmalarının ardından, 6 kategoride ilk dört dereceyi, 6 kategoride ilk dört dereceyi Elde Edilme Formu. Ders >> Küçükler Kızlar (19459006) >> Yazan: Küçükler Kızlar – – Küçükler Genel / Yıldızlar Kızlar – Yıldızlar Genel / Gençler Kızlar – Gençler Genel Küçükler Kızlar

Özel Kocatürk Ortaokulu, Manisa Kılıçarslan Ortaokulu, Samsun Çerkezköy Tepe Ortaokulu, Tekirdağ Mağaracık Ortaokulu, Hatay Küçükler Genel Özel Bursa Bahçeşe Bahçeşehir Koleji Ortaokulu, Ankara Özel Bursa Bahçeşehir Ortaokulu, Bursa ] Kaynak

Devamını Oku »

PSA'nın Tavares, Opel'in 2017'de daha fazla kayıp düştüğünü görüyor

Laurence Frost ve Gilles Guillaume Reuters 10 mayıs 2017 11:55 CET PARIS – PSA Group, Fransız otomobil üreticisi General Motors'tan işletme alanına girerken Opel'in 2017'de daha fazla para kaybetmesini bekliyor, CEO Carlos Tavares Çarşamba günü söyledi. Tavares, General Motors'ın liderliğinde belirli başarılar elde ettiğini söyledi. Tavares, Paris'teki PSA'nın yıllık genel toplantısında hissedarlara, satışların büyümesini vurguladı ve GM markasındaki kayıpları azalttığını …

Devamını Oku »

Mueller, maliyet tasarrufuyla ilgili olarak VW sendikalarıyla daha fazla çatışma görüyor

Matthias Mueller: "Şüphesiz yolumuz zor." Andreas Cremer Otomotiv Haberleri Avrupa 10 Mayıs 2017 12:05 CET CEO'su Matthias Mueller, dizel emisyon skandalını takiben stratejik bir değişikliğin finanse edilmesine yardımcı olmak için verimlilik güdüsünü artırdığından, Volkswagen Group'un üst düzey yönetici, emek liderleriyle maliyet tasarrufu konusundaki tartışmalara devam etmesini beklemektedir . Mueller, Çarşamba günü yapılacak yıllık ortak toplantı toplantısında "Yolumuz şüphesiz zorlu, sürtünmeye …

Devamını Oku »

Facebook, thr çevirmek için daha hızlı bir yol buldu …

                                                                                                  Facebook, araştırmacılarının materyali sosyal ağında daha hızlı ve daha doğru çevirmesi için yapay zekayı kullanmanın yeni bir yolunu bulduğunu söylüyor.                                                                       Bu, Facebook kullanıcılarının nihayetinde her şeyi, yalnızca yazıya değil, videolara değil, tercih edilen dile çevrilmiş halde gördükleri anlamına da gelebilir. Facebook şu an için yayınları 45'den fazla dilde çeviriyor ancak CEO'su Mark …

Devamını Oku »

Alaska'nın tundra ı almak daha fazla CO2 serbest …

                                                                                                          Bilim adamları, Arctic, gezegenin geri kalanı kadar iki katı hızla ısınmakta ve Alaska'nın üç yıl üst üste rekor kırdığını kaydetti.      Alaskan tundra, yakaladıklarından daha fazla karbon dioksit yaymaktadır; bu artış, iklim ısınmasını hızlandıracak bir dinamik, Arctic topraklarında sıkışan CO2 depoları yükselen sıcaklıklar tarafından engellendi.                                                                                 Bilim adamlarının sahip olduğu bir soru, …

Devamını Oku »

Stradivarius'u kes mi? Yeni kemanlar daha iyi ses çıkarır: …

                                                                                                          Kredi: CC0 Public Domain      Antonio Stradivari gibi İtalyan ustaların eski kemanlarının yüce itibarı olmasına rağmen, New York ve Paris'teki konser salonlarındaki gözleri kapalı dinleyiciler, yeni enstrümanların sesini tercih ettiğini söylüyorlar.                                                                                 Kemanların en iyi proje seslerinin kemerler üzerinde üzerinde durduğu uzun süren tartışmalardaki en son gelişmeler, ABD Bilim Dergisi tarafından hazırlanan …

Devamını Oku »

Tesla, otomatik pilot için daha fazla veriye ihtiyaç duyuyor!

Elektrikli araç sektörü öncüsü haline gelen Tesla otomobillerinde yerinde çalışmış pilot özelliği sayesinde otonom araçlarının ilerleyen yıllarda kullanıcılara sağlayacağı kolaylıkları şimdiden gözler önüne sermiş oldu. Geçtiğimiz yıl 12 ultrasonik sensöre ve 8 kameraya ev sahipliği yapan ikinci nesil otomatik pilot donanımının duyurusunu gerçekleştiren Tesla, bu sayede bir pilotun araçlarının çok daha iyi bir seviyeye gelmesini sağladı. Ancak, otomatik pilotun sürücüsü …

Devamını Oku »

Toyota, Land Cruiser'ın 230 mph hız rekoruyla bir La Ferrari'den daha üstün olduğunu kanıtlıyor

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             SUV çılgınlığı biraz daha iyi, daha delirmişti. Eski NASCAR şampiyonu Carl Edwards pilotuyla birlikte 2.000 hp (2.000 bg) Toyota Land Cruiser, 230 mph hız rekoru kırdı. Büyük dostum aslında GPS sertifikalı ve 230,02 mil hızla video belgelendi. Toyota, daha hızlı geçebileceğini fakat kullanılabilir alanın tükenebileceğini söyledi. Toyota, bu …

Devamını Oku »

Bundan daha fazla telefon yok!

Akıllı telefonların hüküm sürdüğü günümüzde, Işık Telefon adı verilen model sadece minimalist hazır kurulu tasarımıyla dikkat çekiyor. kredi kartı boyutlarında gerekliyla da şaşırtıyor . Kredi Kartı Boyutları Telefon minimalistliğinde zirve Işık Telefonu Peki o yok, bu yok Işık Telefona ne işe yarayacak mı diyorsunuz? Ürün sadece esas işlevi olan arama yapma özelliğini sunar. Ek olarak, dokuz adet telefon numarası saklayabilir …

Devamını Oku »

Araştırmacılar, popüler Pacif'u çiftleştirme konusunda daha iyi yollar istiyorlar …

                                                                                                          28 Mart 2017'de çekilen bu fotoğrafta, Ulusal Okyanus ve Atmosfer İdaresi'nden bir balıkçılık araştırması biyolojisi uzmanı Bill Fairgrieve, Wash in Manchester'daki bir araştırma tesisinde bir kara balığı tutuyor. Bilim insanları sablefish genetik inceliyor ve daha kolay ve daha kolay hale getirmenin yollarını araştırıyor. Deniz ürünleri için dünya çapında giderek artan bir talebi karşılamak için …

Devamını Oku »

Nürburgring'de 2018 Porsche 911 GT3'ten Daha Hızlı ve Daha Yavaş 5 Otomobil »AutoGuide.com News

Bir kereliğine binlerce kez söylediysek: Nurburgring tur zamanları, bir otomobilin özelliklerinin boşuna bir kıyaslanabilir niteliktedir. Tabii ki, yeni bir tur rekoru yayınlanana ve Cinco de Mayo'daki bir taco kamyon sahibinden daha fazla yol alana kadar. (Bu yazı 5 Mayıs'ta yayınlandı, AutoGuide .com'da iyi arkadaşlarınızda kesinlikle kaybolmadı.) Porsche yeni 911 GT3'ün 12.9'u çevrelediğini açıkladıktan sonra kolektif heyecanımız bir kez daha yükseldi. …

Devamını Oku »

Güvenlik teknolojisi, daha fazla kazayı düzeltmek için pahalı hale getiriyor

       Şeritten ayrılma uyarı sistemleri ve çoklu hava yastıkları gibi güvenlik özellikleri ölüme ve araç çarpmalarına bağlı yaralanmalara engel olur. Ancak kaza sonrasında toplam kayıp olarak kabul edilen araç sayısını da artırıyorlar. Dallas'ın riskli teorinin üst düzey başkan yardımcısı Bob Tschippert, pahalı teknolojilerin araç onarımlarını daha pahalı hale getirdiğini ve bunun sonucunda hasar görmüş bir aracın sigorta şirketi. "Geçmişte bir …

Devamını Oku »

Yaşamın Daha Koyu Tarafını Kucaklamak

Bu makale okuyucular için yararlı olacak kadar eksik görünmediğinden saplama olarak işaretleyin. Katılmıyorum? Burada bir not bırakın. ← Eski revizyon 16:36, 5 Mayıs 2017 itibariyle revizyon Satır 1: Satır 1: – Bugünün toplumuna bakarsanız, insanların çoğunluğunu Güneş'in yavruları olarak göreceksiniz. Bilemedikleri, sevdikleri Güneş'in çılgın bir ikiyüzücüsü olmasıdır. "Ah, kutsanmış Güneş! Bize sıcaklık katıyor ve o kadar parlak parlıyor!" Ah, ancak …

Devamını Oku »

Yeni Porsche 911 GT3 Öncülüğünden Çok Daha Hızlı »AutoGuide.com News

2018 Porsche 911 GT3, önceki modele göre 12,3 saniye daha hızlı Nurburgring ile yarıştı. Alman otomobil üreticisi yeni modeli Porsche 911 GT3'ü, son modelin süresini 12.3 saniyede geçerek 7: 12.7 Nürburgring tur zamanında döndürdü. Yeni parkur odaklı GT3, bu yılın başlarında Cenevre Motor Show'da 500 beygir gücü ve 339 pound-feet spor torku ile başlayarak 3.153 pound ölçekler kazandı. Tur antrenörünün …

Devamını Oku »

Daha fazla ışık ile kimya hızlanır

                                                                                                          Bazı kimyasal tepkimeler aydınlatmanın yoğunluğunun arttırılmasıyla hızlandırılabilir – Varşova Polonyalı Bilimler Akademisi Fiziksel Kimya Enstitüsünden araştırmacılar tarafından gösterilmiştir. Kredi: IPC PAS, Grzegorz Krzyzewski      Işık, birçok kimyasal reaksiyon başlatır. Polonya Bilimler Akademisi Fiziksel Kimya Enstitüsünün ve Varşova Fizik Üniversitesi'nin deney merkezlerinde, ilk kez, aydınlatma yoğunluğunun arttırılmasıyla bazı reaksiyonların önemli ölçüde hızlandırabileceği gösterildi. Burada, araştırmacılar …

Devamını Oku »

IBM'den keşif daha verimli bir petrol sağlayabilir …

                                     IBM bilim adamları geçtiğimiz günlerde bir damla yağın, bir milyarda bir litre litre veya avotörün ölçeğine göre küçük olması halinde damla gibi görünmediğini keşfetti. Daha ziyade, nano ölçekli bir yağ damlacık katı bir yüzeye karşı düz bir film gibi görünür. Bu keşif, petrol endüstrisi tarafından sıklıkla kullanılan simülasyon araçlarının ve tekniklerinin, bu yağ moleküllerini çıkarmak için gereken artan enerjiyi …

Devamını Oku »