17 Aralık 2017,Pazar
Anasayfa » Tag Archives: da

Tag Archives: da

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Google'ın da sanal stres çarkı var

                     2017-06-21 20:55:00                                                                      Eğer elinizdeki stres çarkları size yetmiyorsa, Google'ın hazır strede sanal stres çaylağı oynatabilirsiniz. Google'ı da sarmış olan anlaşılmış bir Stres çarkı çılgınlığı. Reddit sitesi kullanıcıları tarafından keşfedilen sanal stres çarkı, Google'ın arama sonuçları içine saklanmış durumda. Ama sen 'stres çarkı' veya İngilizcesi olan 'fidget spinner' kelimelerini kullanırsanız bu sanal oyuncağı kullanemiyorsunuz. Google'ın arama …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

'Ben bilmem eşim bilir' ihracatta da ilk sırada

                     2017-06-15 10:39:00                                                                      Ufuk Özkan'ın sunumuyla birlikte Kanal D'de ekrana gelen "Ben Bilmem Eşim Bilir", sadece Türkiye'de değil, dünyada da büyük ilgi görüyor. Kanal D'nin fenomenler arasında girmeyi başaran yarışması "Ben Bilmem Eşim Bilir", sadece Türkiye'de değil, dünyada da büyük ilgi görüyor. Biçimlendirme Kanal D'ye ait olup, 2013 yılında dünya pazarına giren "Ben Bilmem Eşim Bilir" …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Tayvan'da da herşeyi ısırdı! (Computex 2017 vLog)

Computex 2017 fuarı her zaman olduğu gibi dolu dolu geçti. Yeni dizüstü bilgisayarlar, oyuncu aksesuarları, x299 ve x 399 platformuna uygun anakartlar, ekran kartları derken birçok yeni ürün gördük. Bu videomuzda ise, Tayvan Taipe i gezmekde olan biteni vLog ile kayıt altına aldık. Computex 2017 vLog! Dilerseniz şarkı sözü eksik ve bir iki harfle yazıtipinde kısmi bırakmayın. Iyi seyirler.

Devamını Oku »

Yasaklasak da mı saklasak

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

Yirmi binde / kenar boşluksuz resim Bizi nasıl kurtaracağımıza kalp kırıklığı. Herkesin bize aşık olabileceğini anlamayan olanlar. Güzelliğimizi, kusurlarımızı, derinliklerini ve kalanları görüyoruz. Yeniden hazır olmamızı bekleyen olanlar bize hak ettiğimiz sevgiyi, yoksun olduğumuz aşkı ve verebileceğimiz sevgiyi gösterebilirler. Ağlamamızda bile, başarısız olduğumuzda bile, kendimizden hoşlandığımız tek bir şeyi bulamayacağımız zaman bile güzel olduğumuzu söyleyen kişilere. Yavaş yavaş bizi tekrar inandıranlar; Hayatta, sevgide ve potansiyelimizde. Bilmeden bizi sadece bizi dinleyip dinleyerek ve orada hiçbir yere gitmemelerini sağlayarak rahatlatarak orada olmak suretiyle hayata döndürenler. Rüyalarımızı, görüşlerimizi ve planlarımızı değiştirmemize rağmen, hayatlarımızda anlam bulmak için uğraştığımızda bile kendimizi anlamadığımızda bile bizi anlamaya çalışanlara. Herkes uzaklaştığında yanımızda olanlara. Bizi mutlu ve eğlenceli olmayı beklemeyenler, acı çekmemiz veya acı çekmememiz için bizi suçlamayanlar. Aşkın gerçekte ne olduğunu bize gösterecek kişilere. Çubuğu çok yüksek kılan, metinlerimize zamanında cevap veren ve konuşmayı sürdüren olanlar, meşgulken bile bizi görmeye çalışan olanlar, gerçekten sordukları için derin sorular soran olanlar Bizi tanımaya ilgi duyuyoruz, mazeret bulamayan ya da bir şeyler ters gittiğinde çok kolay vazgeçenlere ve bizi gerçekten isteyenler bizimle olmak için ne gerekiyorsa yapacaklarını hatırlatanlara Sonsuza dek kalamayacakları halde, sevilmeyi hak ettiğimizi ve fazla talep etmediğimizi anlamamız için [19459109] iyileştirmek için bizim için yeterince uzun kalmış olanlara. Kalplerimizi kıranların bize karşı doğru olmadığını, bize saygı duymadığını, bizi takdir etmediklerini ve bize nasıl davranacaklarını bilmediklerini göstermek için hayatımıza girenler. Sana gerçekten ihtiyaç duyduğumuz zaman geldiğiniz için teşekkür ederiz. Sevgiye layık olduğumuzu ve istediğimizden daha büyük bir sevgiyi gösterdiğiniz için teşekkürler. Bize umut verdiğiniz için teşekkür ederiz. İnancımızı yenilediğiniz için teşekkür ederiz. Korkusuz olduklarından ve diğerlerinin korktuğu her şeye çok teşekkür ederim. Bize yarı sevgi ya da neredeyse ilişkiler ya da mazeretler ya da maybes için yerleşmemenizi hatırlattığınız için teşekkür ederiz. Bize öncelik verilebileceğimizi göstermiş olduğunuz için teşekkür ederiz. Bizi sevenlerin hep bizi ilk tercihte bulunduklarını hatırlattığı için teşekkür ederim. Bizi gülümsettiğiniz için teşekkür ederiz. Bizi güldürdüğün için teşekkürler.

Devamını Oku »

Asena'ya şok! Arabalar da servet de gitti

                     2017-05-17 11:54:00                                           Asena Atalay, eski eşi Caner Erkin'in menkul, gayrimenkul ve futbol kulüpleri için tedbir alınacak konulmasını istedi. Mahkeme, Atalay'ın açtığı davayı reddetti. Ünlü futbolcu Caner Erkin ve Asena Atalay, geçen yıl Ocak ayında İstanbul 2. Aile Mahkemesi'nde anlaşarak boşandı. 6 yaşındki çocuklarının velayeti de annede kaldı. Mahkeme, tarafların imzasına göre tarihsiz boşanma protokolünü tasdik etti. Ancak …

Devamını Oku »

'Beyaz Şov' da flaş gelişme

                     2017-05-09 20:50:00                                           Kanal D'de yayınladı Beyazıt Öztürk'ün sunduğu Beyaz Şov'un eskisi gibi canlı olarak yayınlanması gündeme gelmişti. Yeni gösterimde 15 gün arayla ve yayınıyla ekranlara gelen Beyaz Show, bundan sonra onu her ay ekrana gelecek. Ancak programın eskiden olduğu gibi canlı mı yoksa yine banttan mı yayınlanacağıyla ilgili bir açıklama yapılmadı. Mesut Yar, köşesine taşıdığı konuyla ilgili …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

PI3Kδ ve primer immün yetmezlikler – Avrupa PMC … Özet Birincil immün yetmezlikler, immün sistemin kalıtsal bozuklukları, Genellikle lenfosit gelişimi için gerekli genlerin mutasyonu ve Aktivasyon. Son zamanlarda, çeşitli çalışmalar, fonksiyon kazanım mutasyonları tespit etmiştir Fosfoinositid 3-kinaz (PI3K) genlerinde PIK3CD (ki P1106'yı kodlar) ve PIK3R1 (p85α'yı kodlar) Aktif olarak adlandırılan kombine bir immün yetmezlik sendromuna neden olan PI3Kδ sendromu (APDS) veya p1108-aktive edici mutasyona neden olan Yaşlı T hücreleri, lenfadenopati ve immün yetmezlik (PASLI). Paradoksal, Hem fonksiyon kaybı hem de bu genleri etkileyen fonksiyon kazanım mutasyonları Farklı mekanizmalar yoluyla olsa da, immünosüpresyona neden olur. Burada, Adaptif bağışıklıkta PI3Kδ'nın rolleri, klinik bulguları tanımlar Ve APDS'deki hastalık mekanizmalarını incelemek ve PI3Kδ'ya yeni bakış açıları vurgulamak Bu hastalardan elde edilen bulguların yanı sıra Klinik tedavi. Giriş Aktif PI3Kδ sendromu (APDS; PASLI olarak da bilinir), Içinde yeni tanımlanmış primer immün yetmezlik (PID) sendromlarının giderek artan sayısı Nedensel mutasyonlar, yeni nesil dizileme ile tanımlanmıştır. The APDS'nin klinik bulguları çeşitlidir ve heterojendir (Kutu 1), ancak hastaların çoğunluğu Tekrarlayan solunum yolu enfeksiyonlarıyla, sıklıkla hava yolu skarlasması ile birlikte görülen (Bronşektazi) ve kulak ve sinüs hasarı, ki bu antikorun (B hücresi) eksiklik. Herpes aile virüsleri ile şiddetli, tekrarlayan veya devam eden enfeksiyonlar, Kusurlu T hücre fonksiyonunu gösteren, bu durumda da sık görülür ve Bazı etkilenen bireylerde erken ölüm neden olur. Birçok hasta benign gelişir Hepatosplenomegali ile sıklıkla ilişkili olan lenfadenopati ve APDS ile ilişkili B hücre lenfoma riski önemli ölçüde artmıştır (Kutu 1). Viral duyarlılık artışı Enfeksiyon ve hafıza T hücrelerinin zayıf geri çağırma tepkileri APDS'yi ayırt eder İzole edilmiş hipogammaglobulinemi 1 – 4 dolayısıyla APDS kombine edilmiş olarak düşünülmelidir Bağışıklık yetersizliği 5 . 100'den fazla hasta APDS ile bugüne kadar bildirilmiştir, ancak kesin insidans henüz bulunmamaktadır. . Kutu 1 APDS'nin klinik özellikleri 6 APDS'li hastalar hem bağışıklık yetersizliği hem de bağışıklık özellikleri sergilerler Disregülasyon: Nükseden akciğer, kulak ve sinüs enfeksiyonları (kapsüllenmiş bakterilerle Olarak Haemophilus influenzae ve Streptokoklar Etkili olabilmek için opsonizasyona ihtiyaç duyan pneumoniae Öldürme) yakın evrenseldir ve yüksek bir insidans ile ilişkilidir Işitme bozukluğu ve bronşektaziyi içeren organ hasarı Havayolu korkutması) 1 4 . Herpes aile virüsü ile şiddetli, tekrarlayan veya kalıcı enfeksiyonlar Yaygın, özellikle kronik EBV veya CMV viremi ve HSV ve VZV Enfeksiyonlar 1 3 – 7 . Bazı solunum yolu virüslerinin sık izolatları 1 Fırsatçı enfeksiyonlar seyrek olmakla birlikte, birkaç hastada (örn., Adenovirüs ve echovirus) Tekrarlayan viral siğiller veya molluskum kontagiosum deneyimli Enfeksiyonlar 49 . Apse oluşumu, lenfadenit ve selülit insidansında artış Gram pozitif bakterilerle (çoğunlukla Staphylococcus Aureus ) ve mikobakterilerin hatalı öldürülmesi APDS'li bir hastadan izole edilen makrofajlar, Doğal bağışıklık 64 . Benign lenfoproliferasyon (lenfadenopati, hepatosplenomegali ve fokal Nodüler lenfoid hiperplazi) tüm hastalarda ortak özelliktir Bugüne kadar incelenmiş olan APDS Etkilenmiş hastalardaki lenfoid dokunun histopatolojik analizi Manto zayıflaması ile atipik folliküler hiperplaziyi gösterir APDS1'deki bölgeler ve APDS2'deki küçük B hücreli folliküller. Germinal merkezler Her ikisinde de T hücrelerini infiltre ederek (çoğunlukla PD1 pozitif) bozuldu APDS1 ve APDS2 APDS ile bağlantılı yüksek oranda bir lenfoma var ve bunları kapsıyor Geniş bir histopatolojik şekil yelpazesi 1 2 7 67 İmmün sitopenias (trombositopeni, hemolitik anemi ve nötropeni) Ve otoimmün benzeri katı organ koşulları (juvenil artrit, Glomerulonefrit, tiroidit ve sklerozan kolanjit) de var 7 66 ,% 34'lük bir frekansta APDS1'li 53 hastanın kohortu 7 Hafif gelişimsel gecikmeler hem APDS1 hem de APDS2'de görüldü. APDS2 olan 36 hastadan oluşan bir kohortta 7 Büyüme (Büyüme) Retardasyon APDS2 olan hastalarda yaygındır 6 73 74 ancak görünmemektedir Özelliği, APDS1'in heterozigot SHORT sendromlu (kısa boylu, boy kısalığı, Eklemlerin hiperekstansibilitesi, fıtı, oküler depresyon, Rieger anomali Ve diş çıkarma gecikmesi) 88 91 APDS heterozigot kazançtan kaynaklanır (GOF) mutasyonları Hiperaktivasyona neden olan PIK3CD veya PIK3R1 Sırasıyla protein ürünleri p1108 veya p85a, 1 – 4 . P85a düzenleyici altbirim ve p110δ katalitik altbirimi Birlikte heterodimerik lipid kinazı PI3Kδ oluşturur; B hücresi reseptörü de dahil olmak üzere bağışıklık sistemindeki hücrelerdeki çoklu reseptörler (BCR) ve T hücre reseptörü (TCR) yanı sıra sitokin ve kostimülatör Reseptörler. Bu aynı altbirimlerde homozigot işlev kaybı (LOF) mutasyonları neden olur İnsanlarda immün yetmezlikten oluşan belirgin ve daha seyrek bir şekil 8 – 10 ve bu belirgin ikiye bölünme, birlikte Etkilenen hasta gruplarının klinik özellikleri, anlayışımızı bildirmiştir. Bu derlemede, PI3Kδ hakkında bilineni özetleyeceğiz, odaklanacağız. Uyarlamalı bağışıklık tepkileri düzenlemesi üzerine. Bu bilginin büyük kısmı Gen hedefli fareler kullanarak yapılan çalışmalar. Ardından, şüphelenilen iki olguyu özetleyeceğiz Insanlarda PI3Kδ eksikliği bildirildi, daha önce tanımlanmadan önce APDS'nin klinik ve immünolojik belirtilerini ayrıntılı olarak açıklar. Sınıf I PI3K'lara genel bakış Sınıf IA PI3K'ler, Pı10a, pı10p veya pı108 katalitik altbirimi oluşturucu olarak Bir p85 düzenleyici altbirimi ile ilişkilidir; IB PI3K sınıfı, Bir p101 veya p84 düzenleyici alt-birim ile etkileşen p110γ katalitik altbirimi (). Pı10a ve pı10p Büyük ölçüde ifade edilirken, p110γ ve pl108 baskın olarak Lökositler tarafından ifade edilir. Fazlalık için önemli bir potansiyel olsa da Katalitik altbirimler arasında, her bireysel p110 izoformu için benzersiz roller var Farklı ifade şekillerini yansıtan ve aynı zamanda Kendi reseptörleri tarafından angaje edilirler 8 , 11 . Örneğin, p110a, Insülin benzeri reseptörler tarafından aktive edilir ve büyümeyi, metabolizmayı ve Angiogenesis 11 oysa p110β Metabolik sinyallemeye katkıda bulunur ve Fare nötrofilleri bağışıklık komplekslerine 12 , 13 . P110γ, Miyeloid hücreler ve kemotaktik tepkilere katkıda bulunur, ayrıca reaktif oksijen Nötrofillerdeki tür (ROS) üretimi 14 . P110δ ile birlikte, p110γ, pre-T hücresi sırasında da önemlidir Timusta gelişim 15 . P1106, Bu derlemenin odak noktası olan hemodiyaliz, hem lenfositlerde hem de Miyeloid hücrelerdir ve antijen reseptörleri, ko-uyarıcı reseptörler, Sitokin reseptörleri ve büyüme faktörü reseptörleri 8 PI3K altbirimleri ve APDS mutasyonları Sınıf Sınıf I PI3K'ler, PtdIns (4,5) P 2'nin fosforilasyonunu katalize eder. ila Bir membran görevi gören PtdIns (3,4,5) P 3 (PIP 3 ) üretirler Pleckstrin homolojisi (PH) alanları olan hücre sinyal proteinleri için ip. Göze çarpan Bunların arasında PDK1 ve AKT, bunlar gibi substratları fosforile edecek şekilde hareket ederler FOXO transkripsiyon faktörleri (inaktive hale gelir) ve regülatörleri MTOR kompleksi 1 (aktive olur). Bu nedenle, sınıf I PI3K'lerin aktivasyonu FOXO transkripsiyon faktörlerinin inaktivasyonu ile sonuçlanır. Lenfositlerde BTK ve İTK PIP 3 – Aktifleştirmeye katkıda bulunan tepki veren tirozin kinazlardır. Fosfolipaz C-gamma (PLCγ) ve diğer indirgeyici sinyal proteinleri (,). Lipid fosfataz PTEN, PIP 3 'i PtdIns'e (4,5) P 2 8'e dönüştürür. Sınıf IA PI3K düzenleyici altbirimler üç farklı gen tarafından kodlanır ( PIK3R1 PIK3R2 ve PIK3R3 ) (). PIK3R1 P85α, p55α ve p50α'yı kodlar (her biri bir alternatiften Transkripsiyon başlangıç ​​sitesi), PIK3R2 p85β'yı kodlar ve PIK3R3 p55γ 16 kodlar. Bu düzenleyici altbirimlerin SH2 etki alanları vardır ve bu bağlar Hücre yüzeyi reseptörlerinin fosforile YXXM motifleri ve membrana bağlı Proteinler. P85α, p55α, p50a ve p85β her yerde bulunur Ifade ederken, p55γ esas olarak beyinde ve testislerde 16 ifade edilir. Sınıf IA PI3K düzenleyici herhangi biri Altbirimler belirgin olmadan p110α, p110β ve p1108'e bağlanabilir seçicilik. PI3Kδ'nın, en iyisi, p85α'yı P1108, ancak p110δ ile diğer sınıf IA PI3K düzenleyici altbirimler de mümkündür. Ayrıca şunu da bilmek önemlidir: P85α birçok p110δ'dan bağımsız işlevlere sahiptir, çünkü aynı zamanda bağlayabilir P110α ve p110β 16 . Sınıf IA PI3K düzenleyici altbirimleri p110 katalitik altbirimlerini etkiler Üç şekilde 17 : proteolitik P110'un bozunması; P110 katalitik aktivitesini inhibe eder; Ve p110'u işe alıyorlar Altbiriminden plazma zarındaki tirozin fosforile proteinlere dönüştürülür. P85α'nın SH2 domenleri fosfotirozinler tarafından tutulduktan sonra, P110 ile inhibitör kontaklar hafifletilir 17 . Böylece, PIK3R1 genindeki mutasyonlar, PI3K aktivitesini, P110δ'nın parçalanmasına veya işe alımının azaltılmasına izin vererek Reseptörler ( PIK3R1 null veya LOF mutasyonları durumunda) veya tarafından P85α'nın p1108 üzerindeki inhibe edici etkisinin serbest bırakılması (durumda PIK3R1 GOF mutasyonları). Düzenleyici alt birimlere ek olarak, P110α ve p110δ RAS'ı bağlayabilir ve p110β, RAC'yi veya CDC42'yi bağlar. Bu küçük GTPazlar p110 altbiriminin membrana bağlanmasına yardımcı olur 17 18 . PI3Kδ ve bağışıklık: fareden alınan dersler APDS tanımından önce, rolü hakkındaki bilgilerin çoğunun Bağışıklık ve enfeksiyonda PI3Kδ, genetik ve farmakolojik Fare modelleri kullanılarak yapılan çalışmalar. APDS'ye neden olan GOF mutasyonları geçtiğimiz günlerde Artmış bazal ve uyarılmış PIP 3 seviyelerine ve PIP 3 – hastadan türeyen bağımlı sinyal iletim dizileri Lenfositler 1 – 4 ve bu hastaların incelenmesi bize yeni bilgiler verebilir PI3Kδ aktivitesinin dengesi bağışıklık hücresi işlevlerini nasıl düzenler. İşte, biz Farelerdeki bu çalışmaların bize ne öğrettiğini özetleyin, önce Mutasyon geçiren insan hastaların immünolojik fenotipleri PIK3R1 Veya PIK3CD

Fare B hücrelerinde PI3Kδ fonksiyon kaybı Farelerde, kemik iliğinde erken B hücresi gelişimi sadece hafiftir 19 – 23 p85α veya p1108'in kaybından etkilenir. Buna karşın p110α ve p110δ kombine kaybı, Pro-B hücresi safhasında 24 yakınlarında yakın komple geliştirme bloğu . Bununla birlikte, p85α veya p1108'den yoksun fareler Altbirimlerin foliküler B hücreleri daha az, marjinal bölge (MZ) B hücrelerinden yoksun ve …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Elektrikli arabaların hızı daha da artacak!

Bataryalar modern dünyada kullandığımız neredeyse tüm cihazların temelinde bulunan en önemli yapı taşlarından bir tanesi. Ancak bu konuda çok uzun bir zamandır neredeyse hiç bir gelişme görülmüyor. Elektrikli arabaların ortaya çıkmasından sonra bu daha da hız kazandı ve sevindirici gelişmelerin haberleri almaya başladık. Çatıda büyük şirketin ilgilendiği ilk konu, bataryaların daha uzun süre dayanması. Büyük Teknoloji şirketleri bu konuda çalışıyor, …

Devamını Oku »

5 Dk ya da Daha Az Duş Yapmanın 3 Yolu (

Satır 4: Satır 4: == Basamaklar == == Basamaklar == === Duş Hazır Olmak === === Duş Hazır Olmak === – #Duşu önceden püskürtün. Duş zamanınızı kesmeye çalışıyorsanız, suyun içine girmeden önce başlayabilirsiniz. Sıcak suyun çalışması uzun zaman alıyorsa, suyu bir dakika kadar önceden çevirin. http://www.wisebread.com/how-to-take-the-worlds-most-efficient -shower + #Umarlı olarak duş al. Duş zamanınızı kesmeye çalışıyorsanız, suyun içine girmeden önce …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

Mink Mingle Sevdiğim birisi derinden beni çağırıyor. Kalbi kırıldığını söylüyor, bana geri kazanmaya çalıştığını söylüyor, ona ihtiyacı olan şeyi, nasıl güvenini kazanabileceğini, doğru şeyleri yapmak için neler yapabileceğini soruyor. Dinliyorum. Ona değerini hatırlatırım. Ve sonra sinirlenirim. Çünkü yardım edemem ama neden bu adamın bir milyon ve bir şeyi denemediğini merak ediyorum. Neden çiçeklerini almadı? Her sabah ve her gece ve hatta gün boyunca onu neden düşünüyor olduğunu göstermek için neden ona mesaj atmadı? Neden ona bir mektup yazmadığı ya da onu yemeğe götürmediği ya da en sevdiği şeker çubuğunu alıp çantasına sokmadığı ya da bir rölyefle rengarenk bir battaniye üzerinde sergileneceğini sorup durmadığını sordu. yıldızlar? Yoksa onu tekrar tekrar hatırlattı, nasıl berbat ettiğini ve onu kaybetmek istemediğini mi? Dinlediğimde, onu geri getirmek için sahip olabileceği bir milyon ve bir fırsattan geçtim, onun endişeli zihnini hafiflettiği söylenebilecek tüm sözleri, ona göstermek için yapabileceği tüm küçük şeyler Önemli olan, katlanarak, ona. Ağlıyor Diye bağırıyor bağırıyor. Neye ihtiyacı olduğunu söyledi, bana neden korktuğunu, nasıl incildiğini, kalbinin güvensizlikten ve kırılmasından nasıl acı çektiğini ve hiçbir şey yapmadığını söylediğini söyledi. Ona sadece ona ihtiyacı olan şeyi gösterebileceğini, kendisini sevmenin yollarını söyleyebileceğini istiyor olduğunu söyledi. Yardım edemem ama bunun yanlış olduğunu düşünüyorum. Çünkü bu adama onu nasıl seveceğini söylemek zorunda kalmamalı, işleri doğru yapmalı. Ona nasıl zarar verdiğini görmesine izin vermemeli, kırık olanı nasıl düzeltebileceğini ona göstermeliydi. Hiçbir şeyi açıklamak zorunda kalmamalı, çünkü onu sevilen biri olarak zaten biliyor olmalıydı. Sözünü dinlerken, kendi ilişkilerimi düşünüyorum. İlk aşkım olduğu için bana nasıl bakacağından emin olmadığı için ya da çok duygusal olduğum için, güvenime ne kazandığından emin olmadığı için ya da benim güvenimi kazandığımdan emin olmadığına inandığım insanlardan bahsediyorum. Hassas ve inatçı olduğum için sevmeyi zorladım. Mazeretlerim var. Aklıma getirdim. Sorun olduğunu düşündüm. Ben, çok fazla kaleyi seven, o adamların beni nasıl seveceğini bilmediğini sanıyordum. Fakat birileri seni seviyorsa seni seveceklerdir. İhtiyacınız olan her şekilde sizi seveceklerdir. Nasıl yapacaklarını bildikleri her şekilde seveceklerdir. Seni sevecekler ve bu sevgiyi defalarca kanıtlayacaklar, çünkü seni kaybetmek istemiyorlar. Gerçek aşk bu. Hepimiz kusuruz, ama birisi gerçekten mahvederse, onu doğru yapmak için her şeyi yapıyor olacaklar. Beklentileri çok yüksek tuttuğunuza inanmak için sizi suçlamaya çalışmazlar. Senaryoyu ters çevirmezler ve sadece zaman çizelgesinde onları bağışlamadığınız için yanıltıcı olanınız gibi davranırlar. Onları kol uzunluğunda tutmak için kendinizi kötü hissettirmezler, çünkü hala inciniyorsunuz. İhtiyacınız olduğunu düşündükleri ya da ne istediklerini algılarlarıyla eşleşmediğinden, ihtiyacınız olan şeyi görmezden gelmeyeceklerdir. Sorunlar olduğunda bir arka koltuk almayacaklar ve onlarla nasıl başa çıkılacağına dair ipucu olmayacak. Bakın, biri sizi sevdiğinde ne yapılacağı söylenemez. Nasýl bakým, nasýl hazineden geçirileceði, kayıp zamanın veya bencil eylemlerin telafi edileceği konularında söylenecekleri yoktur. Seni öpmek, nasıl tutmak, özür dilemek ya da takdir etmek ya da istediğini hissettirmek gibi neden söylenmesi gerekmiyor. Seni seven biri seni gerçekten seviyor, seni düzeltmek için elinden geleni yapıyorlar, ne yaparsan yap, elinden geleni yapabileceklerinden emin olman için elinden geleni yapıyorlar. Sana neye ihtiyaç duyduğunu özel olarak anlatmamalarını istiyorlar. Adım adım açıklamanı beklemeyecekler. Hayır, her zaman doğru yolu bulamıyor olabilirler, ancak


Devamını Oku »

Ne kadar iyi ya da nazik veya nazik olursan ol, orada hiçbir şey yapmak istemeyen insanlar kalacaktır.

Üzücü olan şey, ne kadar iyi ya da nazik veya nazik olursanız olun Seni parçalamaktan daha fazlası. Aslında, çocuk bakıcısı ya da kişi olarak daha iyiysen, daha fazla insan sizi yanlış anlamak ister ya da sizi bir şekilde incitmek isteyecektir. Görüyorsunuz, en iyi insanlar bize güvensizliklerimizi, kendi hatalarımızı, kırık niteliklerimizi hatırlatıyor. Ve kusurlarının nerede olduğunu görmek için sabırsızlıkla bekleriz, böylece …

Devamını Oku »

Maden suyu ile soda da aynı mi?

                     2017-04-18 17:57:00                                           Belki de çoğumuz maden suyu ve sodanın isimleri farklı olsa düşünüyoruz. Beslenme ve Diyet Uzmanı Maden suyu ve sodanın arasındaki farkı anlattı … Maden suyu ve sodanın arasındaki fark Maden suyu da midede rahatlatma özelliğine sahip. Ancak, maden suyu saf ve mineral yataklar. Maden suyu içerisinde cevherlerin çözülmüş olması elementlerden bir andaır. Soda içilebilir nitelikteki …

Devamını Oku »

'Dizel daha önce hiç olmadığı gibi saldırı altındadır – arabalarını çalıştıranlar da olduğu gibi'

Yeter artık yeter. Dizel otomobiller ve sürücüleri günlük olarak gayretle şeytanca ediliyor. Derv ile ilgili kıyamet ve kasvet artık umutsuzca daha önce tanık olmadığı bir kısırdöngü ile teslim edildi. Son zamanlarda iyi niyetle dizel araçlarına yatırım yapan bazı akılcı aileler şimdi "katil" otomobillerinin egzoz borularından gelen emisyonlarla vatandaşlarının yaşamlarını sona erdiriyor. Sadiq Han, Londra Belediye Başkanı ve İşçi Partisi'nin potansiyel …

Devamını Oku »

Katolik Okulları Suck Eden Neden 8 Nedenler Thought.is Nereden geldim, Katolik okullar pratikte norm. Bazı arkadaşlarım Katolik okulundaki mutlu yıllarından ötürü Katoliklikten ayrıldıklarını ifade ettiler. Hâlâ daha yüksek bir güç, belki de Tanrı'nın varlığına inanırken, anladım ve kızgınlıklarını paylaşıyorum. İster sevilsin ya da sevmeyin, bir Katolik okulunda eğitim görürken büyüdüyseniz, muhtemelen neden bahsettiğimi bileceksiniz. Ancak yine belki de deneyimleriniz farklıdır. Bana gelince, Filipin Katolik okullarının neden emildiği 8 nedeni var: 1. Doğal Hareket yerine Alışkanlık olarak Namaz. Her gün dersler başlamadan önce bayrak töreni sırasında 15 dakikalık bir dua toplantısı düzenledik ve bu da okul saat 6:30 gibi erken saatlerde olmamız gerektiğini gösteriyordu. Eğer namaz başlamış olsaydınız sonra geldiyseniz, üç kez geç kaldıysanız, bir günün yokluğuna tekabül edecek bir "gecikmeli kayma" alırsınız. Gün boyunca, her sınıftan önce ve sonra dua edelim, bu yüzden 6 sınıfa sahip olsaydık, bu otomatik olarak 12 ibadet eder. Ayrıca, öğle molasında ve öğle molasında yemek öncesi dua ettik. Öğle yemeğinden sonra The Angelus adlı özel bir duayla öğleden sonra The 3 O'Clock Namaz adlı başka bir özel dua vardı. Eğer Ekim (Raserse'nin ayı) ise, o zaman her gün tespih ederiz. Yalan söylemeyeceğim. Ben ve sınıf arkadaşlarımın birçoğu dua yığını anıla okudu ve gerçekten niyetle ya da kalpten dua etmedi. 2. Zorbalığa Rahat Tolerans. Anaokulundan üniversiteye kadar Katolik okuluna geldim. Filipin'deki en iyi okulların çoğunluğunun Katolik mülkiyetinde olması nedeniyle gerçekten seçeneğiniz yok. Toplamda, 4 farklı Katolik okuluna gittim. Hepsinin kabadayılıklarla uğraşmak için berbat yöntemleri vardı. Lise döneminde bir grup kız öğrenci birkaç öğrenciye zorbalık yapmaya devam ediyordu. Faktöre harekete geçmeden çok, gerçekten çok zaman aldı ve sadece bir okul arkadaşıyla neredeyse fiziksel olarak istismar edilen bir olay tırmandı. Zorbalığa birkaç gün askıya alındı ​​ve hiçbir şey daha proaktif olmadı. Okul, zorbalık hedefleri için asla danışmanlık hizmeti sunmadı. Üniversitede bunu kendim yaşadım. Bir sınıf arkadaşı (ve daha sonra bir arkadaşı) bana öğretmen ve diğer öğrencilerin önünde bağırarak zorbalık etti ve beceriksizce komik olduğunu düşündüğü için öğretmen hiçbir şey yapmadı ve daha sonra güldü. Bu olay diğer olaylara tırmandı. Yine, okul şikayetlerine rağmen hiçbir şey yapmadı ve yalnızca hukuki işlem başlatmak için tehdit edince onlara başvurdu. Öğrenci İşleri Şefi, "Hıristiyan yolu" olduğu için, kabadayı "affet" etmem için ve sorun yaratmamak için "yalvarırım" diye yalvardı. "Öğrencilerin okula devretmek istediğimden dolayı davamı düşürdüğümde (evet, O kötü), aynı zorbanın fiziksel olarak başka bir sınıf arkadaşına saldırdığını duydum. Hayır, kaydında bir erteleme ya da işaret almadı. Bana yaptığı ve diğer sınıf arkadaşı için yaptığı tek şey, değersiz, samimi olmayan bir özür dilemekti. 3. Okul İtibarıyla İlgili Endişeler Katolik okulları, Hıristiyan değerlerin geliştirilmesine yönelik bir tespite rağmen, gelirleri ve itibarları ile daha fazla ilgileniyor gibi görünüyor. Daha önce de belirttiğim gibi, eski okulum şarj cihazlarına basmamamı istedi ve belli bir şeyin medyaya veya halka sızmasına izin vermemek için elinden gelen her şeyi yaptım. Üniversite bölümünün gazetesinde yer aldım ve okulun ya da bedeninin eleştiren herhangi bir makalesi daima öfkelendi ya da gazeteden çıkarılmaya çalışıldı. Farklı bir Katolik Üniversitesi'ne geçtiğimde okul gazetesine de kaydolmuştum. Rahibeler ve rahipler gazeteciliğimizde bizi "şeffaf" olmaya teşvik etti ancak gazetemizin bir baş rahib tarafından kontrol edilmesini ve öğrencinin bedenine gönderilmeden önce onaylanmasını talep ediyordu. Yine, okulu olumsuz yönde etkileyen makaleler, öğrenci bütçesinde yansımayan bazı eksik öğrenci ücretleri üzerine soruşturma parçaları, dükkanlardaki veya kantindeki eşyaların neden aşırı fiyatlandırıldığını bulmak için malların arızalanması, mülakatlar Öğrencilerin yayınladığı şikayet vb. Burada bir desen görebilirsiniz. Son zamanlarda tanıdıklarımın Facebook postasında tökezledi. 14 yaşındaki kızkardeşinin bir öğretmen tarafından nasıl zorbalığa uğradığını açıkladı, ancak okul öğretmeni cezalandırmadı. Bu, Facebook olayını yazana kadar yayınlandı ve viral hale geldi.

Aynı şey, başka bir öğrenciye karşı cinsel taciz şikayetlerini göz ardı eden ve başka bir Katolik okulundaki başka bir öğrenciye oldu ve öğrencinin kardeşinin Facebook yazığı zaman dinlendi (yarım asmış olsa da) Viral gitti. 4. Elbise Kodlarını Kontrol Etme. Kostüm kodlarının veya üniformaların kadın düşmanı ve klasist olduğuna nasıl inanıyorum. Bu, bütünüyle başka bir tartışmaya ihtiyaç duyuyor. Katolik okullarının takıntılı …

Devamını Oku »

VW, yasaklanmış 2.0 litrelik dizellerin yarısından fazlasını sabit ya da geri satın aldı

VW, yaklaşık 238,000 araçta kira geri satın aldığını veya feshedildiğini açıkladı. Fotoğraf kredi: DAVID PHILLIPS        WASHINGTON – Volkswagen AG Cuma günü yaptığı açıklamada, şirketin en büyük otomotiv geri alım teklifini başlatmasından sadece altı ay sonra, ABD hükümetinin bir çözümü kapsamında, 2.0 litre dizel araç kiralanan 475.000 kirliliğin yarısından fazlasını geri aldığı veya onardığını söyledi. Dünyanın en büyük otomobil üreticisi, …

Devamını Oku »

(19459000) Noah Hinton Baştan başlamak güzelliği, baştan başlamanın güzelliğidir. Geçmişte kim olduğunuzu bırakın.Seni tuttuğunuz şeyin elinden vazgeçersiniz ve sıkıştığınızı düşündüğünüzde sizi ya da yanlış kişiyi yanlış yere düşüren sizi aşağılayan tüm şeyleri bırakın. Baştan başlamak güzelliği, 'u seçmenize neden oluyor. Kimsenin olmaması gerektiğini ve bunu nasıl yapman gerektiğini söylemeden bu sefer olmak istediğin kişiyi seçeceksin. Yaşam farklı şekilde yaşamak için yeni bir şans verildi. Hayatı farklı bir renk renkte görmek için yeni bir objektif verildi ve kendinizi düzeltmek ve kendiniz kurmak için bir şans daha verdiniz; her zaman istediklerinize bir adım daha yaklaşın. Olmak Başlamak güzelliği, sonları kutlamaları bulmanıza yardımcı olması. Hoşunuza giden veda ve korkunun öbür tarafında yatan şey, konfor bölgesin ötesinde büyü ve hayat arayan hayat, aramaya karar verdiğinde size sunmak zorundadır. Farklı bir yola çıkmaya karar verdiğinizde, sizi korkutan bir şey yaptığınızda ve sizi tuttuğunuz bir şeyi veya bir şeyi bıraktığınızda – ne kadar acıyor olursa olsun, ne kadar önemsiyorsanız edin, bazen uçmanız gerektiği zaman geri çekilirler ve bazen kükreme vasıtasıyla sesinizi susturdular. Baştan başlamak güzelliği, her zaman yerleşmek zorunda kalmadığınızı öğreneceksin. Her zaman üzgün ya da incinmeden kalmanız gerekmez. Baştan başlayabilirsin ve hâlâ gurur duyduğun bir hayatla, sizi heyecanlandıran bir hayatla ilham veren

bir hayat yaşayabilirsiniz. Tekrar başlayabilirsiniz. İşi bitirip tekrar başlayabilirsiniz . Üzerinde başlama güzelliği, herhangi bir kuralının bulunmaması, el kitabına uymanızın gerekmemesi. Kendin yap. Ateşleri çağırırsın. Kimsenin kalemi tutmadan veya dikte etmeden kendi yeni başlangıcını yazacaksın. Rania Naim, burada mevcut olan yeni kitabın Söylenmesi Gereken Tüm Sözcüklerin bir şairi ve yazarıymış . Tüm kelimeleri-ben-söyledim-kompozit-promosyon "width =" 786 "height =" 524 "/> …

Devamını Oku »

Kuzey NSW sellere yabancı değil, fakat bu da …

                                                                                                          1974 markası halen Lismore'un kaydını tutuyor. Kredi: Ricky Lewis, Yazar sağlandı      Tropical Cyclone Debbie'nin yıktığı sel felaketi, New South Wales'in kuzeyindeki birçok sakinini aylar sürecek muazzam bir temizleme ile karşı karşıya bıraktı.                                                                                 Herhangi bir Lismore yerel size taşkınlığın Kuzey Irmakları'nda yaşamın bir gerçeği olduğunu söyleyecektir. 1954 ve 1974 yıllarında meydana …

Devamını Oku »

Doku faktörü (TF), koagülasyonun hücresel bir başlatıcısı olarak iyi bilinir, ancak aynı zamanda Astım da dahil olmak üzere çoklu patofizyolojik koşullarla ilişkili olan çok fonksiyonlu bir protein. Akciğerde hava yolu epitel hücreleri TF'yi eksprese eder, ancak TF ekspresyonunun astımla ilişkili mediyatörler tarafından nasıl düzenlendiği bilinmemektedir. Tek başına ve tip 2 sitokinin IL-13'ün, primer normal insan bronşiyal epitel hücrelerinden TF pozitif ekstraselüler veziküllerin TF ekspresyonu ve salınması üzerine, astımlı bronkokonstriksiyonu taklit eden basınç stresiyle kombinasyon halinde araştırdık. İyi diferansiye edilmiş normal insan bronşiyal epitel hücreleri, tek başına ve kombinasyon halinde, IL-13 ve basınç stresiyle tedavi edildi. TF mRNA, protein ve aktivite, hücrelerde ve şartlandırılmış ortamlarda ölçülmüştür. TF, allerjene meydan okunan farelerin ve astımlı hastaların bronkoalveolar lavaj (BAL) sıvısında da ölçüldü. IL-13 ve kompresif stres TF ekspresyonunu arttırdı, ancak sadece kompresif stres TF-pozitif ekstrasellüler veziküler salınımı indükledi. IL-13 ile güçlendirilmiş basınç uygulanan TF ekspresyonu ve salınımı ile ön tedavi. BAL sıvısındaki TF proteini ve aktivitesi, allerjenle duyarlılaşmış ve büyütülmüş farelerde artmıştır. Alerjenle mücadele sonrası hafif astımı olan hastaların BAL sıvısında TF yükselmiştir. İn vitro in vivo ve in vivo veriler, astım patofizyolojisine katkıda bulunabilecek akciğerlerde TF pozitif ekstraselüler veziküllerin TF ekspresyonu ve salınımı üzerindeki mekanik ve enflamatuar uyaranlar arasındaki yakın işbirliğini göstermektedir.

Anahtar kelimeler: astım, bronkokonstriksiyon, mekanotransformasyon, pıhtılaşma, hava yolu epiteli [19459019Astım-IL-13vebronkokonstriksiyonunikikritikbileşenidokufaktörünün(TF)ekspresyonunuveiyidiferansiyeedilmişinsanbronşiyalepitelhücrelerindenTF-pozitifekstraselülerveziküllerinsalınmasınısağlamakiçinbirlikteçalışmaktadır . Ayrıca, hem farelerde hem de insanlarda, alerjen uyarısı, TF'nin bronkoalveolar lavaj sıvısı içine salınmasını arttırır.

Devamını Oku »

Gülen'in Türkiye'ye dönüş planı da Akıncı İddianam …

                     2017-04-01 11:25:00                                           Darıca girişiminin yönettiği Akıncı Hava Üssü iddianamesinde 15 Temmuz'da yaşananlar anlatılırken, Fetullah Gülen'in Türkiye'ye dönüş planı da yer aldı. Buna göre Gülen 25 Temmuz'da dönecek ve bir önceki aşamada, Akıncı Üssü'nde inşa edilmiş bir binada kalacaktı. Ankara Cumhuriyet Başsavcılığı'nca hazırlanan 15 Temmuz Darülen girişiminin yönettiği Akıncı Hava Üssü'ne talidanamede, Fethullah Gülen'in Türkiye'ye dönüş planını yer …

Devamını Oku »

Canlandırıcı ya da Atılıyor: 2018 McLaren 720S

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Her sabah 1 kaşık da ya pekmez enerjiyi artırı …

                     2017-03-30 19:33:00                                           Bülent Ecevit Üniversitesi Gıda Mühendisliği Bölümü öğretim üyesi Yard.Doç.Dr. Özge Duygu Okur, sabahı 1 kaşık bal ya da pekmezin insan vücudunun enerjisini arttırdığını söyledi. Yard.Doç.Dr. Özge Duygu Okur, çok ve çok sayıda son derece özel, besleyici ve sağlıklı bir gıda maddesi olup olmadığını, yerini alabilecek alternatifler bulunmadığını ifade etti. Bal, hem de pekmez tüketiminin olmasını …

Devamını Oku »

RNA helikazları, RNA yapılarını modüle etmek ve RNA-protein (RNP) kompleks montajını kolaylaştırmada temel roller oynamaktadır ] In vivo . Daha önceleri, laboratuarımızda S'de DEAD-box RNA helikaz Dbp2 gösterildi. Cerevisiae ko-transkripsiyonel olarak ilişkili mRNA'ya bağlanan protein Yra1, Nab2 ve Mex67'nin poli (A) + RNA üzerine etkili bir şekilde birleştirilmesini teşvik etmek için gereklidir. Ayrıca, Yra1'in doğrudan Dbp2 ile ilişkili olduğunu ve Dbp2'nin çözülme ve inhibisyon döngüsünü düşündüren Dbp2'ye bağlı dupleks çözme inhibitörü olarak işlev gördüğünü bulduk. Bunu test etmek için birlikte transkripsiyonel mRNP montajında ​​Dbp2 olaylarının sırasını aydınlatmak için bir dizi deney yaptık. Şimdi, Dbp2'nin RNA yoluyla kromatin içine alındığını ve Yra1 ve Mex67 ile geniş, RNA'ya bağlı bir kompleks oluşturduğunu gösteriyoruz. Dahası, tek moleküllü (smFRET) ve toplu biyokimyasal analizler, Yra1'in Dbp2'nin tek sarmallı RNA ile ilişkisini engelleyerek konsantrasyona bağlı bir tarzda çözmeyi engellediğini göstermektedir. Bu inhibisyon, Dbp2'nin mRNA üzerinde aşırı birikmesini ve RNA Pol II transkriptlerinin bir alt grubunun stabilize edilmesini önler. Yra1'in, mRNA'nın bir araya getirme işlemini Dbp2 ile sonlandırdığı bir model öneriyoruz. Anahtar kelimeler: DEAD-box, helicase, RNA-Protein kompleksi, kromatin, RNA [Giriş Gen ifadesi sayısız, koreografi yapılan basamakları içeren son derece karmaşık bir süreçtir . Giriş Ökaryotlarda transkripsiyon sırasında, yeni sentezlenmiş haberci RNA'ya (mRNA), nükleer ihracat ve çeviriden önce 5 'kapak, ekleme ve 3' son oluşumu da dahil olmak üzere çeşitli birbirine yakından bağlantılı işleme olaylarına rastlanır [1–3]. Bu adımların her biri boyunca, mRNA, her olgunlaşma evresinde kompozisyonu sürekli değişen haberci ribonükleoprotein kompleksleri (mRNP) oluşturmak için RNA-bağlayıcı proteinlerle bağlanır [4]. Uygun mRNP oluşumu gen ekspresyonu için kritiktir ve uygun biyolojik zaman noktasında doğru yapılandırılmış mRNA gerektirir [2,5]. Fiziksel özelliklerine bakıldığında, RNA molekülleri, uzun ömürlü ve alternatif konformasyonları açıp tekrar konrol etmek için büyük miktarda enerjiye ihtiyaç duyan kararlı ikincil yapılar oluşturma eğilimindedir [6,7]. Bu, hücrelerdeki RNA yapısal dönüşümlerini hızlandıran proteinlere ihtiyaç duyar. Tomurcuklanan mayada S. Cerevisiae mRNA, anormal yapıların oluşumunu önlemek için aktif mekanizmaların dahil edilmesini düşündüren, termodinamik tahminlerden farklı olarak in vivo olarak . Sürekli olarak, mayalanma maymundaki ATP tükenmesi, mRNA'da artmış sekonder yapıya neden olur [2]. Dahası, mRNA sekonder yapısının son genom analizleri, yapısal sapmaların gen regülasyonunu değiştirebileceğini gösteren düzenleyici bölgelerdeki tek nükleotid polimorfizmleri ile değiştirilmiş RNA yapısı (yani, miRNA-bağlanma alanları) arasında çarpıcı bir korelasyon bulmuştur Hücresel mRNA'ların yapısal yeniden düzenlenmesi için olası adaylar, RNA çözen veya RNA-protein (RNP) yeniden şekillendirme enzimleri olarak işlev gören ATP'ye bağımlı RNA helikazlarıdır [10,11]. DEAD-box proteinleri insan hücrelerinde yaklaşık 40 üyeyle (mayada 25) RNA helikaz familyasındaki en büyük enzim sınıfını oluştururlar. Bu sınıfın üyeleri, yaşamın tüm alanlarında bakterilerden memelilere kadar her yerde bulunur ve pre-mRNP meclisi [12] dahil olmak üzere RNA metabolizmasının her alanında yer alırlar. Örneğin, insan Tau proteinini kodlayan pre-mRNA'nın alternatif bağlanması, ekzon 10'un 5 'ek yeri [13]' in aşağısındaki bir kök-ilmek yapısıyla düzenlenir. U1 snRNP'nin tau ekzonunun 5 'ekleme sitesine erişebilmesi için, bu kök-döngünün DEAD-proteini DDX5 [13] tarafından çözülmesi gerekir. tau genindeki eklemenin yanlış düzenlenmesi, demans ile ilişkilidir ve doğru gen ifadesi için yeniden modellemenin önemini vurgulamaktadır [14,15]. Bununla birlikte, pre-mRNA / mRNA yeniden şekillendirme biyokimyasal mekanizması (lar) ımız konusundaki anlayışımız, birlikte transkripsiyonel süreçlerin karmaşık ve oldukça birbirine bağımlı doğası nedeniyle engellenmiştir. Dahası, bireysel DEAD-kutusu protein ailesi üyeleri, düzenleyici yardımcı proteinlerin verdiği biyolojik fonksiyonların çeşitlendirilmesiyle birlikte RNA tavlama, nükleotid algılama ve RNP yeniden biçimlendirme dahil olmak üzere geniş biyokimyasal farklı aktiviteler sergilemektedir S. DDX5'in cerevisiae ortologu Dbp2 [19] 'dır. Laboratuvarımız daha önce, Dbp2'nin kromatin kopyalama ile ilişkili olan aktif bir ATPaz ve RNA helikazının olduğunu tespit etmiştir [17,20]. Üstelik mRNA'ya bağlanan protein Yra1 ve Nab2'nin yanı sıra mRNA ihracat reseptörü Mex67'nin mRNA üzerine birleştirilmesi için Dbp2 gereklidir [17]. İlginç olarak, Yra1 doğrudan Dbp2 ile etkileşime girer ve bu etkileşim, Yra1'in Dbp2'nin çözülmesini kısıtladığını gösteren çoklu döngü, toplu analizlerde Dbp2'nin çözülmesini engeller [17]. Bununla birlikte, Yra1'e bağlı inhibisyonun mekanizması ve biyolojik rolü anlaşılamamıştır. Biyokimyasal, moleküler biyoloji ve biyofiziksel yöntemlerin bir kombinasyonunu kullanarak, şimdi Yra1'in Dbp2'nin aktivitesini -transkripsiyonel mRNP montaj adımları. Bu inhibisyon, transkript seviyelerinin bakımı için önemlidir in vivo . Tek moleküllü (sm) FRET ve floresan anizotropi çalışmaları, Yra1'in Dbp2'nin RNA ile ilişkisini önleyerek Dbp2'nin çözülmesini engellediğini göstermektedir. Sürekli olarak, maya hücrelerindeki Yra1-Dbp2 etkileşiminin kaybı, mRNA üzerinde Dbp2'nin transkripsiyon sonrası birikmesine neden olur. Birlikte ele alındığında, bu, Yra1'in in vivo olarak Dbp2'ye bağımlı mRNP birleşiminin bir döngüsünü sonlandırdığını düşündürmektedir

Sonuçlar Dbp2 işe alındı DEAD-box RNA helikaz Dbp2 ağırlıklı olarak aktif olarak transkripsiyona uğramış genler ile çekirdekte lokalizedir [20–23]. Dbp2'nin başlangıçtaki RNA aracılığıyla kromatin ile işe alınıp alınmadığını belirlemek için, RNaz ile veya olmadan RNase ile kromatin immünopresipitasyon (ChIP) analizleri yaptık [24]. Kısaca, endojen DBP2 kodlama bölgesinin 3 'ucuna kaynaşmış bir 3XFLAG epitop etiketi barındıran maya hücreleri, bilinen gen olan …

Devamını Oku »

Makrofajlar ya klasik (M1) ya da alternatif olarak aktive edilmiş (M2) makrofajlardır.

Makrofajlar klasiktir. Bu nomenklatür tanımlanmış sitokin uyarılarıyla in vitro tedavi edilen monocyte türevi makrofajlardan üretilmiş olsa da, in vivo kaynaklı makrofajların fenotipi daha az anlaşılmıştır. Makrofajların Affymmetrix tabanlı transkriptomik analizini zimosan kaynaklı bir peritonitin çözünürlük evresinden tamamladık. Çözülme fazlı makrofajlar (rM), iltihapsız peritondan gelen saf makrofajların yanı sıra pro-enflamatuar bir doğaya sahip olan hiper-iltihaplı farelerin makrofajlarına kıyasla, monositlerden türetilen dendritik …

Devamını Oku »

NASA astronotları sakatların Öldürmesini emrediyor – sonra da köknar …

                                  SpaceX'in Dragon kapsülü, Uluslararası Uzay İstasyonuna yaklaşık bir ay geçtikten sonra, Dünya'ya başarılı bir şekilde döndü. 40 farenin cesetlerini de içeren bilim deneyleriyle dolu podül şimdi gemiyle NASA'ya gidiyor.                  23 Şubat tarihinde ISS ile bir gecikme hattı yapan bir kapsül, bir bilgisayar hatası nedeniyle ISS'de, istasyonun robotik kolunu kullanarak Avrupa Uzay Ajansı astronotu Thomas Pesquet tarafından Pazar …

Devamını Oku »

Yeni Lotus Elise Sprint daha da hafif »AutoGuide.com News

Lotus Elise, tamamen yenili, ultra hafif Elise Sprint model varyantının eklenmesi de dahil olmak üzere 2017 için küçük güncellemeler aldı. Sprint süs çizgisi, Elise Sport ve Elise Sport 220 modelleriyle belirtilebilir ve çıkan Elise Sport'ten 41 kg (90 lbs) traş olur. Elise Sport, Lotus kurucusu Colin Chapman'ın "hafifletmeyi basitleştirip hafifletmek" mantığını takiben, 9 kg hafif alaşım jant tasarrufu sağlayan hafif …

Devamını Oku »

Nicole Mason Gerçek: Vücudumdaki her organ başarısız oluyordu ve kilomuz 56 kiloya düştüğünde anoreksiya nihayetinde kazanmış gibi göründüğünden ailemden cenaze törenimi planlaması söylendi. Ben: Ben iyiyim! Şişmanım! Kendimden nefret ediyorum! Ben değersiz biriyim. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Gerçek: Sadece 1 ½ yıl sonra, 221 pound'luk bir şiddetle çarpan bir ölçeğe baktım. Her gün boş yiyecek sarmalayıcılar şirketinde uyuşukluk yaşlı yemek yeme bozukluğu yerini anoreksi yerini aldı. Ben: Kendimden nefret ediyorum! Umutsuzum! Artık kendimi tanımıyorum bile. Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Bulimia, umutsuzca kilo vermeye çalışırken yavaş yavaş hayatıma girdi. Aşırı müshil ile yakalanan – kısıtlama döngüsü; Bir defada 100 müshil ürünü yuttuğumda kaya tabanına düştüm. Ben: Ben iyiyim! Bu yemin ederim son olacak! Kendimden nefret ediyorum! Yardıma ya da mutlu olmaya layık değilim. Bu benim hatam. Başlangıç ​​ İsmim Brittany Burgunder'dır, ancak hayatımın çoğunu kendim koşturarak geçirdim. On yıldan fazla bir süredir, dünyadaki en yüksek ölüm oranına sahip zihinsel hastalık olan bir yeme bozukluğu ile savaştım. Sevgi dolu ebeveynlerle büyüdüm, ulusal derecede tenis sporcusuyum, düz 'A' öğrencisi ve yetenekli bir at binicisiyim. Mükemmel bir gülümseme üzerine – parlak bir geleceği olan normal bir hayatını tasvir eden bir gülümseme, ancak altında yatan sıkıntılı ruhu kamufle eden bir gülümseme üzerine boyadım. Gerçeğim, acı çekingen, sürekli alay ve reddettiğim akranlarımın korkunç kaygı, depresyon ve OKB'ye yol açmasıydı. Neden herkes gibi uymadığımın ve hayatın neden bu kadar zor olduğunu anlamadım. Bildiğim şey, ben ile ilgili bir sorun olması ve yeterince iyi olmaması gerektiğiydi. Anoreksiya Anoreksi, 13 yaşındayken hayatıma girdi. Yeme bozukluğunun ne olduğunu, sadece yiyecek konusunda tuhaflaştığım ve kalori, bedenim ve egzersizle ilgili garip yeni ritüeller geliştirdiğim hakkında hiçbir fikrim yoktu. Hastalığım beni yaşamak istemediğim bir yaşama yönlendirmede yeni bir yol bulduğum için endişelerim yatıştı. Ailem hızla müdahale etti ve eve tedavi edeceğim düşüncesiyle beni ilk tedavi merkezime yolladı. Meydan okurcasına, bir sorunum olduğu gerçeğinden habersiz davrandım. Benim gibi diğer insanlar olduğuna şaşkına döndüm ve bir sefer yalnız hissetmedim ve arkadaş oldum. İyi fiziksel sağlıkta eve döndüğüm halde aklım kesinlikle düzelmedi ve bir dizi yeni hileyle silahlı olarak döndüm. Egzersiz bağımlısı oldum. Üç farklı spor müsabakası üyeliğime sahibim, bu nedenle aynı kişiler aşırı davranışsal davranışı gözlemlemiyorlardı. Çoğu yaş grubum baloya giderken, 20'li yıllarda kalp atış hızı ile hastanede yatıyordum. Bir zamanlar Division 1 üniversite tenisi oynamak için bir potansiyel buldum, ama şimdi eğlenmek için babamla bile uğraşamayacak kadar zayıftı. Bir zamanlar en büyük sevincim olan atım satıldı, çünkü ben daha derin ve daha derin bir yanılsama dünyasına girdim. Gerçeklerime olan tek tanık – gerçek düşüncelerim ve gerçek çatışma – bir günlük ve kalemdi. Her gün yoğun bir şekilde yazmıştım. Yeme bozukluğumun yanı sıra, sahip olduğum diğer tek şirket buydu. Günlüklerimde yazarken başımdaki karışıklığın bir kısmını boşaltmaya yardımcı oldular, ancak sırlarımı korumak için dergilerimi gizli tutmayı emrediyorum. Davis Kaliforniya Üniversitesi'ne kabul edildi. Ailem, ihtiyacım olan yeni başlangıç ​​olabileceğini düşünerek gitmeme kararı verdi, ancak yanılıyorlardı. Sınıf arkadaşlarımla sosyalleşmeye çalıştım, ama açıkçası onlar gibi değildi ve dışarı çıkmak için yapılan her davetiyeyi geri çevirmek için bir bahanem vardı: Eğer yiyecek veya alkol olsaydı ne olurdu? Egzersiz programıma müdahale etseydi ne olurdu?

ise Yeme bozukluğumla hayatım çabucak bana oldu. Profesörleri sevdiğim kadarıyla UC Davis'teki vaktim kısa sürede korkunç bir varlığa dönüştü. Özel bir yeme bozukluğu istikrar programına kabul edilmeden çok önce değildi. Tüm dolaşımı kaybettim, saçlarım düştü ve karaciğer yetmezliğiyle yüzleştim. Kilom çok düşük bir kilo aldı ve ailemden cenaze düzenlemeleri yapılması söylendi. Ancak bu bana gerçek dışı geldi. Ben şişmanım. İyiydim. …

Devamını Oku »