24 Kasım 2017,Cuma
Anasayfa » Tag Archives: çok

Tag Archives: çok

En Çok Yapılan Beslenme Hataları Nelerdir? | Hanım …

Beslenme ile ilgili çok insan ne yazık ki yeterli bilgi sahibi olmadığı gibi arka planda diyet yapmaya çalışırken aslında çok hatalı beslenme tekniği kendine maruz bırakmış oluyor. Diyet yaparken dikkat etmeniz gerekenlerden, normal hayatınızda yedikleriniz içinde gibi hayseler yaptığınıza dair her şey burada yazmaya çalışacağız. Yağı Az Olan Diyet Ürünleri Yağ oranı düşük ve diyet bisküvi, diyet süt – yoğurt …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

2017 Çok Kat Maya Sahibi Ethos Ödülü, Küresel İnternet Topluluğunun İki Üyesine Onur Verdi

26 Haziran 2017 – JOHANNESBURG – Atanmış İsimler ve Numaralar İnternet Kurumu (ICANN), 2017 Çok Paydaşlı Etoz Ödülü alan kişileri açıklamaktan memnuniyet duyar. Bu yıl, topluluk değerlendirme paneli ICANN topluluğunun iki uzun zamandır üyesini tanıdı: Hiro Hotta ve Patricio Poblete . Ödüller bugün Güney Afrika'nın Johannesburg kentinde ICANN59'da sunuldu. Çok Kat Maya Sahibi Ethos Ödülü, ICANN topluluğunun üyelerine, ICANN'ın çok …

Devamını Oku »

2017 Çok Kat Maya Sahibi Ethos Ödülü, Küresel İnternet Topluluğunun İki Üyesine Onur Verdi

26 Haziran 2017 – JOHANNESBURG – Atanmış İsimler ve Numaralar İnternet Kurumu (ICANN), 2017 Çok Paydaşlı Etoz Ödülü alan kişileri açıklamaktan memnuniyet duyar. Bu yıl, topluluk değerlendirme paneli ICANN topluluğunun iki uzun zamandır üyesini tanıdı: Hiro Hotta ve Patricio Poblete . Ödüller bugün Güney Afrika'nın Johannesburg kentinde ICANN59'da sunuldu. Çok Kat Maya Sahibi Ethos Ödülü, ICANN topluluğunun üyelerine, ICANN'ın çok …

Devamını Oku »

Özge Ulusoy'dan çok konuşulacak pozlar

                     2017-06-24 10:49:00                                                                      Geride bıraktığımız günlerde göğüslerine estetik operasyon yaptırdığı haberleriyle gündeme gelen Özge Ulusoy bir dergiye verdiği pozlarla yine çok konuşulacak gibi görünüyor. Altı yıllık sevgilisi Hacı Sabancı'dan 1.5 ay önce ayrılan Özge Ulusoy hakkında, geride bıraktığımız günlerde silikonlarını yenileyip büyüttüğüne dair okuduğunu kaydetti. Ulusoy'un dikkatten kaçmasını da istemedi. KAPAK KIZI Biten ilişkileri, kendisini işlerine …

Devamını Oku »

Resident Evil 2 HD çok yakında geliyor!

Resident Evil Serisinin arkasında isim Hiroshi Kobayashi tarafından yapılan açıklamayla birlikte, Resident Evil'in ardından şimdi de Resident Evil 2 Nin yeniden hazırlanarak piyasaya sürüleceği ortaya çıktı. Resident Evil 2 ne zaman piyasaya sürülecek? Hiroshi Kobayashi'nin Collider'a adlı kitabı yazılmış kağıdın bir çıkış tarihi vermelerinin mümkün olmadığı belirtildi. Capcom İlk kez 2015 yılında Resident Evil 2 'nin HD Remake yani yüksek …

Devamını Oku »

Haftanın en çok indirilen filmleri

Her ne kadar içerik üreticileri isterse yıllardır torrent 'in önüne geçmek isteyen de bu pek mümkün olanları yapar bililir gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki 19 Haziran itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Harika Kadın Sadece savaşçı amazon kadınların yaşadığı Themyscira adasında büyüyen, buranın dışına hiç çıkmamış …

Devamını Oku »

Yüzey Laptop'u parçalarına ayırmak çok zor!

Geçtiğimiz günlerde Microsoft tarafından tedarik edilmeye başladı Microsoft Surface Laptop'un performans testlerinin yanı sıra, tamir edilebilirlik testi ortaya çıktı. iFixIt ekibine göre Yüzey Laptop'un tamir etmek oldukça zor olacak. Yüzey Laptop'un yanı sıra 5. jenerasyon Surface Pro'nun da ilei açan iFixIt ekibi, iki cihazın donanımıyla ilgili de facto bilgiler veriyor. Öncelikle Surface Laptop'un bir dereceye kadar bilgisayarın donanım bileşenleriyle karşılamalı, …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Yapılması Çok Kolay Saç Modelleri

Ne giyeceğinize karar mı ver mi, yoksa saçınızı şekle sokmak mı daha zor? Bizce ikisi de. Bir yerlere hep geç kalma, hayatı ıskalama sebebidir bu ikisi. Birbirini kovalayan her dairede aynı kalıpları geçirmek var bir de. Böylesi günler, insan kendinden safra sıkılır. Her gün yeni bir model deneyebileceğiniz, uykulu gözlerle uğraşan uygulayabileceğiniz, sadece üçlü dakikanızı alacak ve pratik saç modellerini …

Devamını Oku »

OnePlus 5'e ilgi çok büyük!

OnePlus'ın yeni akıllı telefonu OnePlus 5 20 Haziran tarihinde tanıtılacak. Hatta Çin'de bu tarih 21 Haziran iken, Hindistan'da tanıtım 22 Haziran'da gerçekleştirilecek. Fakat cihazın ön kaydıla satılmış çoktan başladı ve iki günde 300.000'lik bir ön kayıt sayısına ulaşıldı. Amiral gemisi katili! Bu sayının süresi yalnızca JD.com üzerinde başlatılmış bazı yazılımlar, internet siteleri veya GSM operatörlerinin kampanyaları da dahil olduğu çok …

Devamını Oku »

'' Babanın Libidosu Çok Yüksek İdo ''

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir kullanıcı. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Google Drive, çok daha gelişmiş bir hale geliyor!

Güneş Enrğı Bulut Storage Hizmetlerinden Birisi olan Google Drive kullanıcılara sunduğu sınırsız fotoğraf ve video yedekleme imkanı ile onun geçen gün daha fazla kullanıcı tarafından tercih ediliyor. Google, 850 milyonun üzerinde kullanıcıya ve 2 trilyondan fazla dosyaaya ev sahipliği yapan Drive'ı çok daha gelişmiş bir hale getiren, Yedekleme ve Senkronizasyon isimli üyemiz çevrimdışıdır. [Da] yeni bir aracı duyurmaya hazırlanıyor. 28 …

Devamını Oku »

Call of Duty: WW 2'den Çok Oyunculu Videolar!

Bale Bombacı Oyunları ortaklığında hazırlanan yeni Call of Duty, WW2 için hem çoklu oyunculu modları Tanıtım videosu yayımlandı. E3 2017 bitti düzenlenen Sony konferansı sırasında gösterilen videoda birçok oyun içi ana tanıklık etme fırsatı bulduğumuzu söyleyebiliriz. Bu sayede WW2'nin çoklu oyunculu modlarının nasıl olacağını merak edenlerin de meraklarını giderebilecekleri kesin. Call of Duty: WW2, 3 Kasım 2017 tarihinde PC, PlayStation …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Facebook Messenger tepkileri çok sevildi!

Facebook Mart ayında kullanıcıların Messenger adlı kişinin sohbetlerde ayrı ayrı tepki verebilmesini sağlar özelliğini sunmuştu. Bu beğeniyi seçmenlerin sunabileceği tepkili emoji'lerin ve Facebook uygulaması için ilk olarak Şubat 2016 tarihinde sunulmuş olup da hatırlatalım.              Facebook Messenger Tepkileri 2 kez daha kullanıldı! 'in ' in haberine göre, Tepkiler özelliği Messenger 'da yine popüler olarak kanıtladı. Buna göre özelliğin gelmesinin cezası …

Devamını Oku »

Tülin Şahin o soruya çok sinirlendi

                     2017-06-08 21:25:00                                                                      Geride bıraktığımız günlerde katıldığı etkinlikler ile muhabirlerin sorularını yanıtlayan Tülin Şahin, kendisine yöneltilen soruya çok sinirlendi. Tülin Şahin ve Memet Özer, 12 yıllık evliliklerini geride bıraktığımız sonlandırmış ve bu ayrılıkla ilgili konuşmayı tercih etmişti. İkiliden Tülin Şahin'in geride bıraktığımız günlerde katıldığı bir etkinlikte ilk kez muhabirlerin ayrılıkla ilgili sorularını yanıtladı. "Kimse boşanmak için …

Devamını Oku »

İnsana çok çok benzeyen robot, Sofia!

Teknolojinin doğru ilerleyişiyle birlikte, robotlarla içide yaşayacağımız çağa daha da yaklaşıyoruz. Evet, otomasyon alanından garsonluğa kadar robotlar şu an bir alanda alanda kullanılır. Ancak beneyen robotların sayısı şu an epey az. Sophia Hanson Robotik tarafından geliştirilmiş ve geliştirilmiş bir robot benzeyebilecek robot. Mimikleriyle, geliştirilen şakalarla ve düşündüren cevaplarıyla bir insana oldukça benzer şekilde geliştirilmiş. İnsanlarla sağlıklı bir iletişim kurmak için …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Siri IOS 11 ile birlikte daha çok uygulama destekleyecek

Apple'ın yeni mobil işletim sistemi iOS 11 'de Siri önemli yeniliklerin uzmanları bekleniyor. Reuters'in haberini göre Siri, iOS 11 ile birlikte daha fazla üçüncü parti uygulama desteğine verir. Yeni iOS 11 konsepti yayınlandı! Siri'nin kullanım alanı genişliyor! fotoğraf araması ödemeler İma Şartları IOS 10 VoIP çağrısı ve Egzersiz – Uygulamalı Siri ile entegre olmasına izin vermişti. Bu, sanal asistanın doğru …

Devamını Oku »

BA en çok uçuşa başladığını söylüyor; Öfkeli yolcular fac …

                                                                                                          British Airways, 27 Mayıs 2017 Cumartesi günü bir Bilişim Teknolojileri (BT) sisteminde arıza yaşayan havaalanı nedeniyle uçuşlar bittikten sonra, Londra Heathrow havaalanında bagajları ile birlikte Terminal 5'in dışında durdu. British Airways, Londra'daki Heathrow ve Gatwick havalimanlarından Cumartesi günü yapılan tüm uçuşları küresel bir BT olarak iptal etti. Başarısızlık, yoğun bir İngiltere tatil haftasonunda on …

Devamını Oku »

Trump Almanya'ya çok sayıda otomobil ihraç ettiğinden dolayı eleştiriyor

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Donald Trump, başkanlığının ilk dış gezisine dün Brüksel'de dün durdu ve burada Alman otomobil üreticilerini hedef aldı ve Avrupa Birliği liderleri ile bir toplantı sırasında ABD'de çok fazla araç satmak için eleştirdi. "19459014] Almanlar kötüye çok kötü "diyor Der Spiegel, kimliği belirsiz olanları gerekçe göstererek, AB yetkililerine kapalı …

Devamını Oku »

IPhone 6s çok sayı yeni özelliğe sahip LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/05/iphone-6s-cok-sayi-yeni-ozellige-sahip-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 11604', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/05/iphone-6s-cok-sayi-yeni-ozellige-sahip-letsgomobile.org"; Oy verme "id =" Artıtı “/> '+ sayfa [‘positive’] +'% '+ ' ' + sayfa [‘negative’] + '% ' + …

Devamını Oku »

'Lib Dems dizel otomobillerini öldürmek için çok hevesliler'

Geçen hafta Liberal Demokratlar'ın Seçim manifestosunu biraz zaman zaman rahatça seçtim. Bu kötü bir fikirdi, çünkü beni rahatlatmaktan daha çok sinir bozucuyordum, ayrıca gecenin o zaman genç kızlarımı okuduğum kitap türlerine daha uygun fantezi unsurları içeriyordu. Tahrişimin baş kaynağı, dizel araçların ve küçük kamyonetlerin satışlarının 2025'den itibaren Birleşik Krallık'ta yasaklanması önerisiydi. Politika önergesi tamamen beklenmedik değildi; Bu, Lib Demslerinin daha …

Devamını Oku »

Yirmi binde / kenar boşluksuz resim Bizi nasıl kurtaracağımıza kalp kırıklığı. Herkesin bize aşık olabileceğini anlamayan olanlar. Güzelliğimizi, kusurlarımızı, derinliklerini ve kalanları görüyoruz. Yeniden hazır olmamızı bekleyen olanlar bize hak ettiğimiz sevgiyi, yoksun olduğumuz aşkı ve verebileceğimiz sevgiyi gösterebilirler. Ağlamamızda bile, başarısız olduğumuzda bile, kendimizden hoşlandığımız tek bir şeyi bulamayacağımız zaman bile güzel olduğumuzu söyleyen kişilere. Yavaş yavaş bizi tekrar inandıranlar; Hayatta, sevgide ve potansiyelimizde. Bilmeden bizi sadece bizi dinleyip dinleyerek ve orada hiçbir yere gitmemelerini sağlayarak rahatlatarak orada olmak suretiyle hayata döndürenler. Rüyalarımızı, görüşlerimizi ve planlarımızı değiştirmemize rağmen, hayatlarımızda anlam bulmak için uğraştığımızda bile kendimizi anlamadığımızda bile bizi anlamaya çalışanlara. Herkes uzaklaştığında yanımızda olanlara. Bizi mutlu ve eğlenceli olmayı beklemeyenler, acı çekmemiz veya acı çekmememiz için bizi suçlamayanlar. Aşkın gerçekte ne olduğunu bize gösterecek kişilere. Çubuğu çok yüksek kılan, metinlerimize zamanında cevap veren ve konuşmayı sürdüren olanlar, meşgulken bile bizi görmeye çalışan olanlar, gerçekten sordukları için derin sorular soran olanlar Bizi tanımaya ilgi duyuyoruz, mazeret bulamayan ya da bir şeyler ters gittiğinde çok kolay vazgeçenlere ve bizi gerçekten isteyenler bizimle olmak için ne gerekiyorsa yapacaklarını hatırlatanlara Sonsuza dek kalamayacakları halde, sevilmeyi hak ettiğimizi ve fazla talep etmediğimizi anlamamız için [19459109] iyileştirmek için bizim için yeterince uzun kalmış olanlara. Kalplerimizi kıranların bize karşı doğru olmadığını, bize saygı duymadığını, bizi takdir etmediklerini ve bize nasıl davranacaklarını bilmediklerini göstermek için hayatımıza girenler. Sana gerçekten ihtiyaç duyduğumuz zaman geldiğiniz için teşekkür ederiz. Sevgiye layık olduğumuzu ve istediğimizden daha büyük bir sevgiyi gösterdiğiniz için teşekkürler. Bize umut verdiğiniz için teşekkür ederiz. İnancımızı yenilediğiniz için teşekkür ederiz. Korkusuz olduklarından ve diğerlerinin korktuğu her şeye çok teşekkür ederim. Bize yarı sevgi ya da neredeyse ilişkiler ya da mazeretler ya da maybes için yerleşmemenizi hatırlattığınız için teşekkür ederiz. Bize öncelik verilebileceğimizi göstermiş olduğunuz için teşekkür ederiz. Bizi sevenlerin hep bizi ilk tercihte bulunduklarını hatırlattığı için teşekkür ederim. Bizi gülümsettiğiniz için teşekkür ederiz. Bizi güldürdüğün için teşekkürler.

Devamını Oku »

WannaCrypt'ten en çok Windows 7 çekti!

WannaCrypt 'yayında kullanılırken çok problem yaşayan işleyen sisteminin hangisi olduğu ortaya çıktı . Peki, fidye talebinde bulunan bu zararlı yazılımdan hangi işletim sistemi daha fazla müdahalendi? WannaCrypt, Windows 7'nin başarılı belai oldu Windows Vista Windows XP Windows 7 'da bu zararlıdan daha çok problem yaşmadığı ortaya çıktı. Kaspersky tarafından bilinen tüm enfeksiyonların yüzde 98 in Windows 7 sürümlerinde yer aldığı …

Devamını Oku »

Android'de hangi kilit daha çok kullanılıyor?

Güvenlik sözcüğünün kime ait bazı zamanlarda gerçekleri de göz önüne seriyor ya da akıllı aygıtların sunduğu güvende olduğu gibi sahte düşüncelere kapılabiliyoruz. iPhone 6S'te NFC aktif oldu! Android'de şifreleme oranları Fakat bu normal bir durumuşarak standart bir akıllı telefon kullanıcısı direkt olarak uygulamalardan faydalanmak, arkadaşlarıyla iletişimde olmak ve güvenlik gibi önemli konular pek de düşünmemek istiyor denebilir. Bunu Google'dan G …

Devamını Oku »

Steam'de en çok satan oyunları – 21 Mayıs

Bizler bugün siz SDN Takip edilenler için Mayıs ayının üçüncü haftasında, oyun dünyasının en büyük dijital platformu olan Buhar platformunda en çok satanlar listesindeki ] 10 oyunu sıraladık. Haftanın en çok satan oyunları! Öncelikle listemizin ilk Bir süredir vazgeçilemeyecek Counter Strike Global Offensive oyunu yer alıyor. Neredeyse bütün haftalarda ilk 3 sıra içerisinde olmasa da ilk 10 da yer Alan …

Devamını Oku »

Bakterilere virüsün çok yönlü saldırısı işaret ediyor …

                                                                                                                                          Fajlar bir bakteri saldırır. Kredi: Imperial College London      Araştırmacılar, bir virüsün bakterileri öldürmek için tek bir proteine ​​karşı iki uçlu bir saldırı nasıl kullandığını ortaya çıkarmıştır.                                                                                 İmparatorluk Koleji Londra'daki Moleküler Bakteriyoloji ve Enfeksiyon Merkezi MRC'nin bilim adamları tarafından yönetilen uluslararası grup, çalışmalarının sonuçta bakteriyel enfeksiyonlarla savaşmanın yeni yollarına neden olabileceğine …

Devamını Oku »

ESF, 2017 için en çok 10 yeni türünü listeliyor

                                                         <A rel = "lightbox" href = "https://3c1703fe8d.site.internapcdn.net/newman/gfx/news/hires/2017/esfliststop1.jpg" title = " Eriovixia gryffindori yeni bir Örümcek Harry Potter serisindeki Sıralama Hattı adını taşıyor Kredi: Harry Potter serisindeki Sıralama Hattı adı verilen Eriovixia gryffindori>                                         Eriovixia gryffindori Harry Potter serisinde Sıralama Hentesi adlı yeni bir örümcek. Kredi: Harry Potter serisinde Sıralama Hattı olarak adlandırılan Eriovixia gryffindori      Popüler …

Devamını Oku »

Prekambriyen'deki yaşam çok cana yakın olabilir …

                                                                                                          Bir Parvancorina organizmasının modeli. Kredi: Matteo De Stefano / MUSE / Wikimedia Commons      Ediacaran'ın Bahçesi, dünyanın sığ denizlerine muazzam, yumuşak gövdeli yaratıklar şaşırtıcı bir biçimde nüfuz alan eski geçmişte bir dönemdi. Bilim insanları bunu 635 ila 540 milyon yıl önce yaşayan huzurlu, neredeyse pastoral bir ara kat olarak tasvir ettiler. Fakat yeni bir …

Devamını Oku »

IPhone kullanıcıları çok sadık! – ShiftDelete.Net

Yıl sonuna doğru iPhone 7s, 7s Plus ve iPhone 8 modellerinin tanıtılması bekleniyor. Ancak sonrada düşen iPhone satışları bir yana, asıl soru için kaç kişiyi cihazlarını yeni modellerle güncelleyeceği. Araştırma şirketi Morgan Stanley 'in ankete göre iPhone kullanıcıları markaya oldukça bağlı! % 92 değişmeden bağlı!

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

Çok rahat park bankları.

                                         183 Takipçi | 0 Takip                        Kategorilerim                                                                       Diğer İçeriklerim (8852)                                        Tüm içeriklerim                       Takipçilerim (183)                                                              2017-05-16 10:33:00                                                                                                        1                      0                      0                                                                                                                                                                                         …

Devamını Oku »

8 Çok Amaçlı Çok Yönlü Güzellik Ürünleri …

Twenty20 / @leniepanini Birden fazla kullanışlı bir güzellik ürünü satın aldığınızda, Bu, fazladan para harcamak zorunda kalmadan bonus ürünü puanlamak gibidir. Artı, bu çok fonksiyonlu bulgular, daha temiz ve nazik bir yatak odası ve banyo için daha az minimalist ve daha az makyaj tutucu olmanıza yardımcı olur. Bir güzellikürün kullanabileceği çok yönlü yolları fark ettiğinizde, gereksiz önemsiz şeylerden ve pratik …

Devamını Oku »

Haftanın en çok indirilen filmleri – 15 Mayıs

Her ne kadar içerik üreticileri isterse yıllardır torrent 'in önüne geçmek isteyen de bu pek mümkün olanları yapar bililir gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki 15 Mayıs itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Logan Yakın gelecekte, Yorgun Savaşçısı Logan'ın X'i Meksika'ya sınırında saklamıştı. Ancak Logan'ın dünyadan ve …

Devamını Oku »

Charlotte McKinney çok cesur

                     2017-05-14 21:25:00                                           Ünlü oyuncu Charlotte McKinney, katıldığı davette giydiği siyah derin dekolteli elbisesiyle tüm çekilişi. Charlotte McKinney çok cesur Sahil Güvenlik filminde adını duyuran 23 yaşındaki Charlotte McKinney filminde Miami'de yapılan galasına adeta damga vurdu. Miami kumsallarında yapılan galada bacak ve göğüs dekolteli siyah elbisesiyle dikkatleri çekerek Charlotte McKinney, zaman zaman frikik vermemek için eliyle bacaklarını kapamaya …

Devamını Oku »

Gelişmekte olan tamamlayıcı metal oksit yarı iletken (CMOS) tabanlı, yüksek yoğunluklu mikroelektrod dizisi (HD-MEA) Cihazlar, subselüler seviyede yüksek mekansal çözünürlük ve çok sayıda okuma kanalları sağlar. Bu cihazlar, çok sayıda elektron tarafından tespit edilen her nöronla çok sayıda nöronun ekstraselüler aktivitesinin aynı anda kaydedilmesine olanak tanır. Kaydedilen sinyalleri analiz etmek için, spike olayları, "sivri uçlu sıralama" olarak adlandırılan bir süreç olan bireysel nöronlara atanmalıdır. Bir dizi kaynak sinyalinin doğrusal bir karışımı olan gözlemlenen sinyaller grubu için bağımsız bileşen (IC) Analiz (ICA) verileri körü körüne demixlemek ve bireysel kaynak sinyallerini çıkarmak için kullanılabilir. Bu teknik, nöronal kaynakları ayırmak için denetlenmeyen bir yöntemi temsil ettiği için HD-MEA kayıtlarındaki başak sıralama sorununu hafifletmek için büyük bir potansiyel sunmaktadır. Ayrılan kaynaklar veya IC'ler, daha sonra, tek nöron sinyallerinin tahminlerini oluşturur ve IC'ler üzerindeki eşik algılama, sıralı başaklanma sürelerini verir. Bununla birlikte, ekstraselüler nöronal kayıtların ICA gerekliliklerini ne derece karşıladığı bilinmemektedir. Bu yazıda, ICA'nın HD-MEA kayıtlarının sivri olarak sınıflandırılmasına uygulanabilirliğini değerlendiriyoruz. Yüksek zaman-zamanlı çözünürlükte kaydedilen hücre dışı sinir sinyallerinin analizi, kaydedilen verilerin tamamen doğrusal bir karışım olarak modellenemediğini ortaya koymaktadır. Sonuç olarak, ICA nöronal sinyalleri tamamen ayıramaz ve HD-MEA kayıtlarında başakta sıralama için tek başına bir yöntem olarak kullanılamaz. Simüle veri kümeleri kullanarak ICA'nın demixleme performansını değerlendirdik ve performansın nöronal yoğunluk ve başak amplitüdüne kuvvetle bağlı olduğunu bulduk. Ayrıca, ICA'nın en ciddi sınırlılıklarının üstesinden gelmek için postprocessing tekniklerinin nasıl kullanılabileceğini gösteriyoruz. Anahtar Kelimeler: sivri ayırma, çoklu birleştirme, çoklu elektrod. Bu çoklu boyutlu nöronal kayıtların hızlı bir şekilde şiddetlenmesini kolaylaştırmak için bu ileri işlem teknikleriyle birlikte ICA, uygulanabilir bir yöntemdir.

nevrofizyoloji araştırması sinir aktivitesinin ekstraselüler kayıtları, hücrelerarası etkileşimi incelemek ve fizyolojiyi daha iyi anlamak için desenler atmak için önemli bir araç haline gelmiştir Ve nöronal ağların bilgi işlemesi. Çok birleşimli kayıtlarda elektrotlar, çok sayıda bireysel nöronun eşzamanlı aktivitelerini izler. Analiz için, bireysel nöronların başak eğrileri daha sonra kaydedilen veriden çıkarılmalıdır; bu süreç genellikle "başak toplama" olarak adlandırılır (Lewicki, 1998). Genellikle, …

Devamını Oku »

Opera hızlı, yeni eklemeler ile çok iyi …

                     2017-05-11 13:46:00                                                              Opera hızlı ve güvenli bir tarayıcı mı, şimdi gezinti yaparken aynı anda What'sApp veya facebook mesenger ile mesajlaşmasını yaptır eklemeleri güzel olmuş denemenizi tavsiye ederim … Indirme yeri: http: //www.opera.com/tr                                           1                      0                      0                                                                                                                                       Kaynak

Devamını Oku »

Okulların Şampiyonları Takımları Belli Oldu! Avanos, Nevşehir'de düzenlenen ve 51 KKTC'den 121 takım, 594 sporcunun yarıştığı Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Düzenlenen ödül töreniyle sona erdi. Spor Genel Müdürlüğü Okul Sporları Şube Müdürlüğü'ne, Türkiye 2007 yılından bu yana, Satranç Federasyonu ve Türkiye İş Bankası'nın destekleyicileri ile birleştiğinde Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Avanos Atatürk Spor Salonu'nda gerçekleştirilecek ödül töreni ile sona erdi. 3 Mayıs 2017 akşamında final yarışmasının ödül töreni; Nevşehir Valisi İlhan Aktaş, Gençlik Spor İl Müdürü Mustafa Ünlüer, Türkiye İş Bankası Kurumsal İletişim Müdürü Suat Sözen, Türkiye Satranç Federasyonu Başkanı Gülkiz Tülay, Avanos Gençlik Hizmetleri ve Spor İlçe Müdürü Kerem Yılmaz, TSF Başkan Vekilleri Prof. Dr. Yusuf Doğruer ve Aşkın Keleş , Yönetim Kurulu Üyesi Ümit Şifaver, Nevşehir Okul Sporları Şube Müdürü Aslan Uçar, Okul Sporları Şefi Hüseyin Karatut, Türkiye İş Bankası Kurumsal İletişim Birim Müdürü Müge Nevşehirli Veziroğlu, TSF Nevşehir İl Temsilcisi Birsen Babacan Çengel, antrenörler, öğretmenler, veliler, sporcular ve çok sayıda Davetlinin katılımıyla gerçekleşti. Spor Genel Müdürlüğü'ne düzenlenen Eğitim Takvimi, Satranç Türkiye Birinciliği'ni, Türkiye İş Bankası'nın destekleyicisi ve öğrencilere verdikleri hediyelerle ilgili daha fazla bilgi almak TSF Başkanı Gülkız Tulay, okul Larda satranç sporunun daha fazla yerinde alması ve öğrencileri bu sporla buluşturmayı çok önemsedikleri açıklama bulundu. Tüylü sözleşmeyi şöyle sürdürdü: "51 ilimiz ve KKTC'den 121 takım ve 594 öğrencimiz centilmence ve dostça hamle yaptılar 7 tane tur boyunca. Öğrencilerimiz okullarını zirveye çıkarmak için yarıştılar and 경쟁in birlik ve beraberlik ile iç içe geçtiği bir final heyecanı yaşattılar bizlere. Bu yazıda, yazarların yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, Açılış konuşmalarının ardından, 6 kategoride ilk dört dereceyi, 6 kategoride ilk dört dereceyi Elde Edilme Formu. Ders >> Küçükler Kızlar (19459006) >> Yazan: Küçükler Kızlar – – Küçükler Genel / Yıldızlar Kızlar – Yıldızlar Genel / Gençler Kızlar – Gençler Genel Küçükler Kızlar

Özel Kocatürk Ortaokulu, Manisa Kılıçarslan Ortaokulu, Samsun Çerkezköy Tepe Ortaokulu, Tekirdağ Mağaracık Ortaokulu, Hatay Küçükler Genel Özel Bursa Bahçeşe Bahçeşehir Koleji Ortaokulu, Ankara Özel Bursa Bahçeşehir Ortaokulu, Bursa ] Kaynak

Devamını Oku »

İlk çeyrekte en çok hangi telefon sattı?

Strateji Analizi Şirket tarafından yapılan araştırmaya göre yılın ilk çeyreğinde en çok satan telefon markası belli oldu. Apple taçını geri aldı! Yapılan araştırma sonucuyla birlikte geçen seneki sıralamaya göre ciddi değişikler ortaya çıktığında görmek. Bu yıl oldukça iddialı ürünlerle kullanıcıların karşısına çıkan firmalar, kimi iş beklentisine karşıladı, kimisini hayal kırıklığına uğrattığını söyleyebiliriz. Araştırma raporuna göre Apple Samsung 'a kaptırdığı tacı …

Devamını Oku »

Haftanın en çok indirilen filmleri 8 Mayıs

Her ne kadar içerik üreticileri isterse yıllardır torrent 'in önüne geçmek isteyen de bu pek mümkün olanları yapar bililir gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki 8 Mayıs itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Kabuktaki Hayalet Yıl 2029. Dünya, Güneş, Güneş, Güneş. Düzen, süper güçlü ve istekleri yere …

Devamını Oku »

Çok yönlü dürtüsellik fel …

Nörofarmakoloji. 2016 Ekim; 109: 69-77. Michel Engeln, a, b, 1 Solène Ansquer, c, d, 1 Emilie Dugast, d, e, f Erwan Bezard, a b David Belin, f, g, 2 ve Pierre-Olivier Fernagut a, b, a a Univ. De Bordeaux, Institut des Mérathies Neurodégénérants, UMR 5293, F-33000, Bordeaux, Fransa b CNRS, Institut des Maladies Neurodégénérants, UMR 5293, F-33000, Bordeaux, Fransa c …

Devamını Oku »

Steamde en çok satan oyunları 6 mayıs

SDN SDN Takip edenler için Mayıs ayının ilk haftasında, oyun dünyasının en büyük dijital platformu olan en çok satanlar listesindeki 10 oyunu sıraladık. Öncelikle listemizin ilk hazır çıktığı günden bu yana en çok satanlar listesinde hep üst sıralarda olmayı başaran Playerunknows Battlegrounds var. Fiyatı 69 TL oyuna geri dönüşlerine bakacak olursak, kısa sürede oyuncuların gönüllerinde taht kurmayı başarmış gibi gözüküyor. …

Devamını Oku »

Hindistan'da Top 5 En Çok Satan Superbikes

                         Harley Davidson, 2016-17 yılları arasında çok satan süper bisiklet listesinde birinci sırayı aldı. Bu listede düşünülen süper bisikletlerin satışı, tümü 5 R. R.'yi aşan yükseklikte ve 500 cc'nin üzerinde motor kapasitesine sahip. Harley-Davidson Street 750, en çok satan premium motosiklet modelidir ve Nisan 2016 – Mart 2017 döneminde 2.100 bisiklet satmaktadır. Bu, mali yılda satılan toplam 8.696 süper bisikletin …

Devamını Oku »

Yeni Porsche 911 GT3 Öncülüğünden Çok Daha Hızlı »AutoGuide.com News

2018 Porsche 911 GT3, önceki modele göre 12,3 saniye daha hızlı Nurburgring ile yarıştı. Alman otomobil üreticisi yeni modeli Porsche 911 GT3'ü, son modelin süresini 12.3 saniyede geçerek 7: 12.7 Nürburgring tur zamanında döndürdü. Yeni parkur odaklı GT3, bu yılın başlarında Cenevre Motor Show'da 500 beygir gücü ve 339 pound-feet spor torku ile başlayarak 3.153 pound ölçekler kazandı. Tur antrenörünün …

Devamını Oku »

& # 039; Gerçek Kişiler & # 039; Chevrolet'in Yeni Ekinoksunu Çok Satmasına Yardımcı Olun

Bazı noktalarda, Chevrolet, markanın araçlarının ne kadar iyi olduğu konusunda gerçekten şaşıracak Amerikalıların tükenmesine neden olacak. Ancak şimdilik Chevrolet, Equinox SUV 2018 versiyonunun hayata geçirilmesine "Gerçek Kişiler değil, Aktörler Değil" kampanyasının modus operasını uygulamaktan mutluluk duyuyor. Kaynak

Devamını Oku »

Birbirine çok çok yakışan 7 dizi çifti

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

Bu, Bir Sanat Öğrencisinin Yaşamının Çok Vedat Olan Nedenidir?

unsplash.com Uyanır ve yüzünüzü soyarsınız Yastık ve gözlerinizi ovun. Lanet olsun ve yüzünüzü tekrar yastığa koyarak ertelenirsiniz çünkü hiç uygun bir gece uykusunu almayacaksınız. Dün gece çok geç, okulla hiçbir ilgisi olmayan bir eser üzerinde çalışıyordun. Nihayet kalkın ve tuvalete gidin ve yüzünüze bir göz atın, dün gece yapılan çalışmalardan gelen bir çizgi fark edip, erken bir kırışık gibi davranın, …

Devamını Oku »

Hindistan'da En Çok Satan 5 Bisiklet

                         Hintli Otomobil Üreticileri Derneği (SIAM) tarafından yayınlanan verilere göre, Hindistan iki tekerlekli pazarı, 2017 mali yılı boyunca yıllık% 6,9 artış kaydetti. Nisan 2016 – Mart 2017 arasındaki dönemde Hindistan, bir yıl önce satılan 1.65 çift iki tekerleğe kıyasla 1.76 çift iki tekerleği sattı. Bu sayıdan yaklaşık 56 çift iki tekerlekli scooter idi, ancak motosikletler yine de mali yıl boyunca …

Devamını Oku »

Haftanın en çok indirilen filmleri – 2 Mayıs

Her ne kadar içerik üreticileri olsaydı, torrent'in önüne geçmek isteyebilir miyiz bildiğiniz gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki 2 Mayıs itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Logan Yakın gelecekte, Yorgun Savaşçı Logan'ın X'i Meksika'ya sınırında saklamıştı. Ancak Logan'ın dünyadan ve kendi efsanesinden saklanma çabası, karanlık güçler tarafından …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Royal Enfield, En Çok Yüklenilen Aylık Satış Numaraları

                         Royal Enfield, Nisan ayının 2017'de 60.142 bisiklet satarak şirketin en çok satan sayılarını tek bir ayda yayınladı. Bu rakamların yalnızca iç pazardaki satışları 58.564 bisiklet oluşturdu ve bu rakam başına 25 artış kaydetti. Yüzde bir yıl önce aynı dönemde. Nisan 2016'da, Royal Enfield toplam 48.197 bisiklet sattı. Satışlar büyük oranda Royal Enfield'in satışlarının yüzde 68'inden fazlasını FY 2017'de gerçekleştiren …

Devamını Oku »

2017 Honda Civic Type R görünümü çok fazla mı yoksa sadece doğru mu?

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Yeni Honda Civic Type R'nin dış tasarımı, internet forumlarında Honda fanboys ve fangirls'lar arasındaki tartışmayı karıştırıyor. En yeni Civic Type R'nin başlangıcından önce, spor alanındaki agresif dış görünüşü, satış sonrası kataloglardan birkaç sipariş almak için kullanılıyordu, sayısız mezarlık, Drive-Thru'da, Home Depot'ta satın alınan cıvatalarla vücut kitlerinin inexpert uygulamasında …

Devamını Oku »

Daha çok elbise giymeniz için 5 çok etkin neden

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın doğru olduğu ve önereceğiniz bilgiler. Açıklamaları okumaya devam ediniz: Eğer siz de bu konuda reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Peugeot, satış teşviki çok popüler olduktan sonra üst düzey Alman yetkilileri ateşlediğini söyledi

Peugeot'un 208 leasing teklifi geçmek için çok iyi oldu. FRANKFURT – PSA Group, binlerce Peugeot 208 otomobilinin liste fiyatının% 40'ından fazlasının satıldığı bir satış kampanyası sonrasında Almanya'daki en üst düzey yöneticilerin üçünü görevden aldı Otomotiv Haberleri Avrupa kardeş yayın Automobilwoche bildirdi. Sixt Leasing ve İnternet sağlayıcısı 1 & 1 ile olan işbirliğinde Peugeot, 208 subcompact'ini 99 avro gibi kısa bir …

Devamını Oku »

Yaşlanma ile ilişkili yürüyüş değişiklikleri iyi tanımlanmış olmasına rağmen, merkezi fonksiyonel değişiklikler hakkında çok az şey bilinmektedir.

Yaşla birlikte distal alt ekstremite hareketlerinin motor kontrolü. Beyin aktivitesinde, fonksiyonel manyetik rezonans görüntüleme (fMRI) ile çalışmak için uygulanabilir bir yürüyüş unsuru olan tekrarlayan ayak bileği hareketlerinin kontrolü ile ilişkili yaşla ilgili değişiklikler olduğunu varsaydık. FSL kullanarak 20-83 yaş arasındaki 102 sağ ayak hakim sağlıklı katılımcıdan standartlaĢtırılmıĢ fonksiyonel manyetik rezonans görüntüleme verilerini analiz ettik ve koordinat temelli aktivasyon olasılık tahminini …

Devamını Oku »

Mink Mingle Sevdiğim birisi derinden beni çağırıyor. Kalbi kırıldığını söylüyor, bana geri kazanmaya çalıştığını söylüyor, ona ihtiyacı olan şeyi, nasıl güvenini kazanabileceğini, doğru şeyleri yapmak için neler yapabileceğini soruyor. Dinliyorum. Ona değerini hatırlatırım. Ve sonra sinirlenirim. Çünkü yardım edemem ama neden bu adamın bir milyon ve bir şeyi denemediğini merak ediyorum. Neden çiçeklerini almadı? Her sabah ve her gece ve hatta gün boyunca onu neden düşünüyor olduğunu göstermek için neden ona mesaj atmadı? Neden ona bir mektup yazmadığı ya da onu yemeğe götürmediği ya da en sevdiği şeker çubuğunu alıp çantasına sokmadığı ya da bir rölyefle rengarenk bir battaniye üzerinde sergileneceğini sorup durmadığını sordu. yıldızlar? Yoksa onu tekrar tekrar hatırlattı, nasıl berbat ettiğini ve onu kaybetmek istemediğini mi? Dinlediğimde, onu geri getirmek için sahip olabileceği bir milyon ve bir fırsattan geçtim, onun endişeli zihnini hafiflettiği söylenebilecek tüm sözleri, ona göstermek için yapabileceği tüm küçük şeyler Önemli olan, katlanarak, ona. Ağlıyor Diye bağırıyor bağırıyor. Neye ihtiyacı olduğunu söyledi, bana neden korktuğunu, nasıl incildiğini, kalbinin güvensizlikten ve kırılmasından nasıl acı çektiğini ve hiçbir şey yapmadığını söylediğini söyledi. Ona sadece ona ihtiyacı olan şeyi gösterebileceğini, kendisini sevmenin yollarını söyleyebileceğini istiyor olduğunu söyledi. Yardım edemem ama bunun yanlış olduğunu düşünüyorum. Çünkü bu adama onu nasıl seveceğini söylemek zorunda kalmamalı, işleri doğru yapmalı. Ona nasıl zarar verdiğini görmesine izin vermemeli, kırık olanı nasıl düzeltebileceğini ona göstermeliydi. Hiçbir şeyi açıklamak zorunda kalmamalı, çünkü onu sevilen biri olarak zaten biliyor olmalıydı. Sözünü dinlerken, kendi ilişkilerimi düşünüyorum. İlk aşkım olduğu için bana nasıl bakacağından emin olmadığı için ya da çok duygusal olduğum için, güvenime ne kazandığından emin olmadığı için ya da benim güvenimi kazandığımdan emin olmadığına inandığım insanlardan bahsediyorum. Hassas ve inatçı olduğum için sevmeyi zorladım. Mazeretlerim var. Aklıma getirdim. Sorun olduğunu düşündüm. Ben, çok fazla kaleyi seven, o adamların beni nasıl seveceğini bilmediğini sanıyordum. Fakat birileri seni seviyorsa seni seveceklerdir. İhtiyacınız olan her şekilde sizi seveceklerdir. Nasıl yapacaklarını bildikleri her şekilde seveceklerdir. Seni sevecekler ve bu sevgiyi defalarca kanıtlayacaklar, çünkü seni kaybetmek istemiyorlar. Gerçek aşk bu. Hepimiz kusuruz, ama birisi gerçekten mahvederse, onu doğru yapmak için her şeyi yapıyor olacaklar. Beklentileri çok yüksek tuttuğunuza inanmak için sizi suçlamaya çalışmazlar. Senaryoyu ters çevirmezler ve sadece zaman çizelgesinde onları bağışlamadığınız için yanıltıcı olanınız gibi davranırlar. Onları kol uzunluğunda tutmak için kendinizi kötü hissettirmezler, çünkü hala inciniyorsunuz. İhtiyacınız olduğunu düşündükleri ya da ne istediklerini algılarlarıyla eşleşmediğinden, ihtiyacınız olan şeyi görmezden gelmeyeceklerdir. Sorunlar olduğunda bir arka koltuk almayacaklar ve onlarla nasıl başa çıkılacağına dair ipucu olmayacak. Bakın, biri sizi sevdiğinde ne yapılacağı söylenemez. Nasýl bakým, nasýl hazineden geçirileceði, kayıp zamanın veya bencil eylemlerin telafi edileceği konularında söylenecekleri yoktur. Seni öpmek, nasıl tutmak, özür dilemek ya da takdir etmek ya da istediğini hissettirmek gibi neden söylenmesi gerekmiyor. Seni seven biri seni gerçekten seviyor, seni düzeltmek için elinden geleni yapıyorlar, ne yaparsan yap, elinden geleni yapabileceklerinden emin olman için elinden geleni yapıyorlar. Sana neye ihtiyaç duyduğunu özel olarak anlatmamalarını istiyorlar. Adım adım açıklamanı beklemeyecekler. Hayır, her zaman doğru yolu bulamıyor olabilirler, ancak

deneyebilirler

Devamını Oku »

Daha Çok Ekonomik Bir Supercar Bu Yaz Gelecek »AutoGuide.com News

Rezvani Canavar Alpha'nın bu yaz 100.000 dolardan daha az bir miktarda başlayacağı bildiriliyor. 500 beygir gücü ile 2,5 litrelik bir turbo motora sahip olan Rezvani Canavar Alpha, 1,950 libre (885 kilogram) ağırlığında iken sadece 3,2 saniyede 0 ila 60 mph arasında bir hızla yol alacağını iddia ediyor. Supercar, 2016 L.A. Auto Show'da yerini aldı ve o sırada Amerikalı otomobil 200.000 …

Devamını Oku »

Haftanın en çok indirilen filmleri 24 Nisan

     Her ne kadar içerik üreticileri isterse yıllardır torrent 'in önüne geçmek isteyen de bu pek mümkün olanları yapar bililir gibi. Her gün milyonlarca insan "Torrent'a düşen" filmleri, müzikleri ve dizileri indirmeye devam ediyor. Peki Nisan itibarıyla sonlanan geçtiğimiz hafta en çok hangi filmler indirildi? 1- Logan Yakın gelecekte, yorgun savaşçı Profesör X'i, Logan'ın önemsediği tek şeylerden dolayı Meksika sınırında …

Devamını Oku »

20+ Çok Kısa Saç Stilleri Resimleri Her Leydi Görmeye İhtiyacınız Var | Kısa Saç Stilleri 2016 – 2017

Süper kısa saç kesimi yapmak ya da başınızı tıraş etmek için saçlarınızı kesmeyi hiç düşündünüz mü? Gerçekten yüz özelliklerini vurgulamak ve gerçek güzelliğini sergilemek için bir ömür boyu kısa süren bir saç kesimi ile gidebilirsiniz. 1. Soğuk Tıraşlı Kısa Saç Stilleri Tıraşlı stilin güzel yüzünü gösterebildiğini ve gözlerinin renginin açılmasını sağlayacak kadar yoğun olan bu saç dönüşümü. Kaynak 2. Çok …

Devamını Oku »

Niçin Niçin Çok Neden Oldu 13 Sebebi '

13 Sebebin Nedeni Netflix'in başarısı hakkında beni kızdıran ilk şey, İnsanlara neden bir aşk hikayesi dediğini duyan 13 Sebep Fakat ben mecazen kaçıp gittigimin asıl nedeni, Hannah Baker'in kendini cehennem şerit hak ettiği pek çok nedenden ötürü gösteriyi kızdırdı. Eğer görmüyorsanız, duymadıysanız veya bu sergiyi yüzünüze sokmadıysanız, sana uçurum notlarını vereyim. Lise öğrencisi Hannah Baker intihar etmeden önce, hayatına son …

Devamını Oku »

Milano, ABD ve İngiltere'den En Çok Aranan Eğilimler

Son Milano ModaUomo şovunda erkekleri erkek çocuklara ve erkek çocuklara "erkeksi" bakmaları için şekillendirdiklerini ilan ettiler! Saç trendleri dinamik ve çok yönlü idi – işte profesyonel olarak bakımlı görünmeleri gerekebileceği günümüzde önemli bir nokta olan bu boş zamanları yüksek moda bir görünüm olarak tercih ediyorsunuz. Gelişmiş ve sportif, erkekler için en iyi saç kesimleri, birçoklarının 2017'de erkek saç modellerinde önemli …

Devamını Oku »

"Sosyal destek, kanserle mücadelede çok önemli" | Sağlık

     Dünya Bülteni / Haber Merkezi İstanbul Anadolu Güney Kamu Hastaneleri Birliği Genel Sekreteri Doç. Dr. Ahmet Lütfullah Orhan, kanser hastalarının doğum öncesi ve hastalık etkenleri için yaş psikososyal sorunlar en aza indirmelerinde sosyal desteğin önemli bir role sahip olduklarını bildirdi. Orhan, yazılı göründüğünde, kanserin, günümüzün önemli sorunlardan birisi olduğunu belirtti. Tanı ve tedavideki yenilikler, sağlık kuruluşlarından çıkarılmasına izin veren …

Devamını Oku »