17 Aralık 2017,Pazar
Anasayfa » Tag Archives: Bu

Tag Archives: Bu

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Amiloide Yapısal Değişiklik … Aβ fibril polimorfizminin AD'nin klinik ve patolojik özelliklerinde değişikliklerle ilişkili olabileceğine dair kanıtlar şunları içerir: (i) Farklı molekül yapılarına sahip Aβ40 fibrilleri, primerde farklı toksisite seviyeleri sergiler Nöronal hücre kültürleri 1 ; (Ii) Harici amiloid içeren biyolojik materyal tarafından indüklenen, transjenik farelerde amiloid biriktirme şekilleri, bu maddenin kaynağına göre değişir 13,14 ; (Iii) Transgenik farelerde sentetik Aβ42 fibrilleri ile indüklenen amiloid plaklarının boyutu ve bileşimi, bu fibrillerin morfolojisi ve büyüme koşullarına bağlıdır 15 ; (Iv) Aβ42 agregalarının beyin dokusunda kimyasal dağılımı ve direnci, hızla ilerleyen ve yavaş yavaş ilerleyen AD hastalarında farklılık göstermektedir. 16 AD'deki nörotoksik Aβ yapılarının yapılarının karakterizasyonu geliştirilmiş ve yapı ile Hastalık fenotipinin, patogenez hakkındaki anlayışımızda, uygun tanı ve terapötik biyolojik belirteçlerin gelişimine ve ilaç geliştirme üzerine önemli bir etkisi olacaktır. ssNMR'den gelen veriler, yapısal değişikliklere özellikle duyarlıdır ve iki boyutlu (2D ) 13 C- C ve N- 13 C ssNMR spektrumları, spesifik fibril polimorflarının "parmak izleri" olarak kullanılmaktadır. 1,4,20,21 ssNMR, miligram ölçekli miktarda izotopik olarak işaretlenmiş fibril gerektirdiğinden, beyin dokusunu tohum büyümesi ile büyüttüğü ve etiketlediği beyin dokusunun kaynağı olarak . . tarafından tanımlanan fibril tohumları Farklı suşların farklı hastalık süreleri ürettiği prion hastalıklarına benzer olarak, Ve hastalıkla ilişkili prion proteinlerinde konformasyonel farklılıklar ile ilişkilidir 17-19,22 görme işleminin bozulması ile ilişkili PCA-AD gibi olağandışı iki AD alt tipindeki hastalardan doku örnekleri seçtik. 23 ve n-dejenerasyonunun aylar içinde gerçekleştiği ve kliniksel olarak Creutzfeldt-Jakob hastalığına benzediği r-AD 24 Demans olmadan ölen üç kişi (ND) Otopside Aβ depolanması bulunduğu tespit edildi. Aβ40 ve Aβ42 fibrillerini, amiloidle zenginleştirilmiş korteks özlerinden tohumlanmış büyüme ile ayrı ayrı hazırladık. Tüm fibril numuneleri için transmisyon elektron mikroskopu (TEM) görüntüleri alındı. Tüm örnekler için ssNMR ölçümleri denendi, ancak bazı durumlarda sinyal / gürültü oranları 2D spektrumlarının edinimi veya müteakip analizi için yetersizdi. Doku örneklerini, hasta kategorilerini ve ssNMR ölçümlerini özetler. TEM görüntülerinin örnekleri ve 2D spektrumlarının tam setleri -. AD olmayan bir hastanın korteks özü ile kontrol deneyleri önemli Aβ depolanmasına sahip değildir Ek Tartışma ve

Beyin tohumlanmış Aβ42 fibrillerinin temsili TEM görüntüleri ve 2D ssNMR spektrumu

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Asteroit getirin, bu yüzden bir buzdolabında chuck yapabiliriz …

                                  NASA, kurtarma dünyasından-asteroitlerden birinin ön tasarım aşamasına geçmesini, 2020'lerin başlarında umutlandırıcı bir başlatma yolunda ilerlemesini önerdi.                  Önde giderse, DART – Çiftli Asteroid Yönlendirme Testi – uzay ajansının anlattığı şeyle "tehdit oluşturmayan küçük bir asteroid" olarak başlayacak. Bu şekilde, muhtemelen, yanlış bir şekilde çalınırsa, bir tür büyükşehir (veya küresel) felaket getirmez.                  NASA'nın açıklaması, asteroid ikili sistemi Didymos'u …

Devamını Oku »

Bu görseller iPhone 8'e mi ait?

iPhone'un markasının hisse senedi kutlanacağı Sonbahar aylarında Apple'ın iPhone 8 'i tüm dünyaya tanıtacağı biliniyor. 8 için bugün de yepyeni görseller paylaşıldı. Gerçekten iPhone 8 olabilir mi? tarafından yazan Benjamin Geskin Twitter yayımlanan görsellerin gerçekten iPhone 8'e ait olabileceği iddiaları internette dolaşmaya devam ederse yine de bu görsellerin resmi olarak söylememiz gerek. Daha önce Foxconn'da Çalıştı iddia eden ve iPhone …

Devamını Oku »

Bu yanlışlar saçları üzüyor! | Saçlarım ve Ben

Hacimli, parlak görünen, sağlıklı saçlar herkesin hayali. Bir formül var. Bir formül var. Saçla ilgili ürünlerini ayrı ve vazgeçilmez bir hale getirmek için iddiaları vardır. Bir başkasının saçlarından muhteşem görünmesini etkinleştirmek formüller sizin saçlarınızda aynı etkiyi yaratmayabiliyor. Farklı saç yapılarının ihtiyaçlarını ve uygulanan bakımların verdiği sonuçlar farklılık gösteriyor. Bütün bunlar yanında bir de herkesin doğru bilip. Neymiş o yanlışlar birlikte …

Devamını Oku »

Bu basit kan testi kanseri yıllar önce öngörebilir

Yeni uç bir noninvazif kanser testi, basit kan testiyle birlikte kanser teşhisi yapabileceğimiz bir geleceğe giden yolda, fizibilite çalışmalarının ilk aşamasında umut verici sonuçlar ortaya koydu. " Sıvı biyopsi " de denen teknoloji, tümörlerden kopmuş DNA parçaları kanı için tarıyor. Şu anda kanseri tespit etmek için en iyi yöntem biyopsi yapmak, yani laboratuvar analizleri için tümör dokusundan küçük bir parça …

Devamını Oku »

Sen Bu Gece Öldün – mgezer

<! – ->                                                                                                                                                             ';                                                                         For (veri içindeki var i) {                                                                             html * = "http://mgezer.blogcu.com/";                                                                             html * = "http://mgezer.blogcu.com/";                                                                         }                                                                         html * = "http://mgezer.blogcu.com/";                                                                     }                                                                     $ ( "# Featuredbox") önce (html).;                                                                 }                                                             );                                                             }                                                             Var keyNone = 1;                                                             Işlevi checkKey (e) {                                                                 If (keyNone == 0)                                                                     Doğruyu döndür; …

Devamını Oku »

35+ Soğuk Kısa Saç Stilleri Bu Yazı Kaybedeceksiniz | Kısa Saç Stilleri 2016 – 2017

Yaz geldi ve hepimiz sıcak yaz günlerinde yeni bir görünüm istiyoruz. Farklı serin ve şık kısa saç kesimleri var, çünkü kadınlar arasında mükemmel bir saç stili seçebiliyorlar. 1. Soğuk Blonde Kısa Bob Saç Stilleri Bu kısa bob saç platin sarışın balayaj ile renklendirilmiştir ve gerçekten modern ve şık görünüyor Kaynak 2. Uzun Bob Saç Stilleri Uzun bob saç stilleri çok …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Kılıçdaroğlu, Ankara'dan sunde bu sözlerle başla …

                     2017-06-15 13:13:00                                                                      CHP Genel Başkanı Kemal Kılıçdaroğlu, CHP Milletvekili Eniş Berberoğlu'nun tutuklanmasının ardından bugün Ankara'dan İstanbul'a 'Adalet Yürüyüşü'nü başlattı. Güvenpark'a gelen Kılıçdaroğlu, "Bir dikta yönetimi ile karşııyayız .. Adaletin olmadığı bir ülkede yaşamak istemiyoruz." Beleğe kemiğe dayandı artık. Bıçak kemiğe dayandı artık. "Diye konuştu. . Kılıçdaroğlu'nun günde 18 km katedeceği, yürüyüşün 28 gün sürmesi bekleniyor. …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Nokia 9 Amerika'dan bu yana!

HMD Global 'in yeni amiral gemisi Nokia 9'un GeekBench skorları ve prototipinden sonradan FCC sertifika bilgileri ortaya çıktı. FCC sertifikası, hem cihazın ABD'de satışa sunulması hem de cihazla ilgili yeni bilgiler veriyor Nokia 9 ABD onayı aldı! Nokia 4GB ve 8GB RAM Kapasite Değişim Çeşitleri 8GB RAM Gece Kıyafeti testi Sonuçlara Göre Cihazın Snapdragon 835 Yonga Setine Sahip Olayın ortaya …

Devamını Oku »

Tüm yeni MSI ürünleri bu videoda!

Computex 2017 MSI'yı fuarının önemli firmalarından biri yaptı. Yeni dizüstü bilgisayarlarıyla beraber X299 ve X399 serisi anakartları duyuran şirket, bu ürünleri fuarda sergiledi. Bu videomuzda MSI 'nın tüm yeni ürünlerini konuştuk. Computex 2017'de tanınmış mı? Günümüzde bazı dizüstü modellerini de güncelledi. GT83VR Titan SLI modeli, artık yeni nesil Kaby Lake işlemciler kullandığınız ve klavye tarafında bazı farklılıklar sunuyor. Bunun yanı …

Devamını Oku »

Kız arkadaş edinmek yerine bu oyunu oynuyorlar!

Illusion tarafından geliştirilen VR Kanojo popülerliğini arttırmaya devam ediyor. Sakura Yuhi isimli üyemiz çevrimdışıdır. Sakura Yuhi adlı oyuncunun katıldığı birliktir. oyuncuların yeni kız arkadaşı Sakura oldu 18 yaş üstü bir oyun ve bir oranda cinsellik de içeren VR Kanojo sadece bu iki özellikle çıkış zamanı odak noktası olmayı başarmıştı. Aradan geçen zaman içinde VR Kanojo oynayanların sayısı giderek artmaya devam …

Devamını Oku »

Büyük Aşk Bu Fotoğrafla Belgelendi

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın üstünde bulunup bulunmadığını belirten bir reklam. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Nokia 9 bu kez 4 GB bellek ile göründü!

Geçtiğimiz günlerde sizlere GeekBench üzerinde görünen 8 GB bellekli Nokia 9 haberini iletmiştik. Yukarıdaki yazılara bakınız, kaçırdıysanız, takip ederseniz gidekle ilgili haberleri göz atmanızı tavsiye ediyoruz. Nokia 9 farklı modellerle mi satılacak? Bugün ortaya çıkan 27 farklı GeekBench sonuç görseli ise yine Bilinmeyen Kalp Adındaki cihaza ait ve testlerde Snapdragon 835 işlemci ve 4 Golgede yer aldığı görülebiliyor. Öncelikle Bilinmeyen …

Devamını Oku »

Bu, En Gördüğünüz En Epik Sıcak Tekerlek Videosu »AutoGuide.com News

Bu, muhtemelen şimdiye kadar gördüğümüz en karmaşık ve abartılı Sıcak Tekerlekler izi. Video, Mark Rober tarafından oluşturuldu ve Ghostbusters'ın Ecto-1, Back to the Future 'un DeLorean, Şövalye Binicisi ' ın KITT, minibüsü A Takımı ve Scooby Doo'nun Gizemi Makinesi'nden. Rober saniyede 2.500 kare çekilen patlayıcı final ile tüm hareketleri yakalamak için GoPros, Kırmızı Destanı ve Phantom yüksek hızlı kamera kullandı. …

Devamını Oku »

Yeni Volvo XC60 İncelemesi: Bu Yıl Hindistan'a Geliyor

                        XC60, Volvo'nun küresel çapta en çok satan otomobil modeli hattı ve Avrupa'nın en iyi kompakt SUV segmentinde bir numaralı satıcı. Oldukça iyi bir üne – özellikle de çok uzun zaman önce yazılmaya hazır bir markadan gelen bir otomobil için, değil mi? Yaşam döngüsünün son yılında bir markanın en çok satan modeli olmak, S90, V90 / V90 Cross Country, XC90 ve …

Devamını Oku »

Bu araba parklarının geleceği mi? Valet parking robot

Stan ile tanışın. Havalimanı park yeri tatillerde ve iş seyahatlerinde önemli bir kayıp kaynağı olabilir. Pahalı olmanın yanı sıra, dönüşünüzde hangi bölgeyi park ettiğinizi unutmanız garanti altındadır ve her zaman, dikkatsiz bir tatilcinin veya aşırı ateşli bir vale görevlisinin, siz dışarıdayken kapınıza çarpması ihtimali vardır. Kâbusların kabusları. Neyse ki, Stanley Robotics ekibi tüm bunları tarihe götüren bir çözüm geliştirdi. Onların …

Devamını Oku »

Uhhhhhh, Drake Referansları 'Neden Bu Neden …'

Eğer onu kaçırdıysanız, herkesin en sevdiği şarkı rapçisi, eve alarak Billboard Müzik Ödülleri kayıtlarını kırdı. Önceki kayıt sahibi arasından 13 şeref attı, Adele. Toronto cutie açıkçası haklı bir şekilde stoked ve onun kupa paylaşmak Instagram aldı. Çünkü bir kayıt kırdıklarında bu olanlardandır. Neden 13 Neden … üzerine champagnepapi (@champagnepapi) tarafından paylaşılan bir yazı 22 Mayıs 2017, 14:57 PDT Uhhhh, alıntı …

Devamını Oku »

Erkek arkadaşın bu 8 şeyi yaparsa, O Lov'dadır …

Joao Silas Aşık olmak çok güzel bir şeydir. Ama aynı zamanda biraz strese neden olabilir. Kendinizi düşmelerine izin vermek istiyorsunuz, ancak bir soru sormak sizi bekliyor: Eşiniz sizi seviyor mu? Bir gün, bencil olmayan bir şekilde sevmeyi öğrenebilirsiniz. O aşkın karşılıklılığını gerektirmeden sevmeyi öğrenebilirsiniz. Sonuçta, sevilmediğin için sevmiyorsun; Seviyorsun çünkü bir başkasının sevilmeyi hak ettiğine inanıyorsun. Ve sevginin hak etmesi …

Devamını Oku »

Aşk insanı bu kadar mı güzelleştirir

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

Tülin Şahin ve Memet Özer bu işe mi boşandı?

                     2017-05-22 11:31:00                                           Malken Tülin Şahin ve Memet Özer, 12 yıllık evlilikleri geçtaltı haftalarda sessiz sedasız bitirdi. Bu evliliğin bitmesiyle ilgili farklı iddialar ortaya çıkmıştı. Tek celsede boşanan çiftin ayrılmasına şahin'in vücudu bozulur diye çocuk istememesinin nedeni. Sadece ünlü insanların sadık olduğu göre Şahin, bebek sahibi olmak için teşkil eden hastalıklar. Şahin ve Özer, tüp bebek tedavisi için …

Devamını Oku »

Mustafa Sandal izin verince Emina bu pozları verdi

                     2017-05-22 12:26:00                                           İki çocuk annesi Emina Sandal, birbirinden seksi pozlarıyla ilgili "Eşiniz kıskanmıyor mu?" Sorusuna "Fotolar onun onayından geçmeden yayınlanmıyor" cevabının verdi. Mustafa Sandal'ın eşi, iki çocuğu annesi Emina Sandal, Balkanlar'ın ünlü mayo ve iç markası Extreme Intimo'nun ilkbahar-yaz kataloğu için birbirinden seksi pozlar verdi. "MUSTAFA ONAYLAMADAN YAYINLANMIYOR" Emina Sandal, "Eşiniz kıskanmıyor mu?" Sorusuna, "Mustafa çekilen onu …

Devamını Oku »

'Tesla'nın Elon Musk korkunç görünüyor, ancak dünyayı fethetmeyi hedeflerseniz bu şarttır'

Tesla'nın Elon Musk'u her şeyi ve daha fazlasını içeriyor. Onu sevmekten ya da nefret ederse akıllı, tahmin edilemez derecede zekice, gülünç derecede zengin, zorlu, tehlikeli biçimde meydan okuyan ve motor endüstrisinde en cesur insandır. O da biraz korkutucu görünüyor. Ve evet, bu başka bir iltifattır, çünkü böyle bir özellik, dünyayı fetheden herkes için zorunluluktur. 45 yaşındaki Musk da bunu yapıyor. …

Devamını Oku »

Bu, Tüm Olumsuz Emotunuzu Niçin Alınmalıdır? …

Belki kimse sana bunu yeterince sık söylemedi, ama üzülmek tamam. Yumruklarını sıkılaştırmak isteyen bir noktaya kadar her şeyi hissetmek haksızdır. Kızgın olmak güzel. Bu duyguları atlatmaya çalışmak için çok fazla zaman harcıyoruz; bu duyguları gerçekte hissetmek ve geçmek için zaman harcamak zorunda kalmıyoruz. Peki, onlara baskı yaparken olumsuz duygularla nasıl baş edebiliriz? Erken yaşta başlıyor. Çevremizdeki yetişkinler bize "Kızmayın" ya …

Devamını Oku »

Biz bu olaydan üç hafta önce ayrılmıştık

                     2017-05-21 10:51:00                                           Yakın zamanda evlenecekleri bekledi Murat Boz ve Aslı Enerjinin olay biçimi ayrıldı.Magazin gündemine bomba gibi düşen olay Murat Boz, Eser Yenenler'in programında bulunan Bahar ve Nihal Candan çiftiyle yakalantı. Yakışıklı şarkıcı, Antalya'da verildi konser sonrası şaşırtan bir itirafta bulundu. Ünlü şarkıcı Murat Boz, 19 Mayıs Gençlik ve Spor Bayramı'nda Antalya'nın Efsaneler Diyarı Legends'de Bir Konser …

Devamını Oku »

Bu sevimli, minik süpürgelerin bir LIDAR sensörünü temizlemesini izle

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Bu küçük silecekleri, kuş güruhunu temizlemek için bir Waymo LIDAR sensörünün etrafında dönerken seyretmekten garip bir şey. Evet, görünen, GIF'in bir zaman zarfında bit olduğu, ancak kimin umrunda? Kir, pislik, kuş pislikleri, kar ve buz birikip sensörler ile etkileşime girebilir; bu da, bu tür sensörleri kullanan özerk araçlarla …

Devamını Oku »

Bu 'Siyah Yaşıyor Neden' Balo Elbisesi Öyle İmp Var …

Instagram / @ _milan23_ Cesaret muazzam bir harekette, 17 yaşındaki Milan Bolden-Morris, baloya Trayvon Martin'in ölümüyle Black Lives Matter hareketini doğuran fotoğraflarıyla süslenmiş özel bir kıyafet giyerek devam etmeyi seçti. Cinayetin yaşandığı Milan yaşındaki Trayvon, yaşlı balo seyrini izlemek için yaşamadı. Fakat Michael Brown ve Tamir Rice de dahil olmak üzere polisle ilgili cinayetlerde öldürülen 15 Afrikalı Amerikalı'nın fotoğraflarını içeren …

Devamını Oku »

Bu Muhtemelen Bir Sonraki Ford Mustang Mach 1 »AutoGuide.com News

Başka bir Ford Mustang prototipi, serserinin üzerinde görüldü ve bize cevaplardan daha fazla soru bıraktı. Dikkat çekici bir şekilde, dört tekerleğin üstünde kamuflaj kapakları bulunan birkaç hafta içinde ikinci bir Mustang bu, ancak örtünün bir gözü, bu katırın karbon-seramik fren rotorlarının bir setini gizlemediğini gösteriyor gibi görünüyor. Bunun yerine, tekerlek kapakları GT350 için orijinal olarak geliştirilmiş bir dizi yüzen rotorun …

Devamını Oku »

Bu Vantilatör Kuramı, Temel Bir Tablomu Açıklayabilir …

Ofisi Herkesin yağışlı günü fav olarak -Show Ofisi Pennsylvania, Scranton'daki günlük bir kağıt şirketi hakkında yapılan "gerçek" "gerçek" belgesel hakkında olmalıdır. Dizinin en önemli çizimlerinden biri de gerçek gibi görünüyordu. Jim ve Dwight ile Pam'i gördük ve kendi sıradan çalışma hayatımızın saçmalıklarından bir istisna hatırlatıldı. 2005-2013 yılları arasında, modern Amerikan tarihindeki durgunluğun tam ortasında yayınlanan seriler ve henüz tanık olduğumuz …

Devamını Oku »

Bu sizi Forev'i aldığında üzülmesine neden oluyor …

Unsplash / Jacob Ufkes Sanki büyük değil gibi hissedebilirsiniz anlaştık mı. Bu sadece bir metindir. Ekrandaki kelimeler. Mesajını cevaplamak için yarım gün sürerse, neyin önemli? Tamamıyla görmezden gelseniz bile, kimin umrunda? Bu küçük bir şey. Onun hakkında delirmeye hakkı olmayan bir şey. Fakat o metinde deli değil. Pek sayılmaz. Neyin temsil ettiği konusunda çok kızdır. Metnine cevap vermediğinizde, önceliklerinizin nerede …

Devamını Oku »

Bachelorett'in Bu Mevsiminde Erkek Sıralaması …

Artık o zamanlar. Parantezler oluşturuluyor. Şarap toplu olarak sipariş ediliyor. Papa Bear Chris Harrison bir yerde nemlendirici. Bu Pazartesi günü, Bachelorette'imize, muhteşem, sıcak, akıllı Rachel'a yolculuk başlar ve dürüstçe? Bachelor Nation'ın Rachel'ın hakettiği gibi yüksek kalitede bir adamı gerçekten sağlayıp sağlayamayacağına dair düşüncelerim var. Chris Harrison'u içeren bu garip (ancak komik türde) canlı Facebook videosunda umut verici oyuncularımız ilan edildi. …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

Bu Ürpertici Metin Sohbeti Tehlike Gösteriyor …

Eğer (Typeof (jQuery) == "işlev") {(fonksiyonu ($) {$ fn.fitVids = fonksiyonu () {}}.) (jQuery)}; jwplayer ( 'jwplayer_7nNXwmvY_ydB0cBQo_div'). setup ( { "Oynatma": "http: / / content.jwplatform.com / jw6 /7nNXwmvY.xml"} ); Ne yazık ki, bir kere fotoğraflarınızı oraya koyduktan sonra onları geri getiremezsiniz. Beğendiğiniz kişiye gönderdiğiniz şirin resimler, çevrimiçi olarak yayınlanan tüm arkadaşlarıyla paylaşılabilmesine veya daha kötü olmasına neden olabilir.

Devamını Oku »

Bu yaz tatil için Türkiye'ye gidin

                     2017-05-17 12:42:00                                           İngiltere'de internetten yayın yapıyor Independent gazetesi, tatil ettiği yıl Türkiye'yi tercih edenlerin sayısıının düştüğü ancak gitmeyenlerin Ege'nin güzelliklerinden mahrum kaldığını yazdı. Bağımsız gazetesinde yayımlanan ve seyahat yazarı Emma Thomson'ın imzasını taşıyan yazıda, seyahat planı yapan İngilizlere yaz yaz tatilinde Türkiye'ye gitme çağrısı yapıldı. Thomson yazısında sayı sayısının düşmesinin nedenlerini şöyle sıralıyor: "Ülkenin imajına darbe girişimi, …

Devamını Oku »

Bu Toyota Starlet pas kovasından ralli roketine gitti

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Bu, sahip olduğum ilk Toyota Starlet değil ve bu benim son olmayacak. Nitekim, ailenin beşinci sınıfı, babamın 1990'larda inşa ettiği ve yarıştığını sayıyor. (Eşimde de uzun zamandır inşa ettiğimiz bir eşim var, ama bu başka bir hikaye.) Beni bu küçük Toyotas'a ve mitinge sokan kişi babam; Yalnızca diz …

Devamını Oku »

Hindistan'ın Nagpur'da Başlatılacak İlk Elektrikli Kabin Filosu Bu Ay

                         Ülkedeki ilk elektrikli taksi filosu 26 Mayıs 2017'den itibaren Nagpur'da açılacak. Hindistan'ın 2030'a kadar tüm elektriği vereceği taahhüdü ile bu, işlerin yolunu açması için iyi bir yoldur. Union Transport Minister Nitin Gadkari, daha önce elektrikli radyo istifalarının 24 Mayıs 2017'den itibaren başlayacağını ancak şimdi Narendra Modi hükümetinin üç yıllık tamamlanma süresine denk gelmesi için iki gün ertelendiğini söyledi. Nagpur, …

Devamını Oku »

Büyüyen küresel siber saldırı, bu nedenle 200.000 kurbana çarpıyor …

                                                                           ile vurdu.                                12 Mayıs'ta düzenlenen saldırı dalgası İngiltere'nin sağlık servisine, Rusya'nın içişleri bakanlığına ve Fransız otomobil üreticisi Renault'a ve dünyanın birçok başka kuruluşuna saldırdı      Europol, pazarın eşi benzeri görülmeyen küresel siber saldırı, birçok ülkede 200.000'den fazla kişiye isabet ettiğini bildirerek, insanların işe döndüklerinde durumun artabileceğini belirtti.                                                                                 Dünyanın en büyük bilgisayar …

Devamını Oku »

Dirt Rally bu hafta sonu ücretsiz

Bildiğiniz üzere Steam'de onun hafta sonu bir oyun indirime giriyor ve bazı oyunlar indirime girmekle kalmayıp, hafta boyunca boyunca ücretsiz olarak oynanabilir hale geliyor. Geçen hafta da Bölüm indirime girmişti ve hafta boyunca oynanabilir hale gelmişti. Dirt Rally bu hafta sonu ücretsiz! 1 Aralık 2015 tarihinde Codemasters Yarışması tarafından geliştirilen ve yine Codemasters tarafından yayınlanan Dirt Rally Steam'de hafta sonuna …

Devamını Oku »

Cam silme bu kadar kolaylaşmış .. !!

                     2017-05-13 11:22:00                                                              Bu yeni robot pencerenize yapışır ve sizin için temizler. ECOVACS ROBOTICS, WINBOT 950 – Pencere Temizleme Robotu ve zeminden pencereler geçerek ev robotizmini değiştiriyor. Tek bir dokunuşla lekesiz penceler hızlı bir şekilde sunmak için yenilik ve geliştirilmiş teknoloji standart olarak gelir. Yüksek teknolojili emme fanı ve 4 kademeli temizleme sistemi her türlü cam yüzeyini …

Devamını Oku »

Cam silme bu kadar kolaylaşmış .. !!

                     2017-05-13 11:22:00                                                              Bu yeni robot pencerenize yapışır ve sizin için temizler. ECOVACS ROBOTICS, WINBOT 950 – Pencere Temizleme Robotu ve zeminden pencereler geçerek ev robotizmini değiştiriyor. Tek bir dokunuşla lekesiz penceler hızlı bir şekilde sunmak için yenilik ve geliştirilmiş teknoloji standart olarak gelir. Yüksek teknolojili emme fanı ve 4 kademeli temizleme sistemi her türlü cam yüzeyini …

Devamını Oku »

Bu gece en sonunda Creepiest'u canlandırabilirsiniz …

Aşkın Hounds'ı Avustralya korku filmleri, korku meraklıları tarafından uzun zamandır gözden kaçırıldı. Bugün, Aşk Hounds herkese kayıp olduklarını göstermek için talep üzerine video üzerine başlıyor. Hounds of Love genç kızını kaçırıp rehin almak için evlerinde tuttuğu bir çift üzerinde yoğunlaşmış bir Tribeca Film Festivali favorisi. 2017 yılının en rahatsız edici filmlerinden biri olarak gösterildi. İşte bir arsa genel görünümü: "1980'lerin …

Devamını Oku »

Soyutlama Cinsel üreme, her kromozomun yalnızca bir kopyası ile haploid gametlerin (sperm ve yumurta) üretimini gerektirir; Döllenme sonraki nesildeki diploid kromozom içeriğini geri yükler. Genetik içeriğindeki bu azalma, iki tur kromozom ayrışmasının DNA replikasyonunun tek bir turunu izlediği, mayoz olarak adlandırılan özel bir hücre bölünmesi sırasında başarılır. İlk mayot bölünmeye hazırlanırken, homolog kromozomlar çift ve sinaps, çapraz rekombinasyon olaylarının oluşumunu teşvik eden bir bağlam yaratır. Bu geçitler, kız kardeş kromatid bağlılığı ile bağlantılı olarak, iki homolojiyi birbirine bağlar ve ilk mayoz bölünme sırasında karşı kutuplara ayrılmalarını kolaylaştırır. Mitoz benzer ikinci mayos bölünme sırasında, kız kardeş kromatidler ayrı; Sonuçta üretilen ürünler gamet haline gelen haploid hücrelerdir. In C. Elegans (ve birçoğu ökaryotların çoğunu) mayooz sırasında uygun kromozom kalıtımı için homolog eşleştirme ve rekombinasyon gereklidir; Dolayısıyla, bu olayların düzgün şekilde yürütülmesini sağlamak için mayoz olayları sıkı bir şekilde koordine edilmektedir. Bu bölümde, mayoz bölünme olaylarını gözden geçiriyoruz: homolog kromozomların eşleştirilmesi; Kromozomların mayoz döneminde geçirdiği kromozom yapısındaki değişiklikler; Mayotik rekombinasyon olayları; Homolog kromozom çiftlerinin Meizoz I'de uygun kromozom ayrımı için optimize edilmiş yapılara ayrılması; Ve mayotik bölünmeler sırasında kromozomların nihai ayrımı. Ayrıca, I. evre boyunca bu mayotik olayların koordineli yürütülmesini sağlayan düzenleyici süreçleri de gözden geçirdik.

1. Genel Açıklama Cinsel üreme, mezozun uzmanlaşmış hücre bölüşümü programı aracılığıyla diploid öncülerden haploid gametlerin üretilmesini gerektirir. Ploidy'deki bu azalma döllenmeyle ilgili olarak diploidyondaki restorasyonun sağlanması için gereklidir ve birkaç önemli olayı tamamlamayı gerektirir (). Erken evre (leptoten ve ziggoten evreleri) sırasında, her kromozom, uygun homolog eşleştirme partnerini bulmalı ve tanımalı ve buna uyumlu olmalıdır. Ziggoten safhasında, homologları bir arada …

Devamını Oku »

Endişe Trend Bu kadar Glamourizing Dur Çünkü Değil

Kalegin Michail Ben her zaman gerçeklik televizyon keyif aldık. Çoğu zaman, Beverly Hills'deki Gerçek Ev Kadınlarının hayatları hakkında, kendi hayatımdaki insanlardan çok önem veriyorum. Bununla birlikte, gerçeğe dönüşen televizyon şovlarında ciddi bir eğilim görüyorum ki, gerçek gerçekliğe sıçramaya başladı. T.V.'deki her bir toplantı ya da oturup kalpten kalp sohbetine benziyor, birisi A sözcüğünü bırakıyor. Tek kelimeyle Anksiyete demektir. Günümüzde anksiyete, …

Devamını Oku »

Bu hafta vizyona giren film: 12 Mayıs

Bu hafta vizyona giren filmler arasında aksiyondan komediye 5 yapımı sizler için seçtik. İşte bu hafta vizyona giren filmler Kral Arthur: Kılıç Efsanesi Yönetmen: Yönetmen: Guy Ritchie oyuncular: Charlie Hunnam, Astrid Bergès-Frisbey, Jude Law Tür: Fantastik Süre: 2 saat 7 dakika Kral Arthur efsanesi bu kez aksiyon filmlerinin ünlü ismi Guy Ritchie ile bir kez daha karşımızda. Arthur'un hikayesi arkasına …

Devamını Oku »

Sokağa çıktık ve sorduk: Bu telefonda çift kamera neden var?

VIA F1 mikrofonu aldık ve Casper'ı elemek ve sokağa çıktık. Akıllı telefonlar çift firma döneminin yükselişe geçtiğini, bu sistemin ne işe yaradığını sorduk ve yanıt veren kişilerin bizzat deneyimilemesin sağladık. Bu telefonda çift kamera neden var? Hatırlayacağınız üzere, Casper VIA F1 modeli, arka taraftaki çift kameralı yapısı sayesinde boka ilham yüksek fotoğraflar çekebiliyor. Peki bunu deneyimleyenlerin tepkisi ne oldu? Cevabı …

Devamını Oku »

Serenay Sarıkaya'nın bu paylaşımı olay oldu

                     2017-05-12 09:11:00                                           Son olarak 'Fi' dizisinde rol alan güzel oyuncu Serenay Sarıkaya, 'Fi' dizide 'Duru' adlı balerini oynayan Serenay Sarıkaya üç aydır bale ve jimnastik dersleri alıyordu. Kısa sürede büyük bir gelişme gösteriyor Sarıkaya, geldiğinde sonlandırıldı sosyal medya hesabından paylaştı. "Hocam benim gibi bir hiç esnekliği olmayan bir tek kısa zamanda bu hale getirdi …" notuyla birlikte …

Devamını Oku »

Bu 1.000.000 Porsche 911 – resimleri

       Ana içerik alanına atla                                Kapat                                                                                                                                                                                                                                              Kaynak

Devamını Oku »

Bu 1.000.000 Porsche 911

Porsche Zuffenhausen'deki fabrikasında inşa edilecek bir milyonuncu 911'i ortaya çıkardı; Üretim hattı. Porsche tarafından Porsche Müzesi'nde sergilenmek üzere görevlendirilen tek seferlik Porsche 911 Carrera S – şerefine bir takım özel yükseltmelere tabi tutuldu Olağanüstü kilometre taşı. Araba, kişiselleştirilmiş kişiselleştirme departmanı Porsche Exclusive tarafından rafine edildi ve birçok özel tasarım öğesi, 1963'ten itibaren ilk arabayı ima etti. İçinde, deri koltuklar orijinalinde …

Devamını Oku »

Gelişmekte olan tamamlayıcı metal oksit yarı iletken (CMOS) tabanlı, yüksek yoğunluklu mikroelektrod dizisi (HD-MEA) Cihazlar, subselüler seviyede yüksek mekansal çözünürlük ve çok sayıda okuma kanalları sağlar. Bu cihazlar, çok sayıda elektron tarafından tespit edilen her nöronla çok sayıda nöronun ekstraselüler aktivitesinin aynı anda kaydedilmesine olanak tanır. Kaydedilen sinyalleri analiz etmek için, spike olayları, "sivri uçlu sıralama" olarak adlandırılan bir süreç olan bireysel nöronlara atanmalıdır. Bir dizi kaynak sinyalinin doğrusal bir karışımı olan gözlemlenen sinyaller grubu için bağımsız bileşen (IC) Analiz (ICA) verileri körü körüne demixlemek ve bireysel kaynak sinyallerini çıkarmak için kullanılabilir. Bu teknik, nöronal kaynakları ayırmak için denetlenmeyen bir yöntemi temsil ettiği için HD-MEA kayıtlarındaki başak sıralama sorununu hafifletmek için büyük bir potansiyel sunmaktadır. Ayrılan kaynaklar veya IC'ler, daha sonra, tek nöron sinyallerinin tahminlerini oluşturur ve IC'ler üzerindeki eşik algılama, sıralı başaklanma sürelerini verir. Bununla birlikte, ekstraselüler nöronal kayıtların ICA gerekliliklerini ne derece karşıladığı bilinmemektedir. Bu yazıda, ICA'nın HD-MEA kayıtlarının sivri olarak sınıflandırılmasına uygulanabilirliğini değerlendiriyoruz. Yüksek zaman-zamanlı çözünürlükte kaydedilen hücre dışı sinir sinyallerinin analizi, kaydedilen verilerin tamamen doğrusal bir karışım olarak modellenemediğini ortaya koymaktadır. Sonuç olarak, ICA nöronal sinyalleri tamamen ayıramaz ve HD-MEA kayıtlarında başakta sıralama için tek başına bir yöntem olarak kullanılamaz. Simüle veri kümeleri kullanarak ICA'nın demixleme performansını değerlendirdik ve performansın nöronal yoğunluk ve başak amplitüdüne kuvvetle bağlı olduğunu bulduk. Ayrıca, ICA'nın en ciddi sınırlılıklarının üstesinden gelmek için postprocessing tekniklerinin nasıl kullanılabileceğini gösteriyoruz. Anahtar Kelimeler: sivri ayırma, çoklu birleştirme, çoklu elektrod. Bu çoklu boyutlu nöronal kayıtların hızlı bir şekilde şiddetlenmesini kolaylaştırmak için bu ileri işlem teknikleriyle birlikte ICA, uygulanabilir bir yöntemdir.

nevrofizyoloji araştırması sinir aktivitesinin ekstraselüler kayıtları, hücrelerarası etkileşimi incelemek ve fizyolojiyi daha iyi anlamak için desenler atmak için önemli bir araç haline gelmiştir Ve nöronal ağların bilgi işlemesi. Çok birleşimli kayıtlarda elektrotlar, çok sayıda bireysel nöronun eşzamanlı aktivitelerini izler. Analiz için, bireysel nöronların başak eğrileri daha sonra kaydedilen veriden çıkarılmalıdır; bu süreç genellikle "başak toplama" olarak adlandırılır (Lewicki, 1998). Genellikle, …

Devamını Oku »

Okulların Şampiyonları Takımları Belli Oldu! Avanos, Nevşehir'de düzenlenen ve 51 KKTC'den 121 takım, 594 sporcunun yarıştığı Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Düzenlenen ödül töreniyle sona erdi. Spor Genel Müdürlüğü Okul Sporları Şube Müdürlüğü'ne, Türkiye 2007 yılından bu yana, Satranç Federasyonu ve Türkiye İş Bankası'nın destekleyicileri ile birleştiğinde Okul Sporları Satranç Türkiye Birinciliği, 6 Mayıs 2017 tarihinde Avanos Atatürk Spor Salonu'nda gerçekleştirilecek ödül töreni ile sona erdi. 3 Mayıs 2017 akşamında final yarışmasının ödül töreni; Nevşehir Valisi İlhan Aktaş, Gençlik Spor İl Müdürü Mustafa Ünlüer, Türkiye İş Bankası Kurumsal İletişim Müdürü Suat Sözen, Türkiye Satranç Federasyonu Başkanı Gülkiz Tülay, Avanos Gençlik Hizmetleri ve Spor İlçe Müdürü Kerem Yılmaz, TSF Başkan Vekilleri Prof. Dr. Yusuf Doğruer ve Aşkın Keleş , Yönetim Kurulu Üyesi Ümit Şifaver, Nevşehir Okul Sporları Şube Müdürü Aslan Uçar, Okul Sporları Şefi Hüseyin Karatut, Türkiye İş Bankası Kurumsal İletişim Birim Müdürü Müge Nevşehirli Veziroğlu, TSF Nevşehir İl Temsilcisi Birsen Babacan Çengel, antrenörler, öğretmenler, veliler, sporcular ve çok sayıda Davetlinin katılımıyla gerçekleşti. Spor Genel Müdürlüğü'ne düzenlenen Eğitim Takvimi, Satranç Türkiye Birinciliği'ni, Türkiye İş Bankası'nın destekleyicisi ve öğrencilere verdikleri hediyelerle ilgili daha fazla bilgi almak TSF Başkanı Gülkız Tulay, okul Larda satranç sporunun daha fazla yerinde alması ve öğrencileri bu sporla buluşturmayı çok önemsedikleri açıklama bulundu. Tüylü sözleşmeyi şöyle sürdürdü: "51 ilimiz ve KKTC'den 121 takım ve 594 öğrencimiz centilmence ve dostça hamle yaptılar 7 tane tur boyunca. Öğrencilerimiz okullarını zirveye çıkarmak için yarıştılar and 경쟁in birlik ve beraberlik ile iç içe geçtiği bir final heyecanı yaşattılar bizlere. Bu yazıda, yazarların yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, yazarları, Açılış konuşmalarının ardından, 6 kategoride ilk dört dereceyi, 6 kategoride ilk dört dereceyi Elde Edilme Formu. Ders >> Küçükler Kızlar (19459006) >> Yazan: Küçükler Kızlar – – Küçükler Genel / Yıldızlar Kızlar – Yıldızlar Genel / Gençler Kızlar – Gençler Genel Küçükler Kızlar

Özel Kocatürk Ortaokulu, Manisa Kılıçarslan Ortaokulu, Samsun Çerkezköy Tepe Ortaokulu, Tekirdağ Mağaracık Ortaokulu, Hatay Küçükler Genel Özel Bursa Bahçeşe Bahçeşehir Koleji Ortaokulu, Ankara Özel Bursa Bahçeşehir Ortaokulu, Bursa ] Kaynak

Devamını Oku »

Bu şirketin tarama teknolojisi bir kaçakçının …

                                     Decision Sciences International Corp.'ın karargahında, 20 metrelik bir nakliye konteyneri araba yıkama boyutlu bir tarayıcının altında oturuyor.                                                                                 Yaklaşık bir dakika sonra, konteynırın içeriklerindeki görüntüler yakındaki bir TV ekranında ortaya çıkar ve nesnelerin doğal olarak oluşan atom altı parçacıklarıyla nasıl etkileşime girdiğine bağlı olarak renklerle kodlanmış bir kimliği ile tamamlanır. Bu güzel bir resim değil. İçinde mühimmat, …

Devamını Oku »

Bu sefer Snapchat kopyaladı! – ShiftDelete.Net

Son dönemde aynı popülerleşen Snapchat uzun zamandır Instagram'ın kendisinden kopyalandı özellikleri ile gündemdeydi. Sürekli Instagram'ın özelliklerini kopyalamasını eleştiren Snapchat bu sefer en büyük rekonstrüksiyonun bir özelliği kopyalanmış. Bugün Snapchat uygulamalı radikal sayılabilecek birkaç yeniliği duyurdu. Kolay bir şekilde fotoğraflanmaz düzenleme yapabileceğiniz "Sihirli Silgi" "Sonsuz Snap" ve emoji çizme özellik bunlardan sadece sadeceı birkaçı. Sihirli Silgi İkili Fotoğraflarınızda küçük düzeltmeler yapışabilir …

Devamını Oku »

Bu hafta cikacak oyunlar 8 14 Mayıs 2017

Her hafta, oyununda dünyaya yeni girenlerin günümüzde yapılıyorlar katılıyor. Ancak bu oyunları kimi zaman herkes tarafından oynanmıyor ve beğenilmiyor. Sonuçta herkesin kendine göre bir zevki, bir tarzı var. Ancak bir şans hak ediyor. Bu hafta çıkacak oyunlar PC için SDN takipçileri, PlayStation, Xbox Bir ve Nintendo Anahtarı platformları için piyasaya sürülecek olan oyunları derledik. Bakalım bu hafta oyun dünyasında hangi …

Devamını Oku »

Bilim, bu tür kişi Çıplak W'yi asıyor diyor …

Tanrı ve Adam Harika haberler, herkes: asmak isterseniz Evde çıplak olarak, akıllı olduğunuz için olabilir. Tamam, belki de bundan biraz daha karmaşıktır. Günü geçirmenin en sevdiğiniz yolu pantolon pantolonları olduğu için herkese bir dahi olduğunu söyleyerek dolaşmadan önce Büyük Beş kişilik ölçeğini kullanan çalışmaya bir göz atmanız gerekiyor. Daha önce Big Five'ı hiç duymadıysanız, o kişinin kişiliğini beş kategoriye ayıran …

Devamını Oku »

Bu senden izin veriyor

İşte ben ayrıldığınızı kabul etmek benim. Yapmam gereken başka bir argüman bulunmadığına, benim açıma kapılmayacağına, fikrini değiştirip kalabilmen için bahse girebileceğim herhangi bir savunma veya pazarlık olmadığına benim onayım var. Bu, çöküşümün hafifçe istifası. Bu, iki vatandaş arasındaki çatlağın vadiye dönüştüğü ve bizi sarmış durumda. Bu benim köprü kuramadığım herkesi kabul etti. Sana ya da ilk anın ayrılacağımızı hissettiğim ilk …

Devamını Oku »

Bu 2,000 HP Toyota, Dünyanın En Hızlı Su Vitesidir »AutoGuide.com News

Toyota Land Cruiser şimdi "Dünyanın En Hızlı SUV" unvanını alıyor. SEMA projeleri kesinlikle gösteri arabaları olmakla ün yapıyor ancak Toyota, 2016 SEMA Show'da yer alan ağır modifiye Land Cruiser'ın sadece bir römorka ait olmadığını kanıtlamak istiyor. Özel 2.000 beygir gücü Toyota Land Cruiser, geçen sene Las Vegas'ta şaşırtıcı bir başlangıç ​​yaptı ancak şüpheciler bunu bir miktar boş söz olarak reddetti. …

Devamını Oku »

Merak Rover'ın matkabı bükülüyor, bu yüzden biz …

                                  Curiosity Rover'ın sondajı zor durumda.                  NASA, cihazın "rover'ın sondajını hareket ettiren bir motorla ilgili bir sorun nedeniyle" geç 2016'da "ara ara" olduğunu açıkladı.                  Şimdi, uzay ajansı işleri halletmeye çalışırken, gezici aracın kepçe kütlesi üzerine yoğunlaştığını öğrendik.                 Meraklıs müdür yardımcısı proje müdürü Steven Lee Perşembe günü yaptığı açıklamada "Bazı durumlarda titreşimin yem etkinliğini değiştirdiği gözlendi, bu nedenle …

Devamını Oku »

Üç bilgisayar bilimcisi, matematikçileri onlarca yıldır uğraştıran bir bilmece olarak bildiğimiz, Boolean Pisagor üçleme sorusunun cevabını içeren ve bir süper bilgisayar kullanır 200 terabaytlık bir dosya oluşturdu. Bu en büyük matematik ispata denk geliyor. Süper bilgisayar problemi 2 günde çözdü ve 200 terabayt yer tuttu. Yanlış duymadınız, 200 terabayt. Matematikçileri onlarca yıldır uğraştıran bilgisayar destekli çözümün tuttuğu miktarları miktar. Boolean Pisagor üçleme problemi bu bilgisayarla çözüldü. Birinci okunmamış Mesaja git Bu yazıyı sadece içeriğine tıkla. Bilgisayar destekli matematik ispatları konusunda kırılan 200 terabaytlık dosya rekorunun önceki sahibi sadece 13 gigabayt yer tutmalarıdu. İspatın arkında problem Kaliforniya Üniversitesi, San Diego'da matematikçi olarak çalışan ve bundan önceki sahibi olan Ronald Graham, problemlerin çözümünde bilgisayarların sıkça insanlara yardım ettiğini söylüyor. Hatta problemi çözebilen herkese 100 ABD doları teklif etmiş. Daha önce bahsedildiği gibi, Boolean Pisagor üçlemesi olarak bilinen matematik sorusunun çözümü 200 terabaytlık bir yer kaplıyor. Onun bir pozitif tamsayı kırmızı ya da mavi renkle işaretleniyor ve Pisagor Üçlüsü olarak bilinen a, b ve c tamsayılarının bir kombinasyonunu oluşturuyor. Böylelikle 2 + b 2 = c 2 eşitliğinde üç tamsayının hiç biri aynı renkte olmuyor. Bilgisayar çalışma zamanı ] Farklı kombinasyonlarda, çoklu yöntemlerin hepsi, hepsi birden çok yöntem varsa da, bilim insanları. Kendi avantajları için kullanmış ve bilgisayarın yapımında kontrollerin sayısını düşürmüş. İki Gün ve 800 Adet paralel olarak işlem gören, Teksas Üniversitesi'ndeki Stampede süper bilgisayararı 200 terabaytlık veriyi oluşturdu. Meşhur Boolean üçleme problemini çözmüşse de, rekor kıran dosyada hâlâ neden renk şemasının olasılığı hakkında bir şey açıklama bulunmuyor. İspata göre tamsayıları çok şekilde renklendirmek mümkün , Sadece sadece 7.824 sayısına kadar olabileceği belirtiliyor. Bundan sonra renklendirme mümkün olmuyor. Neden 7.825'te bir kesim noktası var? Kaynak: futurism.com

Araştırma ekibinin bulguları Kaynak

Devamını Oku »

Bu, Bir Sanat Öğrencisinin Yaşamının Çok Vedat Olan Nedenidir?

unsplash.com Uyanır ve yüzünüzü soyarsınız Yastık ve gözlerinizi ovun. Lanet olsun ve yüzünüzü tekrar yastığa koyarak ertelenirsiniz çünkü hiç uygun bir gece uykusunu almayacaksınız. Dün gece çok geç, okulla hiçbir ilgisi olmayan bir eser üzerinde çalışıyordun. Nihayet kalkın ve tuvalete gidin ve yüzünüze bir göz atın, dün gece yapılan çalışmalardan gelen bir çizgi fark edip, erken bir kırışık gibi davranın, …

Devamını Oku »

PI3Kδ ve primer immün yetmezlikler – Avrupa PMC … Özet Birincil immün yetmezlikler, immün sistemin kalıtsal bozuklukları, Genellikle lenfosit gelişimi için gerekli genlerin mutasyonu ve Aktivasyon. Son zamanlarda, çeşitli çalışmalar, fonksiyon kazanım mutasyonları tespit etmiştir Fosfoinositid 3-kinaz (PI3K) genlerinde PIK3CD (ki P1106'yı kodlar) ve PIK3R1 (p85α'yı kodlar) Aktif olarak adlandırılan kombine bir immün yetmezlik sendromuna neden olan PI3Kδ sendromu (APDS) veya p1108-aktive edici mutasyona neden olan Yaşlı T hücreleri, lenfadenopati ve immün yetmezlik (PASLI). Paradoksal, Hem fonksiyon kaybı hem de bu genleri etkileyen fonksiyon kazanım mutasyonları Farklı mekanizmalar yoluyla olsa da, immünosüpresyona neden olur. Burada, Adaptif bağışıklıkta PI3Kδ'nın rolleri, klinik bulguları tanımlar Ve APDS'deki hastalık mekanizmalarını incelemek ve PI3Kδ'ya yeni bakış açıları vurgulamak Bu hastalardan elde edilen bulguların yanı sıra Klinik tedavi. Giriş Aktif PI3Kδ sendromu (APDS; PASLI olarak da bilinir), Içinde yeni tanımlanmış primer immün yetmezlik (PID) sendromlarının giderek artan sayısı Nedensel mutasyonlar, yeni nesil dizileme ile tanımlanmıştır. The APDS'nin klinik bulguları çeşitlidir ve heterojendir (Kutu 1), ancak hastaların çoğunluğu Tekrarlayan solunum yolu enfeksiyonlarıyla, sıklıkla hava yolu skarlasması ile birlikte görülen (Bronşektazi) ve kulak ve sinüs hasarı, ki bu antikorun (B hücresi) eksiklik. Herpes aile virüsleri ile şiddetli, tekrarlayan veya devam eden enfeksiyonlar, Kusurlu T hücre fonksiyonunu gösteren, bu durumda da sık görülür ve Bazı etkilenen bireylerde erken ölüm neden olur. Birçok hasta benign gelişir Hepatosplenomegali ile sıklıkla ilişkili olan lenfadenopati ve APDS ile ilişkili B hücre lenfoma riski önemli ölçüde artmıştır (Kutu 1). Viral duyarlılık artışı Enfeksiyon ve hafıza T hücrelerinin zayıf geri çağırma tepkileri APDS'yi ayırt eder İzole edilmiş hipogammaglobulinemi 1 – 4 dolayısıyla APDS kombine edilmiş olarak düşünülmelidir Bağışıklık yetersizliği 5 . 100'den fazla hasta APDS ile bugüne kadar bildirilmiştir, ancak kesin insidans henüz bulunmamaktadır. . Kutu 1 APDS'nin klinik özellikleri 6 APDS'li hastalar hem bağışıklık yetersizliği hem de bağışıklık özellikleri sergilerler Disregülasyon: Nükseden akciğer, kulak ve sinüs enfeksiyonları (kapsüllenmiş bakterilerle Olarak Haemophilus influenzae ve Streptokoklar Etkili olabilmek için opsonizasyona ihtiyaç duyan pneumoniae Öldürme) yakın evrenseldir ve yüksek bir insidans ile ilişkilidir Işitme bozukluğu ve bronşektaziyi içeren organ hasarı Havayolu korkutması) 1 4 . Herpes aile virüsü ile şiddetli, tekrarlayan veya kalıcı enfeksiyonlar Yaygın, özellikle kronik EBV veya CMV viremi ve HSV ve VZV Enfeksiyonlar 1 3 – 7 . Bazı solunum yolu virüslerinin sık izolatları 1 Fırsatçı enfeksiyonlar seyrek olmakla birlikte, birkaç hastada (örn., Adenovirüs ve echovirus) Tekrarlayan viral siğiller veya molluskum kontagiosum deneyimli Enfeksiyonlar 49 . Apse oluşumu, lenfadenit ve selülit insidansında artış Gram pozitif bakterilerle (çoğunlukla Staphylococcus Aureus ) ve mikobakterilerin hatalı öldürülmesi APDS'li bir hastadan izole edilen makrofajlar, Doğal bağışıklık 64 . Benign lenfoproliferasyon (lenfadenopati, hepatosplenomegali ve fokal Nodüler lenfoid hiperplazi) tüm hastalarda ortak özelliktir Bugüne kadar incelenmiş olan APDS Etkilenmiş hastalardaki lenfoid dokunun histopatolojik analizi Manto zayıflaması ile atipik folliküler hiperplaziyi gösterir APDS1'deki bölgeler ve APDS2'deki küçük B hücreli folliküller. Germinal merkezler Her ikisinde de T hücrelerini infiltre ederek (çoğunlukla PD1 pozitif) bozuldu APDS1 ve APDS2 APDS ile bağlantılı yüksek oranda bir lenfoma var ve bunları kapsıyor Geniş bir histopatolojik şekil yelpazesi 1 2 7 67 İmmün sitopenias (trombositopeni, hemolitik anemi ve nötropeni) Ve otoimmün benzeri katı organ koşulları (juvenil artrit, Glomerulonefrit, tiroidit ve sklerozan kolanjit) de var 7 66 ,% 34'lük bir frekansta APDS1'li 53 hastanın kohortu 7 Hafif gelişimsel gecikmeler hem APDS1 hem de APDS2'de görüldü. APDS2 olan 36 hastadan oluşan bir kohortta 7 Büyüme (Büyüme) Retardasyon APDS2 olan hastalarda yaygındır 6 73 74 ancak görünmemektedir Özelliği, APDS1'in heterozigot SHORT sendromlu (kısa boylu, boy kısalığı, Eklemlerin hiperekstansibilitesi, fıtı, oküler depresyon, Rieger anomali Ve diş çıkarma gecikmesi) 88 91 APDS heterozigot kazançtan kaynaklanır (GOF) mutasyonları Hiperaktivasyona neden olan PIK3CD veya PIK3R1 Sırasıyla protein ürünleri p1108 veya p85a, 1 – 4 . P85a düzenleyici altbirim ve p110δ katalitik altbirimi Birlikte heterodimerik lipid kinazı PI3Kδ oluşturur; B hücresi reseptörü de dahil olmak üzere bağışıklık sistemindeki hücrelerdeki çoklu reseptörler (BCR) ve T hücre reseptörü (TCR) yanı sıra sitokin ve kostimülatör Reseptörler. Bu aynı altbirimlerde homozigot işlev kaybı (LOF) mutasyonları neden olur İnsanlarda immün yetmezlikten oluşan belirgin ve daha seyrek bir şekil 8 – 10 ve bu belirgin ikiye bölünme, birlikte Etkilenen hasta gruplarının klinik özellikleri, anlayışımızı bildirmiştir. Bu derlemede, PI3Kδ hakkında bilineni özetleyeceğiz, odaklanacağız. Uyarlamalı bağışıklık tepkileri düzenlemesi üzerine. Bu bilginin büyük kısmı Gen hedefli fareler kullanarak yapılan çalışmalar. Ardından, şüphelenilen iki olguyu özetleyeceğiz Insanlarda PI3Kδ eksikliği bildirildi, daha önce tanımlanmadan önce APDS'nin klinik ve immünolojik belirtilerini ayrıntılı olarak açıklar. Sınıf I PI3K'lara genel bakış Sınıf IA PI3K'ler, Pı10a, pı10p veya pı108 katalitik altbirimi oluşturucu olarak Bir p85 düzenleyici altbirimi ile ilişkilidir; IB PI3K sınıfı, Bir p101 veya p84 düzenleyici alt-birim ile etkileşen p110γ katalitik altbirimi (). Pı10a ve pı10p Büyük ölçüde ifade edilirken, p110γ ve pl108 baskın olarak Lökositler tarafından ifade edilir. Fazlalık için önemli bir potansiyel olsa da Katalitik altbirimler arasında, her bireysel p110 izoformu için benzersiz roller var Farklı ifade şekillerini yansıtan ve aynı zamanda Kendi reseptörleri tarafından angaje edilirler 8 , 11 . Örneğin, p110a, Insülin benzeri reseptörler tarafından aktive edilir ve büyümeyi, metabolizmayı ve Angiogenesis 11 oysa p110β Metabolik sinyallemeye katkıda bulunur ve Fare nötrofilleri bağışıklık komplekslerine 12 , 13 . P110γ, Miyeloid hücreler ve kemotaktik tepkilere katkıda bulunur, ayrıca reaktif oksijen Nötrofillerdeki tür (ROS) üretimi 14 . P110δ ile birlikte, p110γ, pre-T hücresi sırasında da önemlidir Timusta gelişim 15 . P1106, Bu derlemenin odak noktası olan hemodiyaliz, hem lenfositlerde hem de Miyeloid hücrelerdir ve antijen reseptörleri, ko-uyarıcı reseptörler, Sitokin reseptörleri ve büyüme faktörü reseptörleri 8 PI3K altbirimleri ve APDS mutasyonları Sınıf Sınıf I PI3K'ler, PtdIns (4,5) P 2'nin fosforilasyonunu katalize eder. ila Bir membran görevi gören PtdIns (3,4,5) P 3 (PIP 3 ) üretirler Pleckstrin homolojisi (PH) alanları olan hücre sinyal proteinleri için ip. Göze çarpan Bunların arasında PDK1 ve AKT, bunlar gibi substratları fosforile edecek şekilde hareket ederler FOXO transkripsiyon faktörleri (inaktive hale gelir) ve regülatörleri MTOR kompleksi 1 (aktive olur). Bu nedenle, sınıf I PI3K'lerin aktivasyonu FOXO transkripsiyon faktörlerinin inaktivasyonu ile sonuçlanır. Lenfositlerde BTK ve İTK PIP 3 – Aktifleştirmeye katkıda bulunan tepki veren tirozin kinazlardır. Fosfolipaz C-gamma (PLCγ) ve diğer indirgeyici sinyal proteinleri (,). Lipid fosfataz PTEN, PIP 3 'i PtdIns'e (4,5) P 2 8'e dönüştürür. Sınıf IA PI3K düzenleyici altbirimler üç farklı gen tarafından kodlanır ( PIK3R1 PIK3R2 ve PIK3R3 ) (). PIK3R1 P85α, p55α ve p50α'yı kodlar (her biri bir alternatiften Transkripsiyon başlangıç ​​sitesi), PIK3R2 p85β'yı kodlar ve PIK3R3 p55γ 16 kodlar. Bu düzenleyici altbirimlerin SH2 etki alanları vardır ve bu bağlar Hücre yüzeyi reseptörlerinin fosforile YXXM motifleri ve membrana bağlı Proteinler. P85α, p55α, p50a ve p85β her yerde bulunur Ifade ederken, p55γ esas olarak beyinde ve testislerde 16 ifade edilir. Sınıf IA PI3K düzenleyici herhangi biri Altbirimler belirgin olmadan p110α, p110β ve p1108'e bağlanabilir seçicilik. PI3Kδ'nın, en iyisi, p85α'yı P1108, ancak p110δ ile diğer sınıf IA PI3K düzenleyici altbirimler de mümkündür. Ayrıca şunu da bilmek önemlidir: P85α birçok p110δ'dan bağımsız işlevlere sahiptir, çünkü aynı zamanda bağlayabilir P110α ve p110β 16 . Sınıf IA PI3K düzenleyici altbirimleri p110 katalitik altbirimlerini etkiler Üç şekilde 17 : proteolitik P110'un bozunması; P110 katalitik aktivitesini inhibe eder; Ve p110'u işe alıyorlar Altbiriminden plazma zarındaki tirozin fosforile proteinlere dönüştürülür. P85α'nın SH2 domenleri fosfotirozinler tarafından tutulduktan sonra, P110 ile inhibitör kontaklar hafifletilir 17 . Böylece, PIK3R1 genindeki mutasyonlar, PI3K aktivitesini, P110δ'nın parçalanmasına veya işe alımının azaltılmasına izin vererek Reseptörler ( PIK3R1 null veya LOF mutasyonları durumunda) veya tarafından P85α'nın p1108 üzerindeki inhibe edici etkisinin serbest bırakılması (durumda PIK3R1 GOF mutasyonları). Düzenleyici alt birimlere ek olarak, P110α ve p110δ RAS'ı bağlayabilir ve p110β, RAC'yi veya CDC42'yi bağlar. Bu küçük GTPazlar p110 altbiriminin membrana bağlanmasına yardımcı olur 17 18 . PI3Kδ ve bağışıklık: fareden alınan dersler APDS tanımından önce, rolü hakkındaki bilgilerin çoğunun Bağışıklık ve enfeksiyonda PI3Kδ, genetik ve farmakolojik Fare modelleri kullanılarak yapılan çalışmalar. APDS'ye neden olan GOF mutasyonları geçtiğimiz günlerde Artmış bazal ve uyarılmış PIP 3 seviyelerine ve PIP 3 – hastadan türeyen bağımlı sinyal iletim dizileri Lenfositler 1 – 4 ve bu hastaların incelenmesi bize yeni bilgiler verebilir PI3Kδ aktivitesinin dengesi bağışıklık hücresi işlevlerini nasıl düzenler. İşte, biz Farelerdeki bu çalışmaların bize ne öğrettiğini özetleyin, önce Mutasyon geçiren insan hastaların immünolojik fenotipleri PIK3R1 Veya PIK3CD

Fare B hücrelerinde PI3Kδ fonksiyon kaybı Farelerde, kemik iliğinde erken B hücresi gelişimi sadece hafiftir 19 – 23 p85α veya p1108'in kaybından etkilenir. Buna karşın p110α ve p110δ kombine kaybı, Pro-B hücresi safhasında 24 yakınlarında yakın komple geliştirme bloğu . Bununla birlikte, p85α veya p1108'den yoksun fareler Altbirimlerin foliküler B hücreleri daha az, marjinal bölge (MZ) B hücrelerinden yoksun ve …

Devamını Oku »

Öğrenciler De 'Tükenir' Büşra ATILGAN Tükenmişlik sendromu kavramı, birkaç yıl önce hayatımıza girdi ancak hızla yayıldı. Kişinin kendini 'tüketmesi' anlamına gelen bu kavramı, günlük tempo, yaşanılan olaylar da tetikliyor. Üstelik yetişkin insanlar kadar yoğun ve vaktinde koşturmacası. Peki, sendromla nasıl başlıyor? Öğrenciler yapabilir mi? Yanıtlar, Türk Psikologlar Derneği İstanbul Şube Başkan Yardımcısı Klinik Psikolog Dr. Serap Altekin'den. Günlük stres, iş temposu, okul ve Öğrencilik hayatı derken, kendimizi hep duygusal, hem fiziksel hem de zihinsel açıdan çok fazla yoruyoruz. Öğrenciler; Ders yoğunluğu, sınav stresi, arkadaşları veren rendin a sıra bir de aile basketyle baş etmeye çalışıyor. Bu sıkıntılar kişiyi tükenmişlik sendromuna sürükleyebiliyor. Serap Altekin şöyle diyor: Tükenmişlik sendromu, kişiyi bedensel ve ruhsal açılardan zorlayan hayat olaylarına veya yaşam koşullarına uzun süre maruz kalınması sonucu ortaya çıkan ruhsal, zihinsel, fiziksel bir yıpranma ve Güçsüzleştirme hali. Kişinin uzun süre yorucu ve yıpratıcı bir tempoyla çalışması, yeterince dinlenmeden efor sarf etmesi, rekabetçi bir ortamda performans ve başarı odaklı taleples meşgul olması, bir süre sonra çöküntü ve tükenmişlik getiriyor. Gücümüzün, enerjimizin ve motivasyonumuzun değişkenlikler sergilemesi son derece doğal. Tükenmişlik sendromu tedbiri alabilir bir durum; Onu, altyapısını, nedenlerini ve temel unsurlarını anlamak, önlemek noktasında yardımcı oluyor. Profesyonel atletler, "Susamadan su içmek gerekir. BAŞKALARIYLA KIYASLAMAYIN YGS, LYS, TEOG, vizeler, finaller ve bunlara günlük dersler de eklenince öğrenciler çok yoğun bir Çalışma temposundan geçiyor. Bütün bunlar, riske girmeden tükenmek sendromu. Çünkü öğrenciler bu süreçlerde, bir rekabet ortamında başarı, puan, performans ve sıralama odaklı yüksek standartlara karşı karşıya kalıyor. Aile ve toplum beklentileri ile daha da artıyor ve yıpratıcılık hızlanıyor. Bir kez daha sağlıklı bir davranış. Herkesin performansını ve başarısını kendi koşullarını ölçmek, kendisini mümkün olduğunca başkalarıyla kıyaslamaması koruyucu oluyor. Öğrencinin, "Geçen seneye göre bu yıl neler öğrendim, geçen aya kıyasla bu ay ne kadar hızlandım, düne göre bugün hangi konularda daha iyiyim?" Gibi gelişimini kendi içerisinde daha fazla sağlıklı. Bir de en önemlisi, almadı ya da sınav derecesiyle kendini özdeşleştirmemek. Değil, puan, sıralama; Ibaret sadece bir kere yapmak. ACABA TÜKENİYOR MÜYÜK? Tükenmişliğe neden emin olmalı, henüz erişmek için gibi insanlara yet gibi davranıyorlar mı? Öğrencilerde de benzer. Ama ders programı, ek derslerin, etüt saatlerinin yoğunluğu, daha fazla yükseğe çıkarılmış hedef ve beklentiler, rekabet ortamı, burs gibi birçok etken öğrencilerin üzerindeki baskıyı ve yıpranma payını da maksimuma çıkarıyor. Buna monotonluk, yalnızlık ve sosyal desteğin yetersizliği gibi yeni bir boyut eklenince risk artıyor. Yeterince mola vermemek, dinlenmemek, sağlıklı ve dengeli beslenmemek de riski arttırmak da önemli bir faktör. Kısa vadede yaşanan performans, başarı, puan, derece, prestij, statü, takdir ve onay gibi tatmin kaynakları ve bu anlam anlamı yitirmiş oluyor. [19459107] FİZİKSEL BELİRTİLER: Enerjisizlik, kronik yorgunluk, güçsüzlük, baş, mide, bel ve felsefe ZİHİNSEL BELİRTİLER: Umutsuzluk, ZİHİNSEL BELİRTİLER: Umutsuzluk, DUYGUSAL BELİRTİLER: DUYGUSAL BELİRTİLER: Bu yazı, ] Ağırlıklı olarak stres ve depresyon belirtilerine benzerlik gösteriyor. [19459106] Kimler, risk altında mı? Klinik Psikolog Dr. Serap Altekin'e göre, durum, olay ve iş koşullarının özellikleri kadar, insanın kendi kişiliğiyle ilgili unsurlar da tükenmişlik sendromunun altyapısını oluşturuyor. Dr. Altekin, daha fazla risk taşıyan kişileri şöyle sıralıyor: * Yüksek idealler taşıyanlar, * Mükemmeliyetçiler, * 'Hayır' demekte zorlananlar, * Yüksek sorumluluk ve çarpma iyi görev bilincindekiler, * Diğer insanların beklentilerini ve * Kendini suçlamaya ve yargılamaya eğilimliler, * Kolayca yetersizlik duygusuna kapılabilenler, * Sosyal destek sistemleri az olanlar.

SENDROMUNUZLA NASIL BAŞ EDEBİLİRSİNİZ ] – Yemek ve uyku düzenleyin dikkat edin. – Mizaha vakit ayırın. – Daha fazla hareket edin, spor yapın. – Hobi edinin. – İnsan teması her zaman şifa ve güç kaynağıdır, arkadaş ve dostlarınızla buluşun, konuşun, paylaşın. – Sadece koşullar elveriyorsa yaratıcılık ve esnekliğe izin verin. – İhtiyaç duyduğunuzda yardım ve destek istemekten çekinmeyin. – Koşullarınız …

Devamını Oku »

Homosistein, fizyolojik olarak tüm hücrelerde üretilir ve sağlıklı bireylerin plazmasında bulunur (plazma Homosistein, [HCy]: 3-10uM). Seyrek görülen genetik mutasyonlar ( CBS, MTHFR ) ciddi hiperhomosisteinemiye ([HCy]: 100-200μM) neden olurken, hafif-orta şiddetli hiperhomosisteinemi ([HCy]: 10-100μM) yaşlı insanlarda yaygın olarak görülür ve Inme ve kognitif bozukluk için bağımsız risk faktörü. B vitamini takviyesi (B6, B12 ve folat), homosistein düşürücü etkinliği iyi onaylanmış olduğundan, kognitif bozukluk ve bunamaya (VCID) vasküler katkılarda kolaylıkla modifiye edilebilen bir risk faktörü olabilir. Burada biz VCID ile ilgili HCy'nin biyokimyasal ve hücresel etkilerini gözden geçirin. HCy'nin nöronal eylemleri, klinik olarak ilgili aralığın üstündeki konsantrasyonlarda idi. HCy <100 μM'nin etkileri öncelikle miyosit proliferasyonu, damar duvarı fibrozu, bozulmuş nitrik oksit sinyali, süperoksit oluşumu ve koagülan pro koagülasyon eylemleri gibi vasküler olmuştur. VCID ile ilişkili HCY'yi düşüren klinik araştırmalar tartışıldı. Kapsamlı klinik ve preklinik veriler VCID için bir arabulucu olarak Hcy'yi desteklemektedir. Bizim görüşümüze göre, önceki patikalıklardan ve son deneysel çalışmalardan alınan dersleri içeren, kombine B-vitamin takviyesinin diğer yolları çağrılır. Tedavi etkisinin olasılığını en üst düzeye çıkarmak için gelecekteki bir deneme şunları yapmalıdır: yüksek dozda bir kombinasyon takviyesi (B6, B12 ve folat) sağlayın; Risk altındaki yaş aralığını hedefleyin; Düşük başlangıç ​​B-vitamin statüsüne sahip kohortlar. 1. Giriş 1.1 Bilişsel bozukluk ve bunama hastalığına (VCID) homosistein ve vasküler katkılar Beyin damar lezyonları, vasküler demans, Alzheimer hastalığını şiddetlendiren vasküler faktörler şeklinde hastalığa yakalanmaya katkıda bulunur ) Ve demans için tanı ölçütlerinin karşılanmadığı diğer kognitif bozukluk durumlarını [81,87] içermektedir. Demansa bağlı hastalıkların bu önemli yükü bilişsel bozukluk ve demans için vasküler katkılar kavramı (VCID) kapsamındadır [35,87,107]. Homosistein (HCy), serebral küçük damar hastalığı (SVD) olarak adlandırılan yaygın bir beyin vasküler patolojisi olarak düşünülmektedir (19459159). Homosistein (HCy), tiol içeren gerekli olmayan bir amino asittir () Normal folat ve metionin metabolizmasının bir ürünü olarak tüm hücrelerde üretilir. Yüksek plazma homosisteine, hiperhomosisteinemi (HHCy) adı verilir. HHCy inme [44,48,61,97,98] ve bilişsel bozukluk [101,105] için sağlam ve bağımsız bir risk faktörüdür ve patolojik olarak teyit edilmiş AD [16] ile ilişkilidir. HHCy, artmış hippokampal atrofi oranı [16] ile ilişkilidir ve AD hastalarında kognitif düşüşü hızlandırmıştır [88] ve şimdi AD için bir risk faktörü olarak kabul edilmektedir [6]. Plazma HCy konsantrasyonu kesitsel araştırmalarda hipokampal atrofi, beyaz cevher lezyonları ve lakünar infarktlarla güçlü bir şekilde ilişkilidir [32,61,117,123]. Hipokampal atrofi ile olan ilişki, amiloid patolojiden bağımsız olarak ortaya çıkmaktadır [14]. Beyaz cevher lezyonları vasküler hasarı yansıtır [92] ve bu nedenle beyaz cevher değişikliklerinin HHCy [47,49,64,94] ve düşük vitamin B 12 seviyeleri [21] ve düşük folat [51,100] ile ilişkili olduğu dikkati çekmektedir. HHCy ve serebrovasküler yaralanma arasında nedensel bir ilişkiyi destekleyen kanıtlar şunları içerir: i) Prospektif ve retrospektif klinik çalışmalarda HHCy'nin inme ile bağımsız, dereceli ilişkilendirilmesi [48,61]; Ii) Mendel randomizasyonu kullanılarak HCi metabolizmasını düzenleyen genlerin genetik bağlantı çalışmaları [9]; Iii) Deney hayvanlarında HHCy kaynaklı lezyonlar [4,68,108,111]. Uygun B vitaminleri (B 6 B 12 ve folat) ile beslenme takviyesi HHCy'yi açıkça düzeltir. Bu nedenle, HHCy, VCID'de değiştirilebilir bir risk faktörü olabilir.

Devamını Oku »

S-palmitoilasyon (S-asilasyon), sistein kalıntılarının ortaya çıkmış bir dinamik post-translasyonel modifikasyonudur. S-palmitoylation (S-acylation) Proteinler içinde. Protein S-palmitoilasyon için güncel tahliller, bir afinite kolu (asil-değişimi) ile daha sonra etiketlenebilen bir serbest sistein sülfhidril ortaya çıkarmak için S-palmitoil gruplarının in vivo etiketleme veya kimyasal bölünmesini içerir. Asil-değiştirme kimyası kullanılarak protein S-palmitoilasyon için tahliller, bu nedenle, spesifik olmayan bulgulamayı önlemek için tipik olarak N-etilmaleimid kullanan S-palmitoillenmiş sisteinlerin bloke edilmesini gerektirir. Bu, basamaklar arasındaki reaktifleri çıkar