24 Eylül 2017,Pazar
Anasayfa » Tag Archives: Boyası

Tag Archives: Boyası

Naturigin Saç Boyası

Saç boyalarının sağlığını yapma. Birçok kadında endişe yaratan konulardan bir tanesidir. Özellikle amonyaklı ve bir sürü kanserojen madde içeren saç boyaları hem sağlığın hem de saçlarının bozulmasına yol açacaktır. Bu noktaada piyasa araştırması yapıldığinde Naturigin saç boyası oldu amonyaksız ve sağlığa zararlı olur iddia eden bir banya markası görülecektir. Bu çocukların diğerlerine oranla daha sağlıklı olduğu bilinmektedir. Naturigin organik saç …

Devamını Oku »

Küllü Kumral Saç Boyası

Palette küllü kumral saç boyasında birçok markaya göre saç tonu bakımından çeşitlilik bulunmaktadır. Kül renginin saç tonlarındandır. Kumralın küllü tonları son zamanlarda çok sık kullanılmaya başlamalı. Toplayacak olursak saç boyama konusunda on rengi ve yüz tipi çok önemlidir. Bunlara dikkat edilerek en uygun saç boyası rengini seçmek sizlere kalmaktadır. Her zaman araştırarak saç boyası alır sağlığınız için. Açık Küllü Kumral …

Devamını Oku »

Amonyaksız Saç Boyası

Saçlarımın çok önemsediğimiz organlarımızdan bir tanesidir. Kadınlar, erkekler için çocuklar. Fakat bu denli önemsenen saçlar ne kadar bilinmeyen kimyasal boyalarla boyandığında yıpranmakta ve çok daha farklı görünmektedir. Masum gibi görünen saç boyaları çok büyük etkiler yaratabilmektedir. Bu yüzden evde saç boyama uygulamasıyla dikkatleştirebiliceksin. Evadan bir kuaför yardımı olamadan yapılanlama boyama işlemleri sırasında hata yapılmaması ve saçılması zarar verilmesi için satın …

Devamını Oku »

Bioblas Saç Boyası

Saç boyası seçimi dikkat isteyen bir iştir. Birçok saç dökülmesi, yıpranması ve kırılması gibi sebep olduğu bilinmektedir. Saç boyasının dikkatini tıktır. Içeriğinde ne olur bilsin ki çocukların hem tereddüt ettikleri hem de kanserojen etkileri ile vücut sağlığı bozacaktır. Bioblas saç boyası renkleri ve içerikleri ile olumlu şeyler vaat. Yeni pazaraya sürülen bu boyanın en büyük vaadi saç dökülmesi yapmadığıdır. Bioblas …

Devamını Oku »

Kot Renk Saç Boyası

Renkli saç modeliyle ilgili gençler için popüler moda akımları birleşmiştir. Genellikle geçici olanlar bu boyalar birkaç hafta içinde akarak saçın eski haline getirildiğinde. Saçın tamamına veya da uçuna uygulanabilir bu saç boyaları değişmek isteyen kişiler için kısa sürelide olsa birlike farklılık yaratacaktır. Bu boyalardan en beğenilenler jeans color adlı renkli saç boyasıdır. Pembeden maviye rengin yer aldığı bu boyalar saçlarının …

Devamını Oku »

İgora Saç Boyası

Evde saç boyamak oldukça riskli bir işlemdir. Rengin paketinin üstüne ya da olmayacağı tam anlamıyla kestirilememektedir. Boyanın başarılı bir şekilde tutması için beğenilen markanın önemi büyüktür. Bazı saç boyaları amonyaksız adı veya marketaya sürülmektedir. Bu tarz boyaların saça en az oranda zarar verdiği doğrudur. Fakat kalıcılığının nasıl olacağının garantisi yoktur. Boyama sonrası ilk haftada akan saç boyası özellikle beyazları olan …

Devamını Oku »

Geçici Saç Boyası

Kadın omuz boyar boyundur. Bazısı beyazlayınca boyama şartı. Bazısı için bazısı değişiklik için bazısı da kötü dönemlerinde stresinden arınmak. Hangi amaçla olursa olsun bütün kadınların tek bir ortak noktası vardır, güzel görünmek. Saç boyaları. Cildimiz için bu zararlıdır. Saçlarımız içinde zararlıdır. Saçlarını çok sıkı boyatan pek çok saçlarının döküldüğüne ya da yandığına şahit olmaktadır. Bu nedenle geçici sprey saç boyası …

Devamını Oku »

Saç Boyası Silici

Saç boyamak kadınların rutin işlemlerinden bir tanesidir. Genellikle yaş ilerlemesine bağlı olarak bütünleşmiş olarak beyazların kapatılmasında kullanılan saç boyaları gençler tarafından da sıklıkla kullanılır. Saçları boylece renkleri ortaya çıkarabilmektedir. Bu gibi durumlar çözümü yokmuş gibi görünse de saç boyası silici adı verilen ürünler söyle saç eski haline çevrilebilmektedir. Loreal Efassor saç boyası silici olmaktadır. Bu ürün, pratik bir şekilde istenmeyen …

Devamını Oku »

En İyi Saç Boyası Markası

Logona markalı saç boyası oldukça kalitelidir. en iyi saç boyası markası hangisi diye sorulduğu takdirde bazı markalar var ve bunlartan kalitelidir. bunlar; Topchic, Natural, Royal markaları da en iyiler arasında yer vermektedir. Ne Tür Boyalar Bulunur -Organik ve bitkisel olmak üzere kaliteli boya markaları bulunur. Kimyasal Madde İçermeyen Marka Logona Bitkisel boyalar arasında kaliteliğidir. Logona, koku, sentetik boya, konserve edici …

Devamını Oku »

Saç Boyası Numaraları ve Açıklamaları

Saç boyası satın alırken, kutuadaki o muhteşem renklere aldanmamak gerekir. Kutudaki renâdanı aldanıp boyatılan saçlardaki hayal kırıklığına neden olur. Boyattığınız saçlarınızın istediğiniz renkle aynısı aynı düşününce ziyade boya numaralarına göre tercih yapmalısınız. Peki, ne numaralı işe yarıyor, numarasını söylüyor mu? 1. Rakam: Ana Renk Ana renk boyaların sürümü ilk numaradır. Bu numara boyanın açıklık ve koyuluk derecelerini gösterir. Boya numaralarının …

Devamını Oku »

Koleston Saç Boyası Renkleri | Saçlarım ve Ben

Pek çok kadın saç boyama işlemini evde gerçekleştiriyor. Saç boyatan herkesin mutlaka bilmesi gereken şey ise boya kutusu üzerindeki mankenlerin saç renginin aldatıcı olabileceğidir. İstediğiniz saç rengini yakalayabilmeniz için saç numaralarının dilinden anlamanız gerekir. bu yazımıza göz atabilirsiniz. Yazımıza göz atabilirsiniz. Krem boya kataloğundaki Koleston saç renklerinde daha çok kızıl tonlar var, saç rengi yoğunluğunun da 8 hafta gibi bir …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Bakır Saç Boyası

Bakır saç boyası çok açık tenli olan kadınların kullandıkları renktir. Bakır rengi yıkadıkça pek fazla akma yapmaz yani kızıl rengi gibi değil. Bakır saç boyası serisi krem ​​içerikli boyalar açık tenli olan hanımlarda göz alıcı durmaktadır. Boya esnasında katalogdan 6 sayı ve 6 rakamının tonlarını takip ederek seçim yapın. Bakır rengini boyarken 6-10 rakamı almanız gerekir. Onun markası genelde bu …

Devamını Oku »

Açık Kahve Saç Boyası – sacmodelleri.com

Açık kahve saç boyası saç ve teni koyu olmayan kişiler için ideal olan renktir. Kahve saç genelde herkese yakışır. Sizlerde büyüleyici kahve tonlarını kullanarak bir kezden bir değişden uzak işlem yaptırabilirsiniz. Kahve tonları 6,52 6,55 gibi tonlardır. Özellikle bazı markalarda 6.52, 6.32, 5,35 gibi renkler bulunur. Açık kahve tonu Loreal ve Palette için son derece etkili olan tonları. Dolaysıyla ayrı …

Devamını Oku »

Saç Boyası Markaları

Saç boyatma işlemi onu kadının hayatının bir bölümünde yer alır. Değişiklik ihtiyacını bire bir karşılayan saç boyamanın yaşı gittikçe küçülmektedir. Kozmetiğe merak gittikçe arttığından saç boyası işaretleri da gittikçe çeşitlenmiştir. Adı duyulan markaların yanı sıra hiç duyulmamış markalar da karşınıza çıkabilir. Garanti verilemez. Markalar iyi bir şekilde bir garanti edinim gibi adı. Saç boyası işaretleri pek çok sitede, pek çok …

Devamını Oku »

Organik Saç Boyası

Saç boyaları herkesi beş dakika içinde edinebileceği kadar çok yerde satılmaya başlanmıştır. Büyük marketlerin yanı sıra güzellik pazarlarının tamamında yerinde saç boylarını kullanma yaşı gün geçtikçe düşmektedir. Saç boyaları günün geçittiği ucuzlarla ve kullanan kişiler saçlarının ne kadar yıpranacağını önceden öngörememektedir. Kaliteli olmayan pek çok marka saç dökülmesi, saç yanması gibi şeylere sebep olmaktadır. Saçın kırılması kestirilmeden telafi edilemeyeceği için …

Devamını Oku »

Saç Boyası Nasıl Yapılır

Saç boyalarının çeşitliliği, büyük bir güzellik mağazasında dikkatinizi çekebilir. Koskoca reyonlar bu boyalar doldurulabilir hale gelmiştir. Saç erkeklere uygun inanılmaz kolay al almıştır. Yıllar dolaşmak başka bir şey yok saç boyaları ucuzluğudur. Gittikçe büyüyen bu sektörde güzellik pazarı satılan pek çok saç boyası gittikçe ucuzlamaktadır. Saçları boysanlara aktardığın kimyasallar bir kişiyi saç boyasında soğutabilir. Saç boyamak kadınların çok sevdiklerini gelsin …

Devamını Oku »

Kızıl Saç Boyası

Kızıl saç boyası rengi kolay atabilir. Onun yıkamadan sonra renk atan kızıl zor bir renktir. Herkese de yakışmaz. Çok fazla insan tercih etmez. Bakımı zor olan renktir. Dolaysıyla kız çocuk saçlarını kullanmaya her zamana iyi markalarda sipariş veriniz. Asla bilinmedik markalardan ürün almayınız. kızıl saç boyası tonlarını da anlatacaktır. Kızıl bakırdan safra zor bir renktir. Tutturmak kolay olmaz. Kızıl saç …

Devamını Oku »

Küllü Kahve Saç Boyası

Küllü renk kahvesi ve sarı tonları için geçerlidir. Küllü kahve tonları genelde açık renk saç istemeyenlerin seçimleri için idealdir. Küllü rengi elde etmek zor değildir. Evinizde küllü tonlarında boya alırsanız kendinizde bu işi halledebilirsiniz. Köllü kahve saç boyası Loreal markasında etkileyici tona vardır. Saçta bakım ve güzelliğe önem veren kadınların seçtikleri renklerdir. Saçların rengini çıkarmak, saçlarını terketmek istiyor. Küllü kahve …

Devamını Oku »

Mor Saç Boyası

Son yıllarda rengarenk saçlardı. Bu akım renkli ombreler ile başlamıştır. Mavi, pembe gibi ombrelerin dikkat çekmesi ve bu renklerin saçta kullanılmasına bir süre alışıldıktan sonra tüm saçta kullanılmaya başlamıştır. Mor saç boyası, tonları iyileştirilmiş en rahat kullanmış ve dikkat çeken boyalar arasında yer almaktadır. Mor renk saç boyası birleşim beyaz tenli kadınların tüm saçlarından yararlanma cesaret ettiği bir boyadır. Bunun …

Devamını Oku »

Koyu Kumral Saç Boyası

Kumral saç rengi, kahverengi ve sarı için bulunan ve sıkılan tercih edilen bir ara renktir. Ara tırnakta onlara göre değişebilir. Pek çok renk ile karıştırılarak kullanılmış ve çok çok kadının saç boyası bir şekilde bir numaralı hale gelmiştir. Koyu kumral saç boyası kullananlar beyaz tenli olabilecekleri gibi buğday tenli veya esmer tenli de olabilirler. Koyu kahverengiye yakın bir renk olan …

Devamını Oku »

Boy Boyası Renkleri ve İsimleri

Saç boyaları sürekli kendini yenilemeyi başarır. Yıllar geçtikçe saç boyaları üzerine ilgi arttığından saç boyası markaları ve birlikte saç renkleri artmaktadır. Onun kadının ruhunu yansıtabilecek incelikte saç boyası renkleri düşünülmüş ve tasarlanmıştır. Elbette bu durum hala devam olacaktır. Çok fazla seçeneklilik ve kendine uygun rengi seçmekten zorlanan kadınlar, en belirgin ve en sevilen seçeneklerin bulunduğu isimler. Saç boyası renkleri boyalı …

Devamını Oku »

Sprey Saç Boyası

Saç boyamak gün geçtikçe daha normal bir şey haline gelmiştir. Bunu çok kat reklam ve elbette sosyal medya hesaplarıdır. Saç boyamak eskiden beyazlara kapatmak için yerken, oğul zamanlarda bir cümle icerirken bir işlem halini almıştır. Pek çok markaya ait saç boyaları bulunmaktadır. Çok kolay ulaşılabilen bu saç boyalarını kullanmak yaşı gittikçe düşmektedir. Bu saç boyaları erken yaşta kullanılmaya başlanmasının önüne …

Devamını Oku »

Doğal Saç Boyası

Saç boyatmak kadınların en sevdiği değişikler arasında yerinde ve gittikçe yaygınlaşmaktadır. Kadınların değişim ihtiyaçlarını olabildiğince karşı boyalı saç boyaları gittikçe popülerleşmesi ucuzlaşmalarına neden olmuştur. Ver Bu saçma saç dökülmek saç dökülmek saç dökülmek saç dökülmek saçmak saçmak saçmak saçmak saçmak saçmak saçmak saçmak saçmak saçmak saçmak saç İçerdiği kimyasal maddeler yüzünden saça verdiği zararın yaradan daha fazla olması çok çok …

Devamını Oku »

En İyi Saç Boyası

Kadının hayatının belirli bir döneminde saç renginde sıkılabilir. Kadınların çok çok çeşitli belirli bir yaştan sonra saçlarını boyatır ve saç boyatma yaşı gün geçtikçe küçülmektedir. Bunun nedeni beyazlayan saçlarının kapatılmasının yanı sıra yeni bir imaj yaratmak istenilmesindendir. İlk kez saçını boyatacak olan kadınların aklında pek çok soru bulunmaktadır. Bu soruların en büyüğü en iyi saç boyasının hangisi olduğu ile ilgilidir. …

Devamını Oku »

Beyaz Saç Boyası

Beyaz saç boyası, son yıllarda çeşitlenen saç boyaları arasında yerini almış bir saç boyasıdır. Pek çok kişi daha canlı ve daha parlak renklere yoğunlaşırken, kimilerinin dikkatini soluk ve beyaz rengi çekebilmektedir. Uygun tonuna uygun bir ten rengi bulunabilirse, mükemmel bir uyumla yakalanan serin görüntü başka renklerle elde edilemeyecek kadar güzeldir. Beyaz renk saç boyası diğer saç boyalarına göre çok daha …

Devamını Oku »

Karamel Kahve Saç Boyası

Kahverengi rengi, pek çok kadının doğal saç rengi olmazsa enca tercih edilen saç boyalarından biridir. Elbette bunun nedeni nerdeyse sayısız tonu bulunmasındandır. Doğal kahverengi saçlar yıllar yaşamaktadır. Bu nedenle çocukları boyalarla desteklenmektedir. En sevilen tonlarından bir tanesi de karamel kahvedir. Karamel kahvesi saç boyası, içerisindeki parıltılar, en çok tercih edilen saç boyaları içeriyor. Bu saç boyası en çok beğenilen boyalar …

Devamını Oku »

Açık Kumral Saç Boyası

Açık kumral saç rengi, özellikle yaz aylarında pek çok kadının dikkatini bir saç rengidir çeken. Pek çok kadının günlük hayatında kullanabildiği bu saç rengi çok fazla tercih edildiği için pek çok tonu bulunur. Açık kumral saç boyasının parlak modelleri gibi son derece popüler olan küllü modelleri de bulunmaktadır. Açık kumral saç boyası, pek çok kadının sarıdan önce seç saç rengidir. …

Devamını Oku »

Karamel Saç Boyası

Karamel saç rengi, kahverengi ve sarı renginin yerinde alması sebebiyle en çok tercih edilen renklerdir bir tanesidir. Bir geçiş formülü niteliği taşıyan bu saç rengi, onun on renginden kadının kullanabileceği tonlardamılar. Bu tonlar, kahverengiye veya sarıya yakın olmasına bağlı olarak şekillenmektedir. İçerisindeki araplara paralel olarak onları aradılar. Karamel saç boyası renk katalogu bayan tüm bu renkler bir daha ele alınmış. …

Devamını Oku »

Erkek Saç Boyası

Yıllar geçtikçe erkekler de kadınlar kadar kendilerine bakmaktadır. Vücut geliştirme, maskeler veya saç bakımı için her iki cins için ortak hale getirildi. Saç bakımı, kadınlarınki kadar ayrıntılı olmasa da, saç boyama gibi birkaç konu ortaktır. Erkekler de kadınlar gibi saçlarını boyamaktadırlar. Bir kısmı saçları beyazladığı için bunu yaparken bir kısmı tamamen değiştir. Erkek saç boyası tavsiye leri kadınlarınki kadar geniş …

Devamını Oku »

Bitkisel Saç Boyası

Saç boyamak neredeyse iki kadından birinin yaptığını bir şey haline geldi. Kadınların yanında erkeklerle ilgili ve sık bir şekilde saçlarını boyatmaya başladı. Gittikçe genişleyen bu sektör gittikçe çeşitlendi ve ucuzladı. Pek çok kişi bu ucuzluğun yanında bir şey fark etti: Boyaların saçlarına ne kadar zarar verdiğini bildirdi. Saç boyaları pek çok kimyasal içeriyor. Boy saçlarını boyattıkça saçlarınız kırılmakta ve dikkatli …

Devamını Oku »

Sarı Saç Boyası

Sarı saç boyası, yüzyıllardır kadınların dikkatini bir saç boyasıdır çeken. Kadın ister beyaz tenli isterim, saçının renginin açılması onu mutlu ediyorsa sarı saç rengini sever. Tek problem onun on renginde sarı renginin güzel durmuyor oluşudur. Dikkatli olun, sarı rengi sizi vezirŝken, bir anda verilebilecek bir başka karar ise, rezil edebilir. Bu nedenle doğal sarı saç boyası anten önerilir. Doğal sarı …

Devamını Oku »

Kahverengi Saç Boyası

Kahverengi saç boyası, doğal güzellik için pek çok kadının bir numarası çocuk saç boyasıdır. Türkiye standartları içerisinde pek çok kadının kahverengi olduğu düşünülürse, sarı veya başka renklere sahipseniz yönelimin de fazla artacağı düşünülür. Önceden bu durum gerçekten de böyleydi. Kadınlar sarı rengini inanılmaz çok seviyordu. Ne kadar yapay bir görüntü elde edilecek olursa olsun sarı saçlar ve siyah kaşlar kabul …

Devamını Oku »

Çikolata Kahve Saç Boyası

Kahverengi saç boyaları, kahverengi çok çok kadının doğal saç rengi olmasına rağmen sıkılan tercih edilen boyalardır. Son yıllarda popülerliği biraz daha arttıran kahverengi saçlar, diğer renkler ile mükemmel uyum gösterebildikleri için onlarca tonları ortaya çıkmıştır. Temel olarak bakır, kızıl, sarı ve karamel gibi renklerle uyum gösteren kahve saç boyası, bu renklerin hepsini ile onlarca saç boyası oluşturulmuştur. Küllü renkler dışında …

Devamını Oku »

Siyah Saç Boyası

Siyah saç rengi verdiği gizemli havası ile her zaman güzel bir görüntü sunmak ve oldukça cesur bir saç rengidir. Pek çok kişinin saç rengini kahverengidir. Siyaha yakın çok çok kahverengi var ancak gerçek saçı siyah olan çok az kadın bulunmaktadır. Siyah, çekiciği ve on rengi ile farklı bir hava yaratabilmesi için çok fazla konuşan bir renktir. Siyah saç rengi çok …

Devamını Oku »

Kızıl Kahve Saç Boyası

Kızıl, yanıltmadığı, pek çok ten renginde yabancı duran bir renktir. Bu saç rengini cesur kılar. Kızıl saç rengi ortaya çıkışı ile birlikte saç çok kızdı. Dikkat çeken parlayan kızıllar gibi, daha düz görünümlü kızıllar da ilgiyi üzerine çekmektedir. Kızıl renkler ilk önce farklı tonlarda tek başlarına kullanılmışlardır. Ardından bazı kadınların bu saç rengini çok cesur bulduğu fark yapılmış. Bu noktada …

Devamını Oku »

Gri Saç Boyası

Son dönemlerin eğiliminde saç renkleri arasında yer alan gri, pek çok bayanın ilgisini çekiyor. Saçlarında farklı bir tarz yaratmak isteyen bayanların tercihleri ​​arasında yer alan gri saç rengi, onun yaştan bayan için değişik tonlarında kullanılabiliyor. Siz de saçlarınızda gri yansımalar, balyaj, ombre ya da tamamen gri saç rengi vasıtasıyla, özel olarak bir kuaföre gidebilir ya da evinizde normal boy boyalı …

Devamını Oku »

Bal Köpüğü Saç Boyası

Bal köpüğü saç boyası, doğal saç renkleri arasında en beğenilenlerinden birisi … Son dönemlerde hem ünlü güzellerin hem de bakımına özen gösteriliyor bayanların saçları gördüğümüz bu renk tonu, risksiz saç boyaları arasında yer alıyor. Hemen hemen her on rengine uyumuşunu kullan bal köpüğü ü rengi saç boyası ve bu saç rengine uyumuş saç modelleri hakkında kısa bilgi sizlerle paylaşıyoruz. Bal …

Devamını Oku »

Pembe Saç Boyası

Biz hanımların maksimum ehemmiyet verdiği, güzelliğimizin simgesi olan saçlarımızla ilgili büyük değişikliği meydana getirdiğimiz alandır. Son trendleri takip eder, saç rengimizde ve kesiminde değiştirir yaparız. Canımız sıkılaştırılmış soluğu kuaförde alırız. Kestirir, sonradan hızlı saç uzatma yöntemlerini araştırırız. Boyatır, ardından saçlarını rengimizi açmaya çalışırız. Tamamı güzel görünmek için uygulanan yöntemlerdir. Önemli olan bu taraftan işlemler ile ziyan olan ve yıpranan saç …

Devamını Oku »

Mavi Saç Boyası

Önceleri aha çok rock meraklıların tercih sebebi mavi saç boyası modelleri artık kendini farklı bir şekilde ifade etmeye çalışıyor ve kendini özgür hisseden gençler tarafından da tercih edilmeye başlandı. Saçlarını mavi boya ile değiştirmek isteyen kişiler bu radikal kararları ötürü bazen eleştiri yağmuruna tutulsalar da, yapılan bu eleştiriler onları fikirlerini değiştirmelerini sağlayamamıştır. Saçlarda kullanılan renklerin arttığı mavi saç boyası markaları …

Devamını Oku »

Loreal Saç Boyası Renkleri

Bir dünya markası olan loreal boya hakkındaki bilgilendirmemiz kadınları çok memnun eder. Kozmetik sektöründe vazgeçilmez olan bir boya markasıdır. Şimdiki makalemiz ise loreal saç boyası renkleri hakkında bilgilendirme yapacak. İlgili markada şu tonlar sizin için saçlarınızda devrim yaratmanız adına çok ideal olan renklerdir. loreal saç boyası renklerinde kataloglar bulunan çok değişik tonlar sırada sıralanmıştır. Loreal dünyada isim duyulmuş çok rağbet …

Devamını Oku »

Koleston Saç Boyası Renkleri

Saç rengini değiştirmek için kadınlar için hangi rengin boyatılacağına karar vermek düşünülenden çok daha zor ve karmaşıktır. Bunun nedeni de her rengin herkese yaklamasını sağlayacak bir kaynaktır. Günümüz şartlarında çok fazla boya işareti bulunmakta ya da kadınların kullanımına sunulmaktadır. Bu markalar arasında yer alan Kolestan çok fazla sahip olun, ürettiği renk skalaları ve de yoğun bir ilgi görüyorum devam ediyor. …

Devamını Oku »