24 Kasım 2017,Cuma
Anasayfa » Tag Archives: Beş

Tag Archives: Beş

20 Beş Bileşenli Yan Yemek Tarifleri İğne

Yirmi kolay ve sağlıklı garnitür tarifleri beş maddeden azını gerektiren! Kitabımda, çok az, sağlıklı, kolay garnitür tarifleri bulunmamaktadır! Tatil masanızın mı, yoksa düzenli bir hafta içi akşam yemeğiniz olsun, burada yalnızca beş bileşenli yirmi benim favori yan yemek tariflerim var! Lemon Bowl'tan Kremalı Sarımsak Maskeli Patatesler Büyük Island'daki Görünümden Vanilya Fasülyesi ve Nutmeg ile Kabak Şaplakalı Kabak Bobbi'nin Kozy Mutfak'tan …

Devamını Oku »

Her şeyi beş robotu değiştiren … (video yanda)

                     2017-06-20 10:38:00                                                              Nükleer kazaları temizleyebilen robot simienlerden, büyük nesneleri kaldırmadan yetiştirebiliriz güçlendirilmiş exoskeletonlara kadar, robotik teknolojiler son derece hızlı bir şekilde gelişiyor. Nasa'nın Jet Propulsion Laboratuvarının baş mühendisi Ashitey Trebi-Ollennu, dünyayı değiştiren beş robot aracılığıyla konuşuyor.                                           6                      0                      0                                                                                                                                       Kaynak

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Mark Fields'ın beş nedeni daha görevden alındı ​​

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Mark Fields'ın devrilmesinden bu hafta başlarında Ford Motor Co.'nun CEO'su olarak çok şey yazıldı. Fields, Temmuz 2014'te devralındığından beri konuşanların çoğunluğu şirketin hisse fiyatına yaklaşık yüzde 40 oranında odaklandı. İş dünyasından basın ve Wall Street analistlerinin çoğu bu sayıya baktı ve Tesla'nın hisse fiyatıyla karşılaştırdı – şu anda, …

Devamını Oku »

Volkswagen, Savannah'daki Beş 2017 Kavramını Sundu

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Kadillak Chevrolet Chrysler Kaçma Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Cip Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MİNİ Mitsubishi Nissan Porsche Ram Rolls Royce …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

Bertil Roos beş günlük Yarış Okulu incelemesi 2. gün

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Asla, bir pistin yürüyüşünün önemini asla hafife almam. NJ, Millville'deki New Jersey Motorsports Park'taki beş günlük Bertil Roos Yarış Okulu'nun iki gününden sonra yapışkan olan şey, iki tam gün yarış sonrasında, 90 dakikada coldshoeing 'da 10 turda NJMP. Sahibi / eğitmeni Dennis Macchio'nun söylediği gibi, insan gözü şeyleri …

Devamını Oku »

Bir SCCA lisansı almak için Bertil Roos beş günlük yarış okulu – neyin içerdiği

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Önümüzdeki hafta güneşli, tropikal New Jersey'e gidip, Bertil Roos'un üç günlük karayolu okulu ve Millville'deki New Jersey Motorsports Park'taki iki günlük ileri eğitim okulunda yer alacağız. Umarız bizimle birlikte gideceksiniz çünkü her hafta her gün güncelleneceğiz. Okulun beş günlük "SCCA lisansını al" patlamasıyla aynı olan iki program – …

Devamını Oku »

New Hampshi'de tanımlanan beş yeni truffle türü …

                                     New Hampshire Üniversitesi'ndeki araştırmacılar, beş yeni tür truffles tespit ettiler.                                                                       Makarna üzerine serpiştirmek isteyecekleri türden olmamasına rağmen, bilim insanları New England ormanlarının sağlığı hakkında önemli bilgiler içerebileceklerini söylüyorlar. İki türün yalnızca New Hampshire'da bulunmuştu. Doktora öğrencisi Ryan Stephens, White Mountain Ulusal Ormanı'nda yeni türleri buldu. Resmi olarak tanımlanmadığı ve adlandırılmadığı halde, bunlardan birine E. Oreoides deniyor çünkü …

Devamını Oku »

Beş Yıllık S'nin Etkinliği …

Tasarım Rastgele kör olmayan okul tabanlı Ayarı Pune ve Nasik, Hindistan şehirlerinde iki okul Katılımcılar Müdahale grubu, bir Pune okuluna devam eden çocuklardan oluşuyordu 7-10 yaş arası, 12-15 yaşına kadar. İki kontrol grubu, (1) Aynı yaştaki çocuklar Nasik'teki benzer bir okula devam ediyor ve (2) Pune müdahale okulunda yaşayan ama başlangıçta 12-15 yaş arası çocuklar Müdahale 5 yıllık çok müdahale …

Devamını Oku »

Volkswagen, Tenn'te beş kişilik yeni SUV inşa edecek.

Atina'da geçen yıl açıklanan VW Group of America CEO'su Hinrich Woebcken. Fotoğraf kredi: DAVID UNDERCOFFLER Alman şirketin ABD'li üst düzey yetkilisi Çarşamba günü yaptığı açıklamada, Volkswagen AG, Tenn. Chattanooga'daki tesislerinde daha büyük araçlar için talep arttıkça yeni bir SUV daha yapmayı planlıyor. VW Group of America CEO'su Hinrich Woebcken New York otomobil fuarı gazetecilere verdiği demeçte, otomobil üreticisi Tennessee'de beş …

Devamını Oku »

2017 Lotus Evora Sport 410 GP Sürümü ile Sadece Beş Kopya

Özel Evora, Evora 400 üzerinde 132 kilo atıyor Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC (19459025) Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda …

Devamını Oku »

Mart Ayı Enflasyonu ve Bes Nisan Ayını Kabus Ayına …

BAŞKA BİRLEŞİK DEVLET BAŞKONSÜLÜĞÜ; TÜİK tarafından açıklanan Mart ayındaki% 1.02'lik TÜFE artışının, Ocak ayının zammını geri alıp vermeye çalıştığı gibi zorunlu günatılan BES 'in (Bireysel Emeklilik Sistemi) Nisan ayını kabusa çevirdiğini söyledi. "TÜİK tarafından açıklanan rakamlara göre Mart ayı tüketici enflasyon oranı (TÜFE) bir önceki aya göre% 1.02, Aralık ayına göre ise 4 , 34 artmıştır. Memur ve emeklileri için …

Devamını Oku »

2018 Volkswagen Atlas Mayıs ayında beş Trim Düzeyinde Hazır »AutoGuide.com News

Amerika'nın Volkswagen, yeni 2018 Atlasıyla ilgili fiyat detaylarını açıkladı. Atlas, varış noktası hariç sadece 30.500 dolarlık bir başlangıç ​​fiyatı ile Ford Explorer ve Honda Pilot gibi rakiplerle rekabet edecek. SEL Premium'ın tamamı için bir V6 ile birlikte olsa da, en az 48,490 dolar yatırmanız gerekecek. Amerikalı alıcıyı uyandırmak için kurulan bu yeni SUV hakkında tam bir fiyatlandırma ayrıntıları ve 2018 …

Devamını Oku »

Satılık: Beş Metrekarelik Gayrimenkul, 300'den fazla Klasik Otomobil Içerir

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

2017 Ford GT, Beş Sürüş Modu Sunuyor

Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Cadillac Chevrolet Chrysler Dodge Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Jeep Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MINI Mitsubishi Nissan Porsche Ram Rolls-Royce Filiz …

Devamını Oku »

Dünya Sağlık Örgütü'nün yirmi beş yılı …

Aşı. 2015 1 Ocak; 33 (1): 52-61. Bölüm Bölüm Temel İlaçlar ve Sağlık Ürünleri, Dünya Sağlık Örgütü, 20 Avenue Appia, 1211 Cenevre 27, İsviçre 2013 Ağustos 23 Arasında Alınmıştır; 1 Kasım 2013'te revize edildi; Kabul edilen 2013 Kasım 18 Bu, CC BY-NC-ND lisansı altında bir açık erişim makalesi (http://creativecommons.org/licenses/by-nc-nd/3.0 /). Bu doküman yayıncının izni ile gönderilmiştir.  Para yatırma sırasında, akran …

Devamını Oku »

Subaru Impreza Beş Kapılı veya Honda Civic Hatchback? »AutoGuide.com Haberleri

Küçük hatchback'ler şaşırtıcı derecede çok yönlüdür. Dış cephe ölçülerine rağmen, bütün garaj satışlarının bir önemsiz eşyası ile yükleyebilirsiniz. İki popüler beş kapılı seçenek, yepyeni Subaru Impreza veya Honda'nın neredeyse taze ve çok sinirli Civicidir. Bu arabalardan hangisi daha iyi bir seçimdir? Eh, işini belirlemek için … VE HAKKINDA OY OYNAT! Bu tossup'taki Scoobie, doğal olarak aspire edilen 2.0 silindirli dört …

Devamını Oku »

Engelleri Teknoloji İle Aşıyorlar Esra ÜLKAR Elif Nur Sevim'i oynadı reklam filmiyle tanıdık. Görme engelliler için tasarlanmış sınıfta, doğum günü yaklaşan annesine bilgisayar yardımıyla yaptığı resmini hediye ediyordu. 2015'te MEB ile Turkcell (TMB) ile Turkcell'in ortaklaşa yürüttüğü bir eğitim programıdır. Iki yıl için imzalanan protokolle 45 ildeki 80 okulda teknoloji sınıfları ve meslek atölyeleri kurulması hedeflendi. Şimdiye kadar 47 okulda bu gerçekleştirildi. Sınıflar görme engelli ve az gören öğrenciler için özel teknoloji ve yazılımlarla donatıldı. Bir öğrenci bir öğrenci, öğretmenin tahtaya yazdıklarını bilgisayarında görebileceği şekle getirerek okuyabiliyor. Görme engelliler, özel yazılımla rahatça bilgisayar kullanabiliyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif, Ankara Göreneller Görme Engelliler Okulu'nda eğitim alıyor. Elif halinden memnun. Başka yerlerdeki arkadaşlarının da bu imkânlardan faydalanabilmesi için sınıfların sayısının arttırabileceğini söylüyor. Sekiz öğrenciden oluşan sınıfının özellikleri şöyle anlatıyor: "Ankara'da birinci sınıfta gittim. Başta sınıf normaldi. Beşte s ninfta okumaya başladım. Sınıflar işimizi kolaylaştırıyor. İnterneti daha rahat kullanıyoruz. İstediğimiz bilgiyi bulabiliyoruz. Kitabın fotoğrafını çekip okutabiliyoruz, sesli olarak duyuyoruz. Kamera da çok kullanışlı. Bir şeyin fotoğrafını çekip bilgisayarla okutabiliriz. Bazı derslerin öğretmen anlatıyor, bazılarında konuları bilgisayarla işliyoruz. En sevdiğim dersler, bilgisayar. " Reklamda oynadığı için mutlu olduklarını söyleyen Elif," Önce okulda çekim yapıldı. Sonra beş kişi seçildi. Onların tercihi. İstanbul'a gittim. Filmde oynuyorum için mutluyum. Gelecekle ilgili aklımda bir sürü meslek var ama sunucu olmak istiyorum, spiker gibi "diyor. Hedef 80 okul Programla 2015'te 11, 2016'da ise 36 olmak üzere 47 okul tamamlandı. Nisana kadar 80'e ulaşılması hedefleniyor. MEB ile protokol sınırı belirlenmiş. Iller ihtiyaç önceliğine göre seçildi. Türkiye'de 16 görme engelli okulu var ve tamamına teknoloji sınıfı kuruldu. 20 işitme engelli meslek okulunun hepsine bilişim teknolojileri sınıfları yapıldı.

MEB tarafından gerekli önceliğine göre belirlenen 45 hafif zihinsel engelli özel eğitim mesleki eğitim okuluna ise meslek atölyeleri açıldı. Kaynak

Devamını Oku »

Ben Warren Geleceğin Konuşmalarını Düşündüğümde, gelecekte kesinlikle çıkacaksın; Konuşmalarımda. İnsanlarla bile bilmiyorum. Bundan sonra en yakın arkadaşımla kahve içeceğim ve geçmiş sevgiler hakkında konuşmaya başlayacağız. "Bu adam vardı …" Ona söyleyeceğim ve çünkü seni tanımıyor, yalnızca istediğimi görecek. Ona söylediğim kısımları yalnızca biliyor. Bunda büyülü bir şey olacak, caydırca dürüst bir açıklama olacak ancak aynı zamanda da kör olacak. Öyküyü nasıl anlatacağımı düşünürüm, çünkü yalnızca şimdiye kadar görüşlerini paylaşan insanlara kısmen anlattım. "Bir süre birlikte olduk, uzun değil, sadece on beş ya da on altı" belki söyleyeceğim ama yine de tüm hatıralarımızın tarih ve saatlerini hatırlayacağım. " o adam, bilirsiniz?" Dedim ki, ne demek istediğimi anlamak için ona bakıyorum. "Ne

o adam?" Diye soracak. "Seni hiç unutmayacak o adam biliyor musun? İlk aşkınız belki; Bilmiyorum, gözlerini açan ve dünyayı farklı gören ilk kişi. Sizi hiç tanımadığınız bir çeşit his ile dolduran kişi, onlardan önce var olduğunu ve sonra da gittiklerinde sizi asla mümkün olduğunu düşündüğünüz bir tür boş boşlukla terk ettiler … " Başını salacak, çünkü itiraf etmek istemiyorum bile …

Devamını Oku »

5. Sınıf Matematik Beş Basamaklı Doğal Sayılarla E …

Açıklama Beş basamaklı doğal sayılarla eldeli toplama işlemi 5. Sınıf Matematik Beş Basamaklı Doğal Sayılarla Eldeli Toplama İşlemleri dosyası, 5. Sınıf Matematik Etkinlik ve Çalışma Kağıtları bölümünde bulunmaktadır. 5. Sınıf Matematik Beş Basamaklı Doğal Sayılarla Eldeli Toplama İşlemleri Eğitimhane, 5. Sınıf Matematik Beş Basamaklı Doğal Sayılarla Eldeli Toplama İşlemleri indir. Kaynak

Devamını Oku »

Günün 10.000 Adımına Ulaşma için Beş Kolay İpucu

Günde 10.000 basamağa erişmek için beş kolay, pratik ipucu Geçen hafta, katılımcılarımızı evde daha sık yemek yapmaya teşvik ederek, üçüncü yıllık sağlıklı yaşama meydan okumamızı, Sağlıklı Bir Yeni Sana Dönüşüm Günü 28 Gün'ü başlattık. İki hafta, günde en az 10.000 basamak yürümeye herkese meydan okuyarak, vites değiştiriyoruz ve sağlıklı yaşamın fitness yönüne bakıyoruz. Günün 10.000 basamaklamasıyla ilgili en büyük şey, …

Devamını Oku »