17 Aralık 2017,Pazar
Anasayfa » Tag Archives: 72

Tag Archives: 72

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Geçici Öğretmen Alımı Duyurusu Yayımlandı Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonlarının Desteklenmesi Projesi Geçen Süreli Öğretici ve Rehberlik Danışman Alımına İlişkin Duyuru 2014/21 Sayılı Genelge çerçevesinde Valiliklerin Bünyesinde Kurulan Geçici Eğitim Merkezlerinde (GEM) ve Bakanlığımıza bağlı okullarda öğrenim gören Geçici Koruma Kanunu kapsamındadır Suriyeli öğrencilere Türkçe Öğretmen ve öğretmenlik yapmak rehberlik hizmetlerini geliştirir "Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonunun Desteklenmesi Projesi" (RESİM) kapsamında Ek-1 tabloda belirtilen Bu duyuru Millî Eğitim Bakanlığı "Öğretmen Alım Duyurusu" değil. Birleşmiş Milletler Genel Sekreteri Prof. Dr. Bakanlığımızca yapılan Öğretmen alımı bittiğinde 657 sayılı Devlet Memurları Kanunu Kapsamında atamalarıdır; Atama yapılmadığı için sözleşmeleri proje idaresi tarafından feshedilerek Bakanlığımızda görevlerine başlayabileceklerdir. 1. Genel Müdürlük: Hayat Boyu Öğrenme Genel Müdürlüğünü, İdare: Suriyeli Çocuklarının Türk Eğitim Sistemine Entegrasyon Desteklenmesi Projesi Proje Yönetim Merkezi Proje / RESİMLER: Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyon Desteklenmesi Projesi Geçici Süreli Öğretici: Proje kapsamında geçici koruma altındaki Suriyeli öğrencilere eğitim kurumlarında Türkçe Rehberlik Danışmanı: Proje kapsamında geçici koruma altındaki Suriyeli öğrencilere eğitim kurumlarında Rehberlik sunmak. ] GEM : Geçici Eğitim Merkezi 2. a) Türkiye Cumhuriyeti vatandaşı olmak b) Kamu hakları mahrum bulunmamak, C) Türk Ceza Kanunu'nun 53'üncü maddesinde belirtilen süreler geçmiş olsa bile; Kasten işlenmiş bir suçtan biri bir ya da daha fazla süreyle hapis cezasına ya da affa uğramış olsa bile devletin güvenliğine karşı suçlar, Anayasal düzene ve bu düzenin işleyişine karşı suçlar, millî savunmaya karşı suçlar, devlet sırlarına karşı suçlar ve casusluk, zimmet, irtikâp, rüşvet d) Askerlik hizmetleriini, d) Askerlik servisini kullanıyor musunuz? e) Güvenlik soruşturması olumlu sonuçlanmak, f) 28 Şubat 2017 tarihi itibariyle 40 yaşından gün almamış olmak. 3. ÖZEL ŞARTLAR 3.1. Geçici Süreli Türkçe Öğreticiler: 3.1.1 Üniversitelerin dört yıllık lisans öğretimi yapan Eğitim Fakültelerinin Sınıf Öğretmenliği veya Türkçe Öğretmenliği alanına mezunu ya da öğretmenliğe kaynak teşkil eden yükseköğretim programlarından mezun olanların ihtiyacı karşılamadığı alanlarda Ortaöğretim Alan Öğretmenliği Tezsiz Yüksek Lisans ya da Pedagojik Formasyon Programı / Pedagojik Formasyon Eğitimi Sertifika Programından birini başarıyla tamamlamış olmak, 3.1.2. 3.1.3. Yükseköğretim kurumlarının veya programlarının denkliği kabul edilmiş olmak, 2016 yılı Kamu Kişisel Seçme Sınavına geçici olarak görevlendirileceği alan için KPSS-P121 puan çeşidi açısından 50 ve üzerinde puan almış olmak, 3.1.4 3.1.5. Birleşmiş Milletler Genel Sekreteri 3.1.6. Birleşmiş Milletler Genel Sekreteri Birliği, Genel Sekreterlik Sekreteri, FETÖ / PDY veya herhangi bir bölücü terör örgütleri ile ilgili olarak yapılan soruşturmalarda yer almamak, adli veya idari ceza almamış olmak, özel eğitim kurumlarından çalışanlardan Lisansı iptal yaptırılmamış olmak, KHK cezası ile ihraç edilmemiş olmak veya herhangi birisi disiplin soruşturması sonucu ile suç problemi ceza almamış Olmak, 3.1.7. 3.2. Bir vatandaş olmamak; Geçici Süreli Rehberlik Danışmanları 3.2.1. (*) Mezunu olması gerekmektedir. (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK) (*)) (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK)) Bu ders sadece Türkçe'ye çevrilmiştir. ) 3.2.2. İş Yükü Açıklaması / Açılacak olan Ortaöğretim Alan Öğretmenliği Sertifika Programını başarı ile tamamlayanlar) 3.2.2 Yurt dışındaki yükseköğretim kurumlarından mezun olanların, Yükseköğretim Kurulu Başkanlıklarının yüksek öğrenimlerinin ve / veya pedagojik formasyonun yükseköğretim kurumlarına veya programlarının denkliği kabul edilmiş olması, 3.2.3. 2016 yılı Kamu Kişisel Seçme Sınavı geçici süreli görevlendirileceği alan için KPSSP121 puan çeşidi açısından 50 ve üzerinde puan almış olmak, 3.2.4 3.2.5. Birleşmiş Milletler Genel Sekreteri 657 sayılı Kanunun 4 / B maddesi sözleşmeli olarak çalışmakta iken sözleşmeleri feshedilenler bakımından, başvuru tarihinin son günü başlığında bir yıl bekleme süresini tamamlamış olmak, 3.2.6. FETÖ / PDY veya herhangi bir bölücü terör örgütleri ile ilgili olarak yapılan soruşturmalarda yer almamak, adli veya idari ceza almamış olmak, özel eğitim kurumlarından çalışanlardan Lisansı iptal yaptırılmamış olmak, KHK cezası ile ihraç edilmemiş olmak veya herhangi birisi disiplin soruşturması sonucu ile suç problemi ceza almamış Olmak, 3.2.7. 4. Bir vatandaş olmamak, 4. İŞİN NİTELİĞİ: 4.1. Projenin yürütüldüğü Suriyeli öğrencilerin bulunduğu 23 il ve ilçelerdeki kurumlarda Türkçe öğretmek, 4.2. Projenin yürütüldüğü Suriyeli öğrencilerin bulunduğu yerde 23 il ve ilçelerdeki kurumlar rehberlik amaçlı, 5. GEÇİCİ SÜRELİ EĞİTİM PERSONELİNİ İLİŞKİN HUSUSLAR: 5.1. Geçici İngilizce Öğretmenlik görevlendirilmesinde Sınıf Öğretmenliği veya Türkçe Öğretmenliği Mezunu olmak gerekirlidir. Geçici Zaman Rehberlik Danışmanı görevlendirilmesinde Rehberlik ve Psikoloji Danışmanlık Bölümü / Anabilim Dalı, Eğitimde Psikolojik Hizmetler Bölümü / Anabilim Dalı veya Psikoloji Bölümü (*) mezunu olması gerekmektedir. (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK) iş birliği 5.2. Yüksek Lisans veya Yüksek Öğrenim Formülasyon Programında başarı ile tamamlayanlar) 5.2. 5.3. Sözleşme süresi 1 yıl olup, 4857 sayılı İş Kanunu için sözleşme imzalanacaktır. Geçici olarak görevlendirilecek Türkçe Öğreticiler ve Rehberlik Danışmanları okullarda / kurumlarda haftada 35 saate kadar derse girecek veya çalışacaktır. 5.4. Geçici olarak görevlendirildi. ]] 6. İSTENEN BELGELER 6.1. Elektronik Başvuru Formunda beyan alınacaktır. İsteğe Bağlı Değil, Elektronik Başvuru Formunda beyan alınacaktır. Adli Sicil Belgesi İkametgâh Belgesi Nüfus Cüzdan Fotokopisi (Aslı ibraz edilir.) Mezuniyet Belgesi'nin Fotokopisi (19459010) Askerlik Başvurusu Askerlik Durum Belgesi KPSS sonuç belgesi 7. BAŞVURU 7.1. Başvuru tarihi: 27 Şubat-03 Mart 2017 Başvurular 03 Mart 2017 tarih mesai bitimine kadar (www.meb.gov.tr) (http://pictes.meb.gov.tr) /) (Http://hbogm.meb.gov.tr/) fiyatında yapılacak. 7.2. Adaylar, 3 farklı internet sitesinden başvurabilirler: Milli Eğitim Bakanlığı (www.meb) .gov.tr) Hayat Boyu Öğrenme Genel Müdürlüğü (http://hbogm.meb.gov.tr) Proje Merkez Yönetimi (http://pictes.meb.gov.tr) /) Internet sitesinden başvuru formunu doldurup onaylayacaklardır. Başvuru belgesinin 2 sayısı çıktısını alarak kaldırmak için İl / İlçe Milli Eğitim Müdürlüklerinin Eğitim ve Öğretim Görevlisi Atama Birimine öğrenim belgesi ya da diplomanın aslı veya onaylı birer örneği ile birlikte son başvuru günü mesai bitimine kadar başvurularını şahsen onaylatacaklardır. Başvuru ilan koşulları sağlamayan veya zamanında yapılmayan başvurular kesinlikle kabul edilmeyecektir. 8. SÖZLÜ SINAV 8.1. Geçici Öğretmenlik ve Rehberlik Danışmanlığı için başvuran adaylara başvurusu kabul edenler kontenjan sayısının iki katına kadar sözlü sınava alınacaktır. 8.2. 8.3. Yazan: Sözlü sınavda Geçici Süreli Öğretici ve Rehberlik Danışman adayları bir konuyu kavrayıp özetleme, ifade yeteneği ve muhakeme gücü; 8.4 İletişim büroları, iletişim ve iletişim kuralları, bilimsel ve teknik gelişmelere açıklık, Kontenjan sayısı kadar yedek aday belirlenecektir. 8.5. 8.6. Geçici Süreli Öğretici ve Rehberlik Danışmanları için sözlü sınav, MEB Ölçme Değerlendirme ve Sınav Hizmetleri Genel Müdürlüğünse yaptırılacak. 28.11.2016 tarihinde Hayat Boyu Öğrenme Genel Müdürlüğü internet sitesinde yedekten yerleştirilen ancak göreve başlayacak öğretici adayları, yeniden başvuru yapmaları halinde sözlü sınavından muaf tutulacaklardır. Tescil kendi sayfanı oluştur yeminli sözlük nedir? Bu İlanlar Daha Fazla Ögrenin Ortalamam Yapılsın mı? 8.7. Türkçe [English] [English] [tr] Kaydolun anketi yazan insanlara e- 9. DUYURU VE SÖZLEŞMEYE DAVET 9.1. Sözlü sınav sonuçları, sınav bitimi müteakiben 3 iş günü içinde http://pictes.meb.gov.tr ​​internet siteleri İlan Edilecektir. 9.2. Sözlü sınavlar [Sözleşmeyedavetedilensözlüsınavdabaşarılıolmasırasınagöreyapılacaktır 9.3. En çok satılanlar, kontenjan sayısı kadar Geçerli Süreli Öğretici ve Rehberlik Danışman adayları davet edilecektir. Sonuçların ilanından sonra Ek-2 Takvimde yazarların görüşlerine başlayacak öğreticiler / rehberlik danışmanları ile proje merkezi yönetimi arasında sözleşme imzalanacaktır. Söz konusu sözleşmeyi imzalamaya gelmeyen adayların yerine yedek adaylar sırasıyla davet edilecektir. 1. Sağlık Kurul Raporu 2. SGK İşe Giriş Belgesi 3. 4 adet vesikalık 4. 10. 10.1. Geçici Olarak görevlendirilen Yazin öğretmenlerin maaşları "Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonunun Desteklenmesi Projesi" Kapsamında karşılanacaktır. 11. Diğer Hususlar 11.1 . 11.2. Sözleşme imzalandıktan sonra, işe alınma açısından gerekli niteliklerden kaçınılmalıdır. 11.3 Gerçeğe aykırı beyanda bulunanlar hakkında hukuki işlem yapılacaktır. 11.4. İlan metninde belirtilen hususlar, ilgili mevzuat hükümlerine göre işlem yapılacaktır. İş bulma tekniği şartname 11 maddeden ve alt arasında değişen oluşmaktadır. EK-1 Suriyeli Çocukların Türk Eğitim SİSTEMİNE ENTEGRASYONUNUN DESTEKLENMESİ PROJESİ Kapsamında alınacak GEÇİCİ Süreli EĞİTİM PERSONELİ KONTENJANLARI

İL ADI Kaynak

Devamını Oku »

Sosyal Bilgiler 5. Sınıf Berkay Yayınları Çalışma Kitabı Cevapları sayfa 72

  Berkay yayınları 5. sınıf sosyal bilgileri çalışma kitabı cevapları sayfa 72 Sınıflandırılmış Sosyal Bilgiler Öğrenci Çalışma Kitabı Berkay Yayınları 5. Ünite Gerçek İnter Düşler Sayfa 72 Bildiklerim Bilmek İstediğiniz İçin ve Cevaplarını Verebilirsiniz Etkinlik Soruları ve Cevapları Bildiklerim Bilmek İstediklerim ve Öğrendiklerim 72 Bu etkinlikte A ve B bölümlerini ünitenin başında, C bölümünü ünitenin sonunda yapınız. A. Ders Kitabı'nın …

Devamını Oku »

PD1'in kristal yapısı, Haemophilus yüzey fibrili (Hsf) olağandışı büyük bir üçlü ototransporterdir En öldürücü soylar H tarafından eksprese edilen yapışkan (TAA). Influenzae . Hsf'nin patojen ve konukçu arasındaki yapışmaya aracılık ettiği bilinmektedir ve epiglotit, menenjit ve pnömoni gibi potansiyel olarak ölümcül hastalıkların kurulmasına izin verir. Yakın tarihli araştırmalar bu TAA'nın yeni bir 'saç tokası benzeri' bir mimari oluşturabileceğini önermekle birlikte, yüksek özünürlüklü yapısal veriler bulunmayan Hsf'nin karakterizasyonu silico modelleme ve elektron mikrograflarında ile sınırlı olmuştur. Burada, Hsf varsayımsal alan 1 (PD1) 'in kristal yapısı 3.3 Â çözünürlükte bildirilmektedir. Yapı, beklenmedik bir N-terminal TrpRing alanının mevcudiyetini açığa vurarak önceki alan açıklamasını düzeltir. PD1, çözülecek olan ilk Hsf alanını temsil eder ve böylece 'saç tokası benzeri' hipotez üzerine daha fazla araştırma yapılmasını sağlar. Anahtar Kelimeler: Hsf varsayımsal alan adı 1, trimerik ototransporter, Haemophilus influenzae adezin, hücre adhezyonu, Haemophilus yüzey fibril 1. Giriş Haemophilus influenzae üst solunum yolu enfeksiyonlarına, pnömoniye ve akut menenjit (Danovaro-Holliday ve ark. 2008 ; Murphy'ye bağlı enfeksiyonlara neden olan Gram negatif fakültatif anaerobik bir bakteridir ve diğerleri 2009 ). Farklı suşları H. Influenzae ya a-f serotiplerine, ikincisine de tipik olmayan olarak tanımlanan (Barenkamp ve St Geme, 1996 ) alt bölümlere ayrılmış şekilde kapsüllenmiş ya da kapsül içine alınmamıştır. H. Influenzae enfeksiyon, birçok pilus ve nonpilus yapışkan faktörlerin aracılık ettiği bir süreçte patojenin konak epitel hücresi astarlarına ve çeşitli ekstraselüler matriks (ECM) proteinlerine ( örneğin vitronektin) yapışmasıyla kurulur (Cotter ve diğerleri 2005 Virkola ve diğerleri 2000 ; Hallström ve diğerleri 2006 ). Yapışma, bakterinin konakçı tarafından temizlenmesini önlemesine izin verir ve sayısız virulans mekanizmaları yoluyla derin yerleşimli bir enfeksiyonun kurulmasını kolaylaştırır . Tüm suşları H. Influenzae patojeniktir, 1990'lı yıllarda etkili bir aşı kullanımına başlamadan önce hastanın morbidite ve mortalitesinin en yüksek oranlarından sorumlu olan virülan tip b (Hib) 'dir. Hib tarafından kullanılan böyle bir virülans faktörü, daha iyi karakterize edilmiş bir başka H ile önemli homoloji paylaşan bir trimerik ototransporter adhesin (TAA) proteini olan Haemophilus yüzey sarmalı (Hsf) dir. Influenzae ve diğerleri ve diğerleri 2015 (19459019). TAA'lar olarak bilinen HIA (Cotter ve ark. Salgılanan proteinlerin tip V ailesinin bir parçası olan, doğrusal bir fibril 'lollipop' yapısında düzenlenmiş üç ana alan türüne sahiptir. Baş ve küre alanları, hücre dışı bölgede N-terminüsünden serpiştirilir. YadA benzeri (YIhead) alanlar (Nummelin ve ark. 2004 gibi) ya çapraz mimarilere sahip β-tabakalardan oluşan ön alanlar ya da Triptofan halkası (TrpRing) alanları (Szczesny ve diğerleri 2008 (19459019)), tipik olarak proteinlerin yapışkan aktivitesine aracılık etmektedir. Sap, süper sargının derecesine ve yönüne (Hernandez Alvarez ve ark. 2010 ) bağlı olarak hepartan'tan pentadecad'a değişen periyodik üçlü üç boyutlu sargılı bir yapı oluşturur. Son olarak, C-terminal translokatör alanı, her bir altbirim bir amfipatik alfa-helis artı dört β-tabakaya katkıda bulunan bir trimerik β-namludur (Meng ve ark. 2008 ). Bu alan, proteinin geri kalan kısmının zar yoluyla translokasyonundan sorumludur ve tüm TAA'larda bulunur (Lehr ve diğerleri 2010 ). Son zamanlarda yapılan araştırmalar, Hsf'nin EM görüntülerine dayanan görünüşte yeni bir 'saç tokası benzeri' yapıya sahip olduğunu öne sürdü ( Singh ve diğerleri 2015 ). Paylaşılan bölgelerinde, Hia ve Hsf'nin% 72 sekans özdeşliği vardır (Hia161-1098 ve Hsf1484-2413, Ek Şekil S1), ancak tam uzunlukta trimerik Hsf (~ 750 kDa), Hia'nın (~ 340) iki katından daha büyüktür KDa). Hia'nın iki bağlayıcı alanı (HiaBD1 ve HiaBD2) de Hsf'de tanımlanmıştır (Laarmann ve diğerleri 2002 ); Bununla birlikte, Hia'nın aksine, Hsf'nin ek bir bağlanma alanı (HsfBD3) ve üç varsayımsal alanı vardır, yapısı ve fonksiyonu bilinmemektedir. Dahası, Hsf'nin alanlarını modellemeye yönelik sınırlı bir in silico yaklaşımı, ~ 200 nm'lik doğrusal bir TAA olmasının muhtemel olduğunu ortaya koymuştur (Singh ve diğerleri 2015 ). Buna rağmen, Hsf'nin elektron mikrografları H'de ifade edildi. Influenzae RM804 Hsf'yi doğrusal bir TAA olarak değil çift katlı bir saç tokası halkası yapısı olarak göstermiş görünüyor. Alan dizilişinin haritalanması, Hsf'nin N-ucunun zarın yakınında bulunması ve 'kıl tokası benzeri' hipotez ile tutarlı olmasını önerdi. Yapışkan işlevine ek olarak, Hsf'nin bağlandığı gösterildi. Kompleman inhibitörü vitronektin (Vn): etkileşim, HsfBD2 ve C-terminali Vn kalıntıları 352-374 ile eşleştirilmiştir (Hallström ve diğerleri 2006 ; Singh ve ark. 2014 ). Hem serumda hem de ECM'de bulunan bu glikoproteinin kazanılması, H'yi sağlar. Influenzae kompleman sisteminden kaçınmak ve epitelyal yüzeye daha iyi yapışmak suretiyle bakteri virülansını arttırmaktır. Bu kısmen Hia'nın aksine Hsf'nin en öldürücü, tiplendirilebilir H suşlarında ifade edildiğini açıklayabilir. Influenzae . Burada, bir Hsf varsayımsal alanının (PD1) kristal yapısını bildiriyoruz. Bu yapı, PD1, N-TrpRing: KG: TrpRing-C için yeni bir alan düzenlemesi ortaya çıkarır ve bu nedenle daha önce silico dizi analizi ile tanımlanan alan mimarisinin yerini alır. Bu çalışma, bu TAA'nın varsayımsallaştırılmış yeni 'saç tokası benzeri' yapıyı (Singh ve ark. 2015 kabul ettiği) belirlemek için Hsf'nin tam uzunluklu yapısını belirlemek için sürekli bir çaba oluşturmaktadır. 2. Gereçler ve yöntemler 2.1. Makromolekül üretimi 2.1.1. PD1-GCN4 Hsf alanı PD1, iki GCN4 bağlantı proteini arasında klonlandı. GCN4, doğal haliyle sargı bobini dimerini oluşturan iyi tanımlanmış bir maya transkripsiyon faktörüdür. Bununla birlikte, hidrofobik çekirdeğindeki spesifik kalıntıların mutajenezi GCN4'ün çeşitli oligomerik durumları benimsemesine olanak tanır. Bu nedenle, kararlı oligomerizasyonu kolaylaştırmak için füzyon proteinleri için ortak olarak GCN4 varyasyonları sıklıkla kullanılır. Bu durumda, fikir, HsfPD1'in dengeli trimerleşmesini kolaylaştırmak için hem N- hem de C-terminusuna iyi karakterize edilmiş trimer oluşturan bir GCN4 varyantı eklemek olmuştur (Hernandez Alvarez ve diğerleri 2008 (Hartmann ve diğerleri 2012 Koiwai ve diğerleri 2016 ) Lupas grubunun başarıyla kullandığı gibi. Bu füzyon proteini, PD1-GCN4, restriksiyonsuz (RF) klonlama kullanılarak üretilen bir pIBA-PD1-GCN4tri-His 6 plazmidinden eksprese edildi. PD1 geni, bir pET-16b- hsf polimeraz zincir reaksiyonu ile, 1-2414 plazmid. Primerler, hedef vektör olan pIBA-GCN4tri-His 6 (19459034) (Tamamlayıcı Tablo S1) tamamlayıcı çıkıntıları olan PD1 genini içeren bir 'megaprimer' üretmek üzere tasarlandı. 6 XhoI (New England Biolabs) ile restriksiyon sindirimi ile lineer hale getirildi ve PD1 genini (bunun içinde bulunan PIBA-GCN4tri-His 'Megaprimer') plasmid içine sokun. PD1-GCN4 ekspresyonu, 4 saat süreyle 8.6 μl M nihai konsantrasyona bir anhidrotetrasiklin hidroklorürün eklenmesiyle 0.6 OD 600 de indüklendi. Hücreler 193 K'de gece boyunca saklanan santrifüjleme (2000 g ile 10 dakika süreyle 277 K'de) ile toplanmış ve 50 m M 'den oluşan tampon [NaH 4 500 m NaCl, pH 8.0, 500 m . Hücreler sonikasyon ile parçalanmış ve süpernatanlar santrifüjleme (1600 g ile 10 dakika 277 K'de) ile toplanmıştır. Protein, immobilize metal iyon-afinite kromatografisi (IMAC) ile saflaştırıldı. PD1-GCN4 ihtiva eden temizlenen süpernatant, daha önce tampon A (2 x 6 ml; üç kolon hacmi) ile dengelenen bir Ni-NTA agaroz sütunu (GE Healthcare) üzerine tatbik edildi ve ajitasyon ile 1 saat süreyle bağlanmasına izin verildi. Proteinler, 50 m

NaH [500.04] NaCl'den oluşan tampon B ,% 10 gliserol, 300 m imidazol pH 8.0. Saflaştırılmış proteinin kalitesi, çok açılı bir lazer ışığı saçan (SEC-MALLS) aparatına (Şekil 1) bağlanan boyut uzaklaştırma kromatografisiyle değerlendirildi a ). SEC-MALLS, 50 m'lik Tris, 500 mM'lik NaCl, 50 mM Tris, 1 mM NaCl ve 1 mM NaCl'den oluşan tampon C ile dengelenmiş bir Superdex 200 5/150 …

Devamını Oku »

Land Rover'ı haritaya koyan Bill Baker, 72 yaşında öldü

     Paylaşın      Facebook          Tweet          Pinterest          E-posta             Land Rover'ın 1986'da ABD pazarına başarılı bir şekilde dönmesinde anahtar rolü oynayan efsanevi PR menüsü Bill Baker, Perşembe günü evinde Laguna Niguel yakınlarındaki evinde kanserle savaştan sonra öldü. 72 yaşındaydı. Ohio yayıncısı olan gazeteci Baker, Ford'un dikkatini 1970'lerin başında Cleveland'da yayınlanan yol test bölümleriyle yakaladı. Ford, yayın medya …

Devamını Oku »