25 Kasım 2017,Cumartesi
Anasayfa » Tag Archives: 50

Tag Archives: 50

Servet değerinde 50 TB'lık SSD!

Viking Teknolojisi duyurduğu iki yeni SDD ile donanımlı sürümü alt üst etmeye hazırlanıyor. 10 TB, 15 TB SSD'ler daha yeni duyurulurken, 25 ve 50 TB kapasiteli iki yeni SSD modeli çıktı. 50 TB'lık SSD için veri merkezleri hedefleniyor Yeni üretilen bu diskler önecelikli olarak veri merkezlerini hedefliyor. Veri merkezlerinin maliyetlerini düşürmesi planlanan bu iki yeni ürün uzun vaadede fiyatını çıkartabilir …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Mercedes, Limited Edition Race Car ile 50 Yıllık AMG Kutlamaları »AutoGuide.com News

AMG gibi performans odaklı bir markanın 50. yıldönümünü kutlamak için yeni bir yarış arabası yapmaktan daha iyi bir yol. Tam da Mercedes-Benz'in yaptığı şey, sadece beş örnek inşa edilecek olan yeni AMG GT3 Edition 50 parça özelliğini piyasaya sürdü. Beş yıl önce Mercedes, 45 yıllık performans mirasını kutlayan SLS AMG GT Edition 45 ile aynısını yaptı. Şunlara bakın: Detaylar Mercedes-AMG'nin …

Devamını Oku »

50 Yıllık Mazda Rotary Motorları: '67 Cosmo Sport ', 93 RX-7, '01 RX-8 ve daha fazlası

Sürüş Bedava Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Değiştirme Arabası Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Kadillak Chevrolet Chrysler Kaçma Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Cip Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MİNİ Mitsubishi Nissan Porsche Ram Rolls …

Devamını Oku »

BMW, AMG'nin 50. Yıldönümünde Mercedes-Benz'i Tebrik Ediyor

                         BMW, otomobil endüstrisinde 100. yılını tamamladığında, Alman otomobil üreticisi Mercedes-Benz, Bavyera otomobil üreticisini yüzüncü yıldönümünde kutlayan sosyal medyada çok esprili bir klip yayınladı. Aşağıda bulacağınız küçük video klip, "100 yıllık rekabetin için teşekkür ederim, önceki 30 yıl aslında biraz sıkıcı" dedi. Mercedes işi kendisinden 30 yıl sonra işe girdiği için BMW'ye trol ederken, BMW bir spor gibi geçti. Son …

Devamını Oku »

Hızlı Ödeme 4.0 ile 15 dakikada yüzde 50 şarj imkanı!

Günümüzde akıllı telefonlar gelişen donanım ve optimize edilmiş yazılımlar çoklu pil süreleri sunuyor dai, şarj süreleri Halen kullanıcı için önemli hususlar başında geliyor. Qualcomm geçtiğimiz yıl New York'ta düzenlediği toplantıda, Snapdragon 835 ile beraber, hızlı hızlı şarj çözümü Hızlı Başvuru 4.0 'ı duyurdu. Galaxy S8 gibi Snapdragon 835 'on güç alanındaki amiral gemi modellerinde Hızlı Başvuru 4.0 desteğinin görülemesinde sonradan …

Devamını Oku »

50 saatlik oyun 44 dakikada bitirdi!

Prey geçtiğimiz hafta satışa sunuldu ve şimdiden Half-Life Bioshock gibi yapımlara ve benzerlikleriyle büyük övgüler alıyor. Arkhane Studios tarafından geliştirilen Prey oyunculara sunduğu özgürlük ile hayli dikkat çekiyor. Prey sadece 44 dakikada bitirildi! Video oyunlarının değiş değişi Speedrun bu kez Prey'e bulaştı. Speedrun videolarıyla tanınan DraQu oyun sadece 44 dakikada bitirmeyi başardı. Prey açık dünya yapısı ve mekanikleri arasında aslında …

Devamını Oku »

Yaklaşık 50 kişi, Teksas'tan sonra hastanelere götürüldü …

                                     Doğu Teksas'ın Kanton kentinde bir kasırga süpürüldükten sonra yaklaşık 50 kişi hastaneye kaldırıldı.                                                                       ETMC Bölgesel Heathcare Sistemleri'nin bir sözcüsü, bölgedeki hastanelerinin şu ana kadar kritik bir durumu bulunan 47 hasta aldığını açıkladı. Sözcüsü Rebecca Berkley, Cumartesi akşamı fırtınadan sonra yolda birkaç hastanın bir avuç bulunduğunu söyledi. Ulusal Hava Durumu Servisi meteorologlarından Mark Fox, Dallas'tan yaklaşık 80 kilometre …

Devamını Oku »

VW, ABD'de 2 litrelik Dizel Kirliliği Gideren 50 Cent'ın Üzerinde Onarılan Geri Satın Altı

                         Volkswagen geçen hafta ABD hükümeti ile uzlaştırma anlaşması uyarınca 475.000 kirleten 2 litrelik dizel araçlarının yüzde 50'sinin geri satın alındığını veya onardığını söyledi. Şirket, önlemlerin en büyük otomotiv geri alım teklifinin piyasaya sürülmesinden yalnızca altı ay sonra elde edildiğini de sözlerine ekledi. VW, 12 Nisan 2017 tarihine kadar 238.000 araç üzerinde geri kiralanan veya feshedilmiş kiralamaları ve 6.200'ü tamir …

Devamını Oku »

Chassix, Çek Cumhuriyeti'nde 50 milyon dolarlık genişleme planlıyor

Genel Müdür Doug DelGrosso: "müşterilerimizin bize en çok ihtiyaç duyduğu yerlerin" tedarik edilmesi. ABD. Otomobil tedarikçisi Chassix Inc. 2018 yılı başında operasyonlarını Doğu Avrupa'ya genişletmek için 50 milyon dolar yatırım yapmayı planladığını açıkladı. Şirket, Çek Cumhuriyeti Ostrava'da binek otomobilleri için alüminyum şasi ve aktarma organları parçaları üretmek üzere 140.000 metrekarelik bir fabrika kurmayı planlıyor. Bu, Avrupa'daki ilk döküm fabrikası ve …

Devamını Oku »

Metanobaktiğin ve Bakır ile Bactanın Bağlantısı … Özet Methanobactins (mbs), düşük molekül ağırlıklı (<1,200 Da) bakır- Birçok metan oksitleyici bakteri (metanotrof) tarafından üretilen bağlayıcı peptidler veya chalkophores. Bu moleküller belirli demir bağlama sideroforlarına benzerlikler gösterir, ancak bakır sınırlamasına yanıt olarak eksprese edilir ve salgılanır. Yapısal olarak, mbs, bakır koordinasyon bölgesini oluşturan ilişkili tiyoamit gruplarına sahip bir çift heterosiklik halkayla karakterize edilir. Halkalardan biri her zaman bir oksazolondur ve ikinci halka bir oksazolon, bir imidazolon veya bir pirazindion parçasıdır. Mb molekülü, (i) halka oluşumu, (ii) bir lider peptid dizisinin bölünmesi ve (iii) bazı durumlarda bir sülfat grubunun eklenmesi de dahil olmak üzere bir dizi posttranslasyonel modifikasyona uğramış bir peptid öncüsünden kaynaklanmaktadır. İşlevsel olarak, mbs bakır alım sisteminin hücre dışı bileşenini temsil eder. Bakır alımındaki bu rolü ile tutarlı olarak, mbs bakır iyonları için yüksek afiniteye sahiptir. Bağlandıktan sonra, mbs hızla Cu 2+ 'i Cu 1+ e indirir. Bağlayıcı bağlamaya ek olarak, mbs çoğu geçiş metalini ve geçiş metaline yakın bağlar ve ana metanotrof yanı sıra diğer bakterileri toksik metallerden korur. Mbslere, başta redoks ve metal bağlayıcı özelliklerine dayanan diğer birçok fizyolojik fonksiyonlar atanmıştır. Bu derlemede, bu yeni metal bağlayıcı peptit tipinin mevcut durumunu inceliyoruz. Potansiyel uygulamalarını, mbslerin çoklu metallerin biyoyararlanımını nasıl değiştirebildiğini ve mbs'lerin metanotrofların fizyolojisinde nasıl oynayabileceğini de keşfediyoruz. GİRİŞ Methanobactins (mbs) ilk önce aerobik metan oksitleyici bakterilerde (metanotroflar) tanımlandı. Bu göze çarpan bakteri grubu, karbon ve enerjinin tek kaynağı olarak metan kullanarak büyüyebilir. Oksijen ve metanın bulunduğu ortamlarda bulunurlar ve biyosferde üretilen metanların çoğunun tüketilmesinde önemli bir rol oynarlar ve böylece küresel ısınmaya olan etkilerini azaltıyorlar (1, -4). Metanogenezis (5) yoluyla üretilen, ucuz, kolay bulunabilen ve yenilenebilir karbon kaynağı ile üretildikleri takdirde, metanotrofların toplu ve ince kimyasalların üretimi için ve çevre kirleticilerin biyolojik olarak temizlenmesinde önemli bir potansiyeli vardır (2, 6 , -8). Metan üzerinde yetişen bir bakterinin ilk raporu, 1906'da Hollanda'da Delft'te bulunan Beijerinck'in laboratuvarında çalışan Söhngen tarafından yapıldı; bu gaz, 1906'da Bacillus metanicus'un izolasyonunu Su bitkileri ve gölet suyu (9). 50 yıl sonra bu mikropun yeniden izole edildiği ve adı değiştirildi Pseudomonas metanica (10, 11). İkinci metanotrof, Metilokokus kapsülatus (Texas türü), 1966'da izole edildi (12). Methanotrof biyolojisindeki bir dönüm noktası, Whittenbury ve meslektaşları tarafından çeşitli karasal ve tatlı su ortamlarından izole edildiğinde ve metan üzerinde büyüyen 100 yeni aerobik metanotrofu anlatan 1970'de geldi (13). Daha sonra bu metanotrofların metan üzerinde yetişebilme yeteneği, karbon asimilasyonunun yolakları, istirahat evreleri (kistler ve sporlar) oluşumu, morfoloji, kompleks intrasitoplazmik zarın bulunduğuna dayanarak tip II'ye karşı tip II sınıflandırması geliştirdiler. Düzenlemeler ve DNA'ların mol yüzdeleri G + C içeriği. Daha sonra, Bowman ve meslektaşları çeşitli ortamlardan benzer sayıda metanotrof izole etti ve bunları Whittenbury ve meslektaşlarının programına ve 16S rRNA filogenezine (14, 15) göre sınıflandırdılar. O sırada hiçbir DNA sıralamasının yapılmamış olmasına rağmen, Whittenbury ve arkadaşlarının genel sınıflandırma şeması bugün metanotrofların gruplandırılmasında sağlam ve kullanışlı bir yöntem olmaya devam etmektedir. Buna göre şu anda 15 jenerat metanotrof bulunmaktadır Gammaproteobakteri sınıfının Methylococcaceae ve 3'ünde Methylothermaceae ailesi bulunmaktadır. Metilobakter Metilokaldum Metilokokus Metilogea Metiloglobulus Metilomagnum ] Metilomarinat Metilpomfurus Metilfosfamid Metilfosfat, Metilpomkarboksilik Asit Metanol, Metilokarboksilik Asit Metilpomkarboksilik Asit Metilpomkarboksilik Asit Metanol (19459016, Metilosarkin (19459016) ve Metilovüum ailesi metanotroflarıdır ve Metilohalobius Metilomarinovum , Ve Metiltermermus Metiltothermaceae familyasındaki metanotroflardır (16, -21, 227). Methylocystaceae familyasında ve Metilocella familyasında Alphaproteobacteria cins Methylosinus ve Methylocystis , Metiloferula ve Metilokapsa 'nın ailesi Beijerinkiaceae'de . Son 15 yılda, çoğul bileşiklerini büyüme için kullanabilen Metilokolella Metilokapsa ve Metilokistis cinslerinde fakültatif metanotroflara ilişkin raporlar artmaktadır Metan (22, -26). Günümüzde ayrıca, Crenothrix ve Clonothrix gibi diğer cinslerden filamentli metanotroflar ve yüksek sıcaklıklarda büyüyen ve düşük sıcaklıklarda yetişen cins Methylacidiphilum'un nonproteobakteriyel (verrucomicrobial) metanotrofları PH da yakınlarda keşfedilmiştir (27). Son olarak NC10 filumunun bir üyesi olan "Candidatus Metilomirabilis oksifizasyonu" zorunlu anaerob olmasına rağmen metan oksidasyonu için dioksijen ürettiğini gösterdi (28,29). Birlikte ele alındığında, bu veriler gezegenimizin birçok ekosisteminde metanotrofik bakterilerin yaygın doğasını açık bir şekilde göstermektedir. Metanotrofların fizyolojisi ve biyokimyası Metanotroflar metan'ı bir enerji kaynağı olarak kullanabilir ve ayrıca (6, 30, 31) için karbon sağlamaktır. Metanın metanole ilk oksidasyonu metan monooksigenaz enzim (MMO) tarafından katalize edilir. Aynı moleküler metan oksidasyon problemine (32, -37) evrimsel olarak bağımsız çözümler üreten MMO, membrana bağlı veya partikülat MMO (pMMO) ve sitoplazmik veya çözünür MMO (sMMO) olmak üzere iki yapısal ve biyokimyasal açıdan farklı formlar vardır . SMMO, aynı zamanda sınıf I ribonükleotid R2 alt-birimi için homolog olan çözünebilir di-demir monooksigenazlar (SDIMOs) (38) olarak bilinen geniş bir bakteri hidrokarbon oksijenaz grubuna ait olan üç komponentli bir bin nuclear demir aktif merkez monooksigenazdır Redüktaz. Methylococcus capsulatus (Bath) (39, -43) ve Methylosinus trichosporium OB3b (44, -47) 'den elde edilen iki çok benzer sMMO sistemi ayrıntılı olarak incelenmiştir. SMMO altı genli bir operon, mmoXYBZDC tarafından kodlanır ve üç bileşene sahiptir: (i) bir α-hidroksilazokinaz ile bir 250-kDa hidroksilaz (19459022) α alt birimlerinin (MmoX) substrat oksijenasyonunun meydana geldiği yerde çift çekirdekli demir aktif merkezini içerdiği yapı, (ii) flavin adenin dinükleotidli 39-kDa NAD (P) H bağımlı redüktaz (MmoC) FAD) ve Fe (19459022) 2 2 protez grupları ve (iii) protein B olarak bilinen bir 16-kDa bileşenini (MmoB) veya protez grupları içermeyen kuplaj / geçitlendirme proteini veya Metal iyonları (39, 48). Protein B için (39, 53, 54) hidroksilaz bileşeni (49, -52), nükleer manyetik rezonans (NMR) -tabutulan yapılar için X-ışını kristal yapıları vardır ve bu bileşiğin flavin alanı için bir NMR türetilmiş yapı vardır Redüktaz (55). Üç bileşen tarafından oluşturulan kompleks, küçük açı X-ışını saçılım analizi ve biyofiziksel olarak elektron paramanyetik rezonans spektroskopi, ultra-santrifüjleme ve kalorimetrik analiz ile yapısal olarak incelenmiştir (56, 57). SMMO'nun katalitik döngüsü kapsamlı bir şekilde incelenmiş ve çift-çekirdekli demir merkezindeki oksijen ve hidrokarbon aktivasyon mekanizmasının anlaşılmasına yönelik mükemmel ilerlemeler yapılmıştır (45) (45, 58, -62). Bununla birlikte, pMMO, bakır ve muhtemelen demir içeren membrana bağlı enzimdir (6, 37, 47, 63, 64). Tip I metanotroflardaki veziküler disklerin şeklini alan sıradışı intrasitoplazmik membranlar ve tip II organizmalarda eşleştirilmiş periferik tabakalar ile ilişkilidir (65, -75). İntrasitoplazmik membranlar pMMO'da zenginleştirilir ve sukroz yoğunluk gradyanlarında sedimantasyon hızı temelinde sitoplazmik membrandan fiziksel olarak ayrılabilir (76). PMMO'nun yapısı ve mekanizması hakkında bir anlayış, enzim çözünürken aktivite kaybından dolayı sMMO için olana göre daha yavaş ortaya çıkmıştır. PMMO, genler pmoCAB tarafından kodlanan yaklaşık 49, 27 ve 22 kDa'lık üç polipeptitten oluşur (77). Metanotroflarda genellikle bu pmo genlerinin birden fazla kopyası vardır (78, 79). Son yıllardaki araştırmalar, doğal pMMO'nun, hidroksilamin oksidoredüktaz ve amonyak monooksigenaz redoks çiftleri (82, -85) için bulunana benzer şekilde, pMMO'ya elektronlar (80, 81) sağlayabilecek metanol dehidrojenazı (MeDH) ile kompleks oluşturduğunu göstermiştir ). Bazı metanotroflar, mesela M. Kapsülatus (Banyo) ve M. Trichosporium OB3b, her iki MMO formunu üretebilir. En bilinen metanotroflar yalnızca pMMO'ya sahiptir, örneğin Metilomonas metanika Metilomikrobiyum album BG8, Metilokistis parvus OBBP ve verrukomikrobik ve NC10 metanotroflar. Beijerinckiaceae ailesindeki, örneğin Metilasella silvestris ve Metiloferula stellata içindeki sadece birkaç metanotrofun sMMO'ya sahip olduğu, ancak pMMO'ya sahip olmadığı (21, 86) MMO tarafından üretilen metanol, bir kalsiyum veya nadir toprak bağımlı pirroloquinoline quinone (PQQ) içeren MeDH (87, -91) ile formaldehite oksitlenir. Formaldehit, metanotrofik metabolizmanın metabolizmasının önemli bir koludur ve bir karbon (C 1 ara ürününün enerji elde etmek için CO 2'ye oksitlenebildiği veya asimile edildiği noktayı temsil eder Biyokütleye dönüştürdü. Formaldehid toksik olduğundan, metanotroflar bu metabolik ara maddenin birikimine karşı kendilerini korumalıdırlar. Formaldehit metabolizması için çoklu yollar metanotroflarda bulunur (2, 26, 92, -96). Örneğin, formaldehitin oksidatif dissimilasyonu, boya bağlı membrana bağlı (93) yoluyla ya da NAD + yoluyla tetrahidrometanopterine (H 4) [97,98] konjügasyonuyla ortaya çıkabilir ] Bağımlı (95, 96, 99) formaldehit dehidrogenazlar. Formül, formaldehidin formaldehit dehidrogenazlar tarafından oksidasyonundan kaynaklanır ve daha sonra metan, biyosentetik reaksiyonlar ve enerjinin oksidasyonu için NADH üreten bir NAD + [bağımlıformatdihidrojenazilekarbondioksit'eoksitlenirHücreiçinesil(100-102)Metanotroflaraynızamandaalfaproteobakteriyelvegammaproteobakteriyelmetanotroflardaaktifolanformaldehitinbiyokütleyeserinveribulozmonofosfat(RuMP)döngülerinefiksasyonuiçinikiyolasahiptirMetanotroflardakikarbonfiksasyonyolaklarıkapsamlıolarakgözdengeçirildi(bkzÖrneğinreferans6) Metanotroflardaki "Bakır Anahtar" Metan karakterizasyonu için erken teşebbüsler MMO'nun hücresel konumu hakkında farklı raporlar vasıtasıyla oksidasyon karmaşıktı. MMO'lar, suşuna ve bazı suşlar için raporlama laboratuvarına bağlı olarak çözünebilir veya membran ile ilişkili olarak tanımlanmıştır. Çeşitli gruplar başlangıçta partikül veya zar fraksiyonunda aktivite bildirdiler (103, 104), buna karşılık diğer gruplar çözünür fraksiyonda aktivite saptamıştı (105, 106). Sonraki çalışmalar hücresel konumun ekim koşullarına göre değiştiğini gösterdi. Oksijen kısıtlamasının çözünür fraksiyonda metan oksidasyonunu indüklediği bildirildi M. Trikosporium OB3b (36, 107). Bununla birlikte, oksijenin düzenleyici faktör olmadığı ve membrana bağlı ve çözünen aktiviteler arasındaki geçişin biyokütle konsantrasyonuyla ilişkili olduğu gösterildi (108). Bu "geçiş" in keşfedilmesinde tanımlayıcı an, Dalton ve meslektaşlarının M büyümeye çalıştıkları zamandı. Parvus OBBP, kemostat kültüründe yüksek hücre yoğunluklarına. M. Parvus OBBP, nispeten düşük hücre yoğunluklarında metan, hava ve nitrat mineral tuzları (NMS) çözeltisiyle birlikte verildiğinde büyümeyi durdurdu. Bununla birlikte, ek eser element çözümü eklendiğinde, kültürler derhal büyümeye başladı. İz element solüsyonundaki "gizli içerik", bakır iyonlarına indirgenmiştir (108). Daha sonra, M. Parvus OBBP, yalnızca bakır iyonlarına yüksek gereksinim getiren pMMO içeriyordu ve M ile o sırada gözlenen aynı yüksek hücre yoğunluklarına ulaşmasına izin verecek bir sMMO içermiyordu. Kapsülatus Banyo ve M. Trichosporium OB3b, bakır sınırlaması altında. Aynı suşlarla karşı karşıya kalındığında, suşlar sMMO'nun ifadesine geçti ve büyümeyi sürdürdü (35, 109). İlginç bir şekilde, bakırın daha önce sMMO içermeyen metanotrof olan Methanomonas margaritae 'nın büyümesini arttırdığı gösterildi, ancak bu orijinal gözlemler hiçbir zaman daha fazla araştırılmadı (110) Dalton ve arkadaşları Gözlemlerini detaylı bir şekilde incelediler ve bu "bakır geçiş" in varlığını kurdular, yani, iki farklı MMO formunun, hem sMMO hem de sMMO'ya sahip olan metanotrof kültürlerinin bakır-to-biyokütle oranına yanıt olarak metanotroflardaki ifadesinin düzenlenmesi PMMO. Metanotrofların metal bağımlı büyümesi üzerine daha önceki gözlemlerin birçoğunu açıklamalarını sağladı. Örneğin, M. Kapsülatus Banyo, sMMO'nun ekspresyonu yalnızca ortamdaki bakır iyonları tükendiğinde yüksek hücre yoğunluklarında gözlemlenirken, fazla bakır iyonlarının ilavesi bu metanotrofun aktif pMMO'yu ifade etmesine izin vermiştir. Daha sonra, Murrell ve meslektaşları moleküler seviyede, düşük konsantrasyonlarda bakır iyonlarıyla büyümenin altında sMMO ifadesi, sMMO gen kümesinin yukarı akışında σ 54 promotöründe başlatıldığını gösterdi ( mmoXYBZDC ). Tersine, yüksek bakır büyüme koşulları altında, sMMO ekspresyonu bastırılmış ve pMMO kodlayan genlerin yüksek seviyelerde ekspresyonu ( pmoCAB ) her ikisine de izin vermiştir. Trichosporium OB3b ve M. Kapsülatus Banyo, pMMO (34, 111, -113) kullanılarak büyüyecektir. Daha ileri araştırmalar bakırın metanotrofik fizyolojiyi ve gen ifadesini daha geniş ölçüde etkilediğini ortaya koymuştur. Örneğin, metanotroflardaki intrasitoplazmik zar içeriğinin büyüme ortamında bakır arttıkça arttığı bulundu (66, 109, 114). Bununla birlikte, bu tamamen beklenmedik değildi: pMMO'nun intrasitoplazmik zarlarda lokalize olduğu göz önüne alındığında, pMMO'nun daha fazla ekspresyonu ve aktivitesi bu zarların mantıksal olarak daha fazlasını gerektirir. Bununla birlikte, daha şaşırtıcı bir şekilde, pMMO'nun ve mxa operon tarafından kodlanan PQQ'ya bağlı MeDH'nin, intrasitoplazmik membranlara sabitlenmiş bir süper kompleks oluşturduğunu ve elektronun, PQQ-bağlantılı MeDH'den pMMO'ya In vivo metan oksidasyonunu tetikleyebilir (80,81). Son bulguyu destekleyerek yakın zamanda, pmo genlerinin ekspresyonu arttıkça arttığını değil, mxa operonundaki genlerin çoğunun da arttığını bulduk ) Proteomik yöntemle, metanın karbondioksit ile oksitlenmesindeki ilave basamaklar, lipid, hücre duvarı ve membran sentezinde rol oynayan proteinler gibi bakır kullanımının artmasıyla aşırı eksprese edildiği de gösterilmiştir ( 66, 115). Tersine, metanotrofların karbonu metandan poli-3-hidroksibutirat'a yöneltme yeteneği, bakırın bulunabilirliğini azaltarak artar (66, 116), bu da metanotrofların enerji metabolizmasının bakır tarafından kontrol edildiğini düşündürmektedir. Böyle bir sonuca Dalton ve arkadaşları daha önce ulaşmıştı ki metanotroflardaki metanotroflardaki biyolojik kütle verimi ve karbon dönüşüm etkinliği, bakır arttıkça, yani metanotroflar sMMO ifade ederek pMMO'yu ifade etmeye geçtiğinde (117) arttığını gösteriyordu. Dış zarın dış yüzeyindeki "yüzeysel" veya proteinler, bazı metanotroflarda bakır bulunması ile de kontrol edilir. Bakır alımına dahil olduğuna inanılan çok sayıda çoklu sitokrom ve proteinin ifadesi de bakırın bulunabilirliği arttıkça değişir ve çoğu durumda azalır (118, -123). Metanotrofların bakırı nasıl tuttuğu üzerine ilave bilgiler, yeni bir bakır depolama proteini ailesinin Csps'in keşfedilmesiyle sağlandı . Trikosporyum OB3b (124). Bu metanotrof, üç Csp'ye sahiptir: Csp1 ve Csp2, ikiz arginin translokaz hedefleme sinyal peptidlerini öngörmüşlerdir ve bu nedenle katlanmanın ardından sitosolik Csp3'den sonra ihraç edildiği düşünülmektedir. Csp1, paketin çekirdeğini gösteren Cys kalıntıları vasıtasıyla 52 Cu 1+ iyonuna kadar bağlanabilen dört heliks demetinin bir tetramerini oluşturur. SMMO'ya geçiş, vahşi türe göre, Δ csp1 csp2 mutantında hızlandırılmış olup, bu proteinlerin pMMO için bakır depolamada rol oynadığını ve bakır sınırlandığında bir dahili bakır kaynağı temin ettiğini düşündürmektedir. Bu koşullar altında, tüm Cu 1+ 'i Cspl'den kolayca kaldırabilen ve dolayısıyla Csp1 bağlı bakırın kullanılmasına yardımcı olan bir rol oynayabilecek mb üretilmektedir. ] Bir bakıra özgü alım sistemi öneren kanıtlar Bakır özgül alım sistemi ve hücre dışı bir bakır bağlama ligandının üretilmesi için ilk kanıt, yapıcı sMMO mutantlarının (sMMO ) fenotipik karakterizasyonu sırasında ortaya çıktı. C ) M. Trikosporyum [1958016] OB3b (125, 126). Phelps ve ark. (126), beş sMMO C mutantını M kültürleyerek izole etti. Trikosporium diklorometan mevcudiyetinde OB3b, metan monooksigenaz ile formetil klorüre dönüşümü için kometabolik dönüşümü takiben bir mutajen olarak işlev görür. SMMO C fenotipine ek olarak, sMMO mutantları bakır alımında kusurluydı (125, 127, 128). Kültür ortamında çözünür olmayan bakır karşısında sert bir artış da gözlendi ve Fe'ye benzer bir ekstraselüler Cu 2+ kompleks yapıcı ajan (lar) üretimine ilişkin spekülasyonlar teşvik edildi Fe 3+ Komplike siderophores (127). Sonraki çalışmalar düşük molekül kütleli bir bakır bağlama ligandının varlığını ortaya çıkarmıştır, ancak bu bileşiğin kimliğini belirlememişti (125, 127). Methanobactin'in İlk Tanımlanması ve İzolasyonu (Bir Bakır Bağlayıcı Bileşik veya "Chalkophore") Biraz paradoksal olarak, "bakır bağlayıcı ligand" veya "bakır bağlayıcı bileşik" önce M'den izole edildi. Kapsülat pMMO'nun arıtılması sırasında ve dolayısıyla yüksek bakır konsantrasyonlarında (73) banyo. Bu bakır bağlayıcı bileşiğin pMMO'dan ayrılması, düşük molekül ağırlıklı bir sarı-flüoresan bakır ihtiva eden molekülü ortaya çıkarmıştır. Bu molekülün renk ve flüoresan özellikleri, düşük bakır ortamda kültürlenen hücrelerde görülen suda çözünebilen pigmentinkine benzerdi (73). Bu suda çözünür pigmentin karakterizasyonu, pMMO ile birleşmiş bakır bağlayıcı bileşik ile özdeş olduğu ortaya çıktı (73, 128). Methanotroflarla suda çözünen pigmentlerin üretimi, birçok tip suşun ilk izolasyonu sırasında 40 yıl önce kaydedildi ancak düşük demirli ortamda kültürlenen hücrelerle ilişkilendirildi (13). Bakır bağlayıcı bileşik, molekülün Gram pozitif bakterilere karşı antimikrobiyal etkinliğine dayanılarak sonuçta metanobaktin (mb) olarak adlandırıldı (129, 130). Tanımlandıktan sonra, bu bakır bağlama bileşiği, bir dizi farklı metanotrofda izole edildi veya tanımlandı; bunlara aşağıdakileri içeren metil bromür albumin BG8 (131), Metiloksisit soyu SB2 (132), Metiloksisit (133), (197) Methylocystis hirsuta Methylocystis M türü (133) CSC1 (133) ve (suş SV97). Mb'lerin kristal yapıları M. Trichosporium [1358.016] OB3b (134,135), M. Hirsuta CSC1 (133) ve Metiloksisit suşu M (133) saptanmıştır. Ayrıca, Methylocystis suşu SB2 (132) ve Mbr'lerin kimyasal yapıları. Rosea (133) çıkarıldı. Bu yorum farazi mbs sıralı genomları ile Methanotroph anlaşılabilir sağladı bu mbs üzerinde durulacak. Methanobactins olarak Chalkophores İşlevsel olarak, mbs siderofor benzer. Sideroforlarda olduğu gibi, düşük bakır koşullarında (125, 126, 128, 136, -138) bakteriler tarafından üretilen düşük moleküler kütleli (<1,200-Da) bileşiklerdir. Yunancadan demir taşıyan ya da demir taşıyan siderophores'in adlandırılmasından sonra, mbsler chalkophores (bakır taşıyan ya da bakır taşıyan) (134, 139). Mbs şu anda bu grubun bilinen tek temsilcisi. Bir bakır alım sisteminin hücre dışı bileşeni rolü ile tutarlı olarak, mbs bakır iyonları için bilinen en yüksek bağlanma afinitelerine sahiptir (2, 131, 135, 138, 140, 141) (19459000) mb'lerin metal bağlayıcı afiniteleri ( K ). [PubMed] TABLO 1 "başlık =" Tablo 1 "/> Trikosporium Metil sistein M türü Methylocystis hirsuta methylcystis CSC1, Metilkistis Methylocystis rosea ve Methylocystis streyn SB2 bir Her ne kadar chalkophores ve siderofor Bir dizi özellik paylaştığında, bu iki metal bağlayıcı bileşik grubu çeşitli şekillerde ayrılabilir. Fitoziderofor domoik asit (142) haricinde, sideroforlar demir sınırlaması altında eksprese edilirken, chalkophores bakır sınırlaması altında eksprese edilir. Birçok siderofor bakır bağlar ve chalkophores demir bağlayabilir (142, -148); Bununla birlikte, farklı metal bağlama sabitleri iki grubu karakterize eder ve bu farka göre ayırt etmek için kolorimetrik analizler geliştirilmiştir (138, 149, 150). Yapısal olarak chalkophores, tipik heterosiklik halkalar ve ilişkili tiyoamit grupları (ve) ile siderophores'den farklıdır. Farklı halka sistemleri, molekülün metal bağlama özelliklerini (131, 133, -136, 138, 148, 151) tanımlamak ve karakterize etmek için kullanılabilen karakteristik UV-görünür emiş, dairesel dikroizm (CD) ve floresan spektral özelliklere sahiptir , -153). Uyarılma enerjisi transferi, ışık toplama komplekslerinin (155, -157) kromoforları için gözlemlendiği gibi mb'deki (136, 154) iki halka arasında meydana gelir ve bu da mbs'nin floresan özelliklerine neden olur. Örneğin, mbs emisyon yoğunluğu halkalardan birinin seçici hidrolizi ile artmakta ve metal eklenmesinin ardından emisyon yoğunluğu sıklıkla artmaktadır (132, 136, -138, 141, 148, 154). Yine, bu özellik hem mbs tanımlamada hem de karakterizasyonu için kullanılabilir Tam uzunlukta mb-OB3b'nin (135 (133) (C), mb- (133) (D) ve mb-SB2 (132) (A), mb- (E). yıldızlarla hepsini olmasa da bazı örneklerde görülmektedir ile Amino asitler işaretlenmiş. ve Çekirdek özellikleri Mbs. AA, amino asit (ler). R grupları Arg, Ile, Met veya Pro olabilir Ancak, açıklanan özelliklerin tamamı mbs'leri tanımlamak için yeterli değildir. Örneğin, Clostridium cellulolyticum mbs'lere (158, -160) benzer bir molekül kütlesi olan bir bakır bağlayıcı sekonder metabolit olan klosthioamid üretir ve benzer mbs'ler, closthioamid tiyoamid gruplarına sahiptir, Cu 2 + ila Cu 1+ 2+ 1+ 1+ 1+ ). Closthioamine ayrıca mb üretimini taramak için kullanılan sıvı veya plaka bir analiz olan bakır-krom azural S (Cu-CAS) tahliliyle pozitif çıkacaktır (138, 149, 161). Bununla birlikte, klosthioamid spektroskopik olarak mbs'den ayırt edilebilir; Örneğin, klostihoamid, altı tiyoamit kısmı ile ayrılmış iki karakteristik fenolik grubundan kaynaklanan, 270 nm'de maksimum tek bir UV-görünür emme mukavemeti gösterir. Dahası, klostihoamit bir dinükleer Cu 1+ kompleksi oluşturabilmektedir. Ayrıca, mbs'lerin aksine, klostihoamid sentezi bakır tarafından düzenlenmez ve mbs'nin aksine, molekülün bir poliketit sintazı ile üretildiğine inanılır (aşağıya bakınız). Benzer şekilde, düşük bakır koşullarında , Paraküs denitrifikalılar aynı zamanda, bakır alımında rol alan düşük molekül ağırlıklı bir 716.18-Da porfirin, kopoporfirin III üretirler (162). Ne yazık ki, ilk yayında bakır bağlanma özellikleri bildirilmemiştir ve herhangi bir takip çalışmalarının farkında değiliz. Coproporphyrin III, tipik bir heme UV-görünür emilim spektrumuna sahiptir ve heme grubu tarafından koordine edilen metale bağlı olarak farklı γ, α ve β maksimumlarını gösterir ve bu mülke dayanan mbs'den ayırt edilmesini sağlar. METAL BAĞLAYICI ÖZELLİKLERİ Bağlama ve İlköğretim Metal indirgenmesi, Bakır mb bağlayan hem Cu 2+ ve Cu 1+ ve mb ile bağlanma pH'ya (135, 172) ve Cu 2+ / Cu'ya 1 + ila mb'ye 136, 141, 172) (). Aşağıda tartışıldığı gibi, mb Cu 1+ ve Cu 2+ 'in çözünür ve çözünmez formlarını kompleks yapabilir. Mb-OB3b ve mb-SB2'ye (136, 141) Cu 2+ ilavesi üzerine termodinamik, spektral ve kinetik çalışmalar yürütülmüştür. Bu çalışmalar (136, 141, 172) mb'nin hızla Cu 2+ 'i Cu 1+ ' e indirgemesi ile karmaşıktır. Cu 2+ 'in apo-mbs'ye eklendiği deneyler için yüksek bağlanma sabitinden sorumlu bakırın oksidasyon durumu bilinmediğinden, bu oksidasyon durumlarının bir karışımının, "Cu 2+ / Cu 1+ " Bu noktadan itibaren. Cu düşük oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b başlangıçta Cu 2+ / Cu 1+ [bağlar oligomer / tetramer olarak (136, 141). Kararlı halden önceki kinetik veriler, metalin ilk bağlanmasının yalnızca halkaların birinde ve buna bağlı tiyoamid üzerinde olduğunu göstermektedir. Mb-OB3b'de başlangıç ​​Cu 2+ / Cu 1+ koordinasyonu oksazolon A'ya ve ardından kısa (8 ila 10 ms) gecikme periyoduna ve daha sonra Oksazolon B (141). Cu yüksek oranlarda 2+ / Cu 1+ mb-OB3b için, mb-OB3b 2+ / Cu 1+ [19459008Cukoordinatları]Bir dimer olarak dimer olarak eklenir ve bunu takiben, mb-OB3b için 0.5 Cu'nin üzerinde 2+ / Cu 1+ ila-mb- OB3b. Mb-SB2, bakır-mb oranına bağlı olarak benzer bir tetramer-dimer-monomer bağlanma dizisini izlemektedir. Mb-SB2 için, Cu 2+ / Cu 1+ 'in ilk bağlanması imidazolon halkasına ve bunu takiben oksazolon halkasına (154) koordine edilir.

Mbs () için metal bağlanma afinite sabitlerini belirlemek için çeşitli yöntemler kullanılmıştır. Cu için afiniteler 1+ banyookuproin disülfonat gibi kromoforik ligand ile iyi kurulmuş bir yaklaşımı (173, -175) kullanarak rekabet çalışmaları ile belirlenebilir. Cu-mb'nin indirgeme potansiyeli ölçümü, daha sonra Cu 2+ afinitesinin hesaplanmasını sağlar. Bu yaklaşımı (133, 135) kullanarak analiz edilen tüm mbsler için Cu 1+ afinitesi ~ 10 M …

Devamını Oku »

Yirmilerinde Yanınızda Olabileceğiniz 50 Kilometre Taşı …

unsplash.com 1. Kendinizi esin kaynağı, desteklenen, meydan okuyan, ilgilenilen ve sevilen iş arkadaşları, arkadaşları ve aileleri ile kendinizi çevreleyin. 2. Nihayetinde istediğiniz şeyi sormaktan hoşnut olduğunuz bir noktaya ulaşıyorsunuz (bunu hak ettiğinizi biliyorsanız). 3. Yalnız zamanınızı nasıl seveceğinizi bulmak ve bazı hobileri geliştirmek, iyi kitaplar toplamak ve birlikte olmamak için iyi (ve sağlıklı) olduğunu anlamakla kendi başınıza harcayacağınız anları nasıl …

Devamını Oku »

50 Awesome Truths Ablam Dyin'den Önce Yazdı …

1996'da liseden mezun olduktan kısa süre sonra ablam Celine, arkadaşlarının her birine kendi el yazısıyla hazırladığı bir kitapçık verdi. 18 yaşına kadar öğrenildi. Bu tür bir DIY mezuniyet hediyesi oldu. Kızkardeşler olarak çok şey paylaştık ama bu kitapçık, Céline'ın 30 yaşındayken 2009 yılının ilkbaharında ölümünün oluşumunun farkında değildim. Cenaze töreninde Celine'in en yakın arkadaşlarından biri bana nazik bir surette bir …

Devamını Oku »

Geçici Öğretmen Alımı Duyurusu Yayımlandı Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonlarının Desteklenmesi Projesi Geçen Süreli Öğretici ve Rehberlik Danışman Alımına İlişkin Duyuru 2014/21 Sayılı Genelge çerçevesinde Valiliklerin Bünyesinde Kurulan Geçici Eğitim Merkezlerinde (GEM) ve Bakanlığımıza bağlı okullarda öğrenim gören Geçici Koruma Kanunu kapsamındadır Suriyeli öğrencilere Türkçe Öğretmen ve öğretmenlik yapmak rehberlik hizmetlerini geliştirir "Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonunun Desteklenmesi Projesi" (RESİM) kapsamında Ek-1 tabloda belirtilen Bu duyuru Millî Eğitim Bakanlığı "Öğretmen Alım Duyurusu" değil. Birleşmiş Milletler Genel Sekreteri Prof. Dr. Bakanlığımızca yapılan Öğretmen alımı bittiğinde 657 sayılı Devlet Memurları Kanunu Kapsamında atamalarıdır; Atama yapılmadığı için sözleşmeleri proje idaresi tarafından feshedilerek Bakanlığımızda görevlerine başlayabileceklerdir. 1. Genel Müdürlük: Hayat Boyu Öğrenme Genel Müdürlüğünü, İdare: Suriyeli Çocuklarının Türk Eğitim Sistemine Entegrasyon Desteklenmesi Projesi Proje Yönetim Merkezi Proje / RESİMLER: Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyon Desteklenmesi Projesi Geçici Süreli Öğretici: Proje kapsamında geçici koruma altındaki Suriyeli öğrencilere eğitim kurumlarında Türkçe Rehberlik Danışmanı: Proje kapsamında geçici koruma altındaki Suriyeli öğrencilere eğitim kurumlarında Rehberlik sunmak. ] GEM : Geçici Eğitim Merkezi 2. a) Türkiye Cumhuriyeti vatandaşı olmak b) Kamu hakları mahrum bulunmamak, C) Türk Ceza Kanunu'nun 53'üncü maddesinde belirtilen süreler geçmiş olsa bile; Kasten işlenmiş bir suçtan biri bir ya da daha fazla süreyle hapis cezasına ya da affa uğramış olsa bile devletin güvenliğine karşı suçlar, Anayasal düzene ve bu düzenin işleyişine karşı suçlar, millî savunmaya karşı suçlar, devlet sırlarına karşı suçlar ve casusluk, zimmet, irtikâp, rüşvet d) Askerlik hizmetleriini, d) Askerlik servisini kullanıyor musunuz? e) Güvenlik soruşturması olumlu sonuçlanmak, f) 28 Şubat 2017 tarihi itibariyle 40 yaşından gün almamış olmak. 3. ÖZEL ŞARTLAR 3.1. Geçici Süreli Türkçe Öğreticiler: 3.1.1 Üniversitelerin dört yıllık lisans öğretimi yapan Eğitim Fakültelerinin Sınıf Öğretmenliği veya Türkçe Öğretmenliği alanına mezunu ya da öğretmenliğe kaynak teşkil eden yükseköğretim programlarından mezun olanların ihtiyacı karşılamadığı alanlarda Ortaöğretim Alan Öğretmenliği Tezsiz Yüksek Lisans ya da Pedagojik Formasyon Programı / Pedagojik Formasyon Eğitimi Sertifika Programından birini başarıyla tamamlamış olmak, 3.1.2. 3.1.3. Yükseköğretim kurumlarının veya programlarının denkliği kabul edilmiş olmak, 2016 yılı Kamu Kişisel Seçme Sınavına geçici olarak görevlendirileceği alan için KPSS-P121 puan çeşidi açısından 50 ve üzerinde puan almış olmak, 3.1.4 3.1.5. Birleşmiş Milletler Genel Sekreteri 3.1.6. Birleşmiş Milletler Genel Sekreteri Birliği, Genel Sekreterlik Sekreteri, FETÖ / PDY veya herhangi bir bölücü terör örgütleri ile ilgili olarak yapılan soruşturmalarda yer almamak, adli veya idari ceza almamış olmak, özel eğitim kurumlarından çalışanlardan Lisansı iptal yaptırılmamış olmak, KHK cezası ile ihraç edilmemiş olmak veya herhangi birisi disiplin soruşturması sonucu ile suç problemi ceza almamış Olmak, 3.1.7. 3.2. Bir vatandaş olmamak; Geçici Süreli Rehberlik Danışmanları 3.2.1. (*) Mezunu olması gerekmektedir. (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK) (*)) (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK)) Bu ders sadece Türkçe'ye çevrilmiştir. ) 3.2.2. İş Yükü Açıklaması / Açılacak olan Ortaöğretim Alan Öğretmenliği Sertifika Programını başarı ile tamamlayanlar) 3.2.2 Yurt dışındaki yükseköğretim kurumlarından mezun olanların, Yükseköğretim Kurulu Başkanlıklarının yüksek öğrenimlerinin ve / veya pedagojik formasyonun yükseköğretim kurumlarına veya programlarının denkliği kabul edilmiş olması, 3.2.3. 2016 yılı Kamu Kişisel Seçme Sınavı geçici süreli görevlendirileceği alan için KPSSP121 puan çeşidi açısından 50 ve üzerinde puan almış olmak, 3.2.4 3.2.5. Birleşmiş Milletler Genel Sekreteri 657 sayılı Kanunun 4 / B maddesi sözleşmeli olarak çalışmakta iken sözleşmeleri feshedilenler bakımından, başvuru tarihinin son günü başlığında bir yıl bekleme süresini tamamlamış olmak, 3.2.6. FETÖ / PDY veya herhangi bir bölücü terör örgütleri ile ilgili olarak yapılan soruşturmalarda yer almamak, adli veya idari ceza almamış olmak, özel eğitim kurumlarından çalışanlardan Lisansı iptal yaptırılmamış olmak, KHK cezası ile ihraç edilmemiş olmak veya herhangi birisi disiplin soruşturması sonucu ile suç problemi ceza almamış Olmak, 3.2.7. 4. Bir vatandaş olmamak, 4. İŞİN NİTELİĞİ: 4.1. Projenin yürütüldüğü Suriyeli öğrencilerin bulunduğu 23 il ve ilçelerdeki kurumlarda Türkçe öğretmek, 4.2. Projenin yürütüldüğü Suriyeli öğrencilerin bulunduğu yerde 23 il ve ilçelerdeki kurumlar rehberlik amaçlı, 5. GEÇİCİ SÜRELİ EĞİTİM PERSONELİNİ İLİŞKİN HUSUSLAR: 5.1. Geçici İngilizce Öğretmenlik görevlendirilmesinde Sınıf Öğretmenliği veya Türkçe Öğretmenliği Mezunu olmak gerekirlidir. Geçici Zaman Rehberlik Danışmanı görevlendirilmesinde Rehberlik ve Psikoloji Danışmanlık Bölümü / Anabilim Dalı, Eğitimde Psikolojik Hizmetler Bölümü / Anabilim Dalı veya Psikoloji Bölümü (*) mezunu olması gerekmektedir. (*) (Bakanlık ve Yükseköğretim Kurulu (YÖK) iş birliği 5.2. Yüksek Lisans veya Yüksek Öğrenim Formülasyon Programında başarı ile tamamlayanlar) 5.2. 5.3. Sözleşme süresi 1 yıl olup, 4857 sayılı İş Kanunu için sözleşme imzalanacaktır. Geçici olarak görevlendirilecek Türkçe Öğreticiler ve Rehberlik Danışmanları okullarda / kurumlarda haftada 35 saate kadar derse girecek veya çalışacaktır. 5.4. Geçici olarak görevlendirildi. ]] 6. İSTENEN BELGELER 6.1. Elektronik Başvuru Formunda beyan alınacaktır. İsteğe Bağlı Değil, Elektronik Başvuru Formunda beyan alınacaktır. Adli Sicil Belgesi İkametgâh Belgesi Nüfus Cüzdan Fotokopisi (Aslı ibraz edilir.) Mezuniyet Belgesi'nin Fotokopisi (19459010) Askerlik Başvurusu Askerlik Durum Belgesi KPSS sonuç belgesi 7. BAŞVURU 7.1. Başvuru tarihi: 27 Şubat-03 Mart 2017 Başvurular 03 Mart 2017 tarih mesai bitimine kadar (www.meb.gov.tr) (http://pictes.meb.gov.tr) /) (Http://hbogm.meb.gov.tr/) fiyatında yapılacak. 7.2. Adaylar, 3 farklı internet sitesinden başvurabilirler: Milli Eğitim Bakanlığı (www.meb) .gov.tr) Hayat Boyu Öğrenme Genel Müdürlüğü (http://hbogm.meb.gov.tr) Proje Merkez Yönetimi (http://pictes.meb.gov.tr) /) Internet sitesinden başvuru formunu doldurup onaylayacaklardır. Başvuru belgesinin 2 sayısı çıktısını alarak kaldırmak için İl / İlçe Milli Eğitim Müdürlüklerinin Eğitim ve Öğretim Görevlisi Atama Birimine öğrenim belgesi ya da diplomanın aslı veya onaylı birer örneği ile birlikte son başvuru günü mesai bitimine kadar başvurularını şahsen onaylatacaklardır. Başvuru ilan koşulları sağlamayan veya zamanında yapılmayan başvurular kesinlikle kabul edilmeyecektir. 8. SÖZLÜ SINAV 8.1. Geçici Öğretmenlik ve Rehberlik Danışmanlığı için başvuran adaylara başvurusu kabul edenler kontenjan sayısının iki katına kadar sözlü sınava alınacaktır. 8.2. 8.3. Yazan: Sözlü sınavda Geçici Süreli Öğretici ve Rehberlik Danışman adayları bir konuyu kavrayıp özetleme, ifade yeteneği ve muhakeme gücü; 8.4 İletişim büroları, iletişim ve iletişim kuralları, bilimsel ve teknik gelişmelere açıklık, Kontenjan sayısı kadar yedek aday belirlenecektir. 8.5. 8.6. Geçici Süreli Öğretici ve Rehberlik Danışmanları için sözlü sınav, MEB Ölçme Değerlendirme ve Sınav Hizmetleri Genel Müdürlüğünse yaptırılacak. 28.11.2016 tarihinde Hayat Boyu Öğrenme Genel Müdürlüğü internet sitesinde yedekten yerleştirilen ancak göreve başlayacak öğretici adayları, yeniden başvuru yapmaları halinde sözlü sınavından muaf tutulacaklardır. Tescil kendi sayfanı oluştur yeminli sözlük nedir? Bu İlanlar Daha Fazla Ögrenin Ortalamam Yapılsın mı? 8.7. Türkçe [English] [English] [tr] Kaydolun anketi yazan insanlara e- 9. DUYURU VE SÖZLEŞMEYE DAVET 9.1. Sözlü sınav sonuçları, sınav bitimi müteakiben 3 iş günü içinde http://pictes.meb.gov.tr ​​internet siteleri İlan Edilecektir. 9.2. Sözlü sınavlar [Sözleşmeyedavetedilensözlüsınavdabaşarılıolmasırasınagöreyapılacaktır 9.3. En çok satılanlar, kontenjan sayısı kadar Geçerli Süreli Öğretici ve Rehberlik Danışman adayları davet edilecektir. Sonuçların ilanından sonra Ek-2 Takvimde yazarların görüşlerine başlayacak öğreticiler / rehberlik danışmanları ile proje merkezi yönetimi arasında sözleşme imzalanacaktır. Söz konusu sözleşmeyi imzalamaya gelmeyen adayların yerine yedek adaylar sırasıyla davet edilecektir. 1. Sağlık Kurul Raporu 2. SGK İşe Giriş Belgesi 3. 4 adet vesikalık 4. 10. 10.1. Geçici Olarak görevlendirilen Yazin öğretmenlerin maaşları "Suriyeli Çocukların Türk Eğitim Sistemine Entegrasyonunun Desteklenmesi Projesi" Kapsamında karşılanacaktır. 11. Diğer Hususlar 11.1 . 11.2. Sözleşme imzalandıktan sonra, işe alınma açısından gerekli niteliklerden kaçınılmalıdır. 11.3 Gerçeğe aykırı beyanda bulunanlar hakkında hukuki işlem yapılacaktır. 11.4. İlan metninde belirtilen hususlar, ilgili mevzuat hükümlerine göre işlem yapılacaktır. İş bulma tekniği şartname 11 maddeden ve alt arasında değişen oluşmaktadır. EK-1 Suriyeli Çocukların Türk Eğitim SİSTEMİNE ENTEGRASYONUNUN DESTEKLENMESİ PROJESİ Kapsamında alınacak GEÇİCİ Süreli EĞİTİM PERSONELİ KONTENJANLARI

İL ADI Kaynak

Devamını Oku »

Mercedes-AMG, Çarpıcı Özel Sürümlerle 50 Yılını Kutladı »AutoGuide.com News

Mercedes-AMG GT C Roadster Edition 50, yalnızca 500 ünite ile sınırlı olacaktır. Alman otomobil üreticisi, AMG GT C Roadster Edition 50'den başlayarak 50. yıldönümünü kutlamak için üç özel model kullanıyor. Dünyadaki 500 üniteden yalnızca 50 kişi ABD'ye geliyor olacak. Dış cephede, Cabrio'da Spor otomobil, designo Grafit Gri Magno'da özel bir boya finisaja sahiptir. Benzersiz bir görünüm vermeye yardımcı olması, ızgaranın …

Devamını Oku »

Tubercu'nun Küresel Epidemiyolojisi … Etkili kemoterapinin varlığına rağmen, tüberküloz (TB) 2012'de 1.3 milyon insanı öldürdü. HIV ile birlikte, Enfeksiyöz bir hastalığın ölüm nedeninin başında gelir. TBC'nin epidemiyolojik yükünün azaltılması için küresel hedefler, Binyıl Kalkınma Hedefleri (Binyıl Kalkınma Hedefleri) ve Stop TB Ortaklığı bağlamında 2015 ve 2050 yılları için belirlenmiştir. Bu hedeflere ulaşmak, Tütün kontrolü konusunda ulusal ve uluslararası çabaların odak noktasındadır ve elde edilip edilmediğini göstermek, gelecekteki ve sürdürülebilir yatırımlara rehberlik etmek için büyük önem taşımaktadır. Bu makale, TB hastalığının yükünü tahmin etmek için veri kaynakları hakkında kısa bir bakış sunar; 2012 yılında TB insidansı, prevalans ve mortalite tahminlerini ve 1990 yılından bu yana eğilimlere ve 2015 yılına kadar projeksiyonlara dayalı olarak bu göstergelerdeki düşüşler için 2015 hedeflerine yönelik bir ilerlemenin değerlendirmesini sunar; TB bildiriminde ve Stop TB Stratejisinin uygulanmasında eğilimleri analiz eder; Ve 2015'ten sonra TBC'nin ortadan kaldırılma ihtimalini göz önünde bulundurmaktadır. Tüberküloz (TB), insanlar için tarihlerinin çoğunu etkilemiş olabilir (Holloway ve ark., 2011; Comas ve ark. 2013) ve 50 yılı aşkın süredir etkili ve uygun fiyatlı kemoterapi bulgusuna rağmen dünya çapında ölümün ana nedenlerinden biri olmaya devam etmektedir. 2012'de (WHO 2013a) 1,3 milyon TB ölümle (HIV pozitif kişilerde TB ölümleri dahil), TB ve insan bağışıklık yetersizliği virüsü (HIV) dünya üzerindeki tek bir bulaşıcı ajandan ölümün en büyük nedenidir (Lozano ve ark., 2012; Ortblad ve diğerleri, 2013). TB, en ekonomik olarak üretken yaş gruplarında ve HIV ile yaşayan insanlarda önde gelen bir katildir (Lopez ve ark. 2006) ve TB'den sağlanan iyileştirmeler bile hayat kalitesini önemli derecede azaltan yaşam boyu sekellerle bırakılabilir (Miller ve ark. 2009). Bu gerçeklerin tanınması, 1990'ların başından bu yana TBC kontrolünü uluslararası toplum sağlığı gündeminde yüksek tutmuştur (Zumla ve diğerleri 2009; Lienhardt ve diğerleri 2012a), 1980'ler boyunca yıllarca ihmal edildikten sonra (Raviglione ve Pio 2002). Kemoterapinin, tüm sağlık bakım müdahalelerinden en uygun maliyetli olanı (Murray ve diğerleri 1991; Dye and Floyd 2006), HIV epidemisinin Afrika'daki TB üzerindeki katastrofik etkileri ve Çoklu ilaca dirençli TB'nin (ÇİD-TB) büyümesi, TB önleme ve kontrolünün iyileştirilmesine olan ihtiyacı vurgulamıştır. TBC'nin epidemiyolojik yükünün azaltılmasına yönelik küresel hedefler, 2015 ve 2050 yılları için Binyıl Kalkınma Hedefleri (BKH) bağlamında ve ayrıca uluslararası çabaları koordine etmek için kurulan paydaşların küresel bir koalisyonu olan TBT Ortaklığı tarafından belirlenmiştir (Kutu 1) . DSÖ'nün bu hedeflere ulaşması için önerilen yaklaşım, aktif TB bulunan hastaların tanı ve tedavisinde en iyi uygulamaları, büyük epidemiyolojik ve sistem zorluklarını gidermeye yönelik yaklaşımları ve araştırmaların desteklenmesini içeren TB Stratejisini Durdurma (Raviglione and Uplekar 2006) dur. Yenilikler (Kutu 2). 2006'da başlatılmış ve küresel hedeflere ulaşmak için kapsamlı ve bütçelenmiş bir plan olan Global Plan 2011-2015'in temelini oluşturmaktadır (Raviglione 2006b; 2007; Korenromp ve diğerleri 2012). KUTU 1. Hedefler, HEDEF ve TBC KONTROLÜ GÖSTERGELERİ Binyıl Kalkınma Hedefleri'nde Sağlık Hedef 6: HIV / Hedef 6c : Sıtma ve diğer önemli hastalıkların görülme sıklığını durdurun ve başlatın

TB ile ilişkili insidans, yaygınlık ve ölüm oranları Gösterge 6.10 : : : DOTS kapsamında tespit edilen ve tedavi edilen tBC vakalarının oranı TB Ortaklığı Hedeflerini Durdurun 2005'e kadar : Balgam yayma pozitif TB hastalarının en az% 70'inde teşhis konulacak (DOTS stratejisi altında) ve en az% 85'i başarıyla tedavi edilecektir. En az% 70'lik bir vaka tespit oranı hedefi ve en …

Devamını Oku »

PD1'in kristal yapısı, Haemophilus yüzey fibrili (Hsf) olağandışı büyük bir üçlü ototransporterdir En öldürücü soylar H tarafından eksprese edilen yapışkan (TAA). Influenzae . Hsf'nin patojen ve konukçu arasındaki yapışmaya aracılık ettiği bilinmektedir ve epiglotit, menenjit ve pnömoni gibi potansiyel olarak ölümcül hastalıkların kurulmasına izin verir. Yakın tarihli araştırmalar bu TAA'nın yeni bir 'saç tokası benzeri' bir mimari oluşturabileceğini önermekle birlikte, yüksek özünürlüklü yapısal veriler bulunmayan Hsf'nin karakterizasyonu silico modelleme ve elektron mikrograflarında ile sınırlı olmuştur. Burada, Hsf varsayımsal alan 1 (PD1) 'in kristal yapısı 3.3 Â çözünürlükte bildirilmektedir. Yapı, beklenmedik bir N-terminal TrpRing alanının mevcudiyetini açığa vurarak önceki alan açıklamasını düzeltir. PD1, çözülecek olan ilk Hsf alanını temsil eder ve böylece 'saç tokası benzeri' hipotez üzerine daha fazla araştırma yapılmasını sağlar. Anahtar Kelimeler: Hsf varsayımsal alan adı 1, trimerik ototransporter, Haemophilus influenzae adezin, hücre adhezyonu, Haemophilus yüzey fibril 1. Giriş Haemophilus influenzae üst solunum yolu enfeksiyonlarına, pnömoniye ve akut menenjit (Danovaro-Holliday ve ark. 2008 ; Murphy'ye bağlı enfeksiyonlara neden olan Gram negatif fakültatif anaerobik bir bakteridir ve diğerleri 2009 ). Farklı suşları H. Influenzae ya a-f serotiplerine, ikincisine de tipik olmayan olarak tanımlanan (Barenkamp ve St Geme, 1996 ) alt bölümlere ayrılmış şekilde kapsüllenmiş ya da kapsül içine alınmamıştır. H. Influenzae enfeksiyon, birçok pilus ve nonpilus yapışkan faktörlerin aracılık ettiği bir süreçte patojenin konak epitel hücresi astarlarına ve çeşitli ekstraselüler matriks (ECM) proteinlerine ( örneğin vitronektin) yapışmasıyla kurulur (Cotter ve diğerleri 2005 Virkola ve diğerleri 2000 ; Hallström ve diğerleri 2006 ). Yapışma, bakterinin konakçı tarafından temizlenmesini önlemesine izin verir ve sayısız virulans mekanizmaları yoluyla derin yerleşimli bir enfeksiyonun kurulmasını kolaylaştırır . Tüm suşları H. Influenzae patojeniktir, 1990'lı yıllarda etkili bir aşı kullanımına başlamadan önce hastanın morbidite ve mortalitesinin en yüksek oranlarından sorumlu olan virülan tip b (Hib) 'dir. Hib tarafından kullanılan böyle bir virülans faktörü, daha iyi karakterize edilmiş bir başka H ile önemli homoloji paylaşan bir trimerik ototransporter adhesin (TAA) proteini olan Haemophilus yüzey sarmalı (Hsf) dir. Influenzae ve diğerleri ve diğerleri 2015 (19459019). TAA'lar olarak bilinen HIA (Cotter ve ark. Salgılanan proteinlerin tip V ailesinin bir parçası olan, doğrusal bir fibril 'lollipop' yapısında düzenlenmiş üç ana alan türüne sahiptir. Baş ve küre alanları, hücre dışı bölgede N-terminüsünden serpiştirilir. YadA benzeri (YIhead) alanlar (Nummelin ve ark. 2004 gibi) ya çapraz mimarilere sahip β-tabakalardan oluşan ön alanlar ya da Triptofan halkası (TrpRing) alanları (Szczesny ve diğerleri 2008 (19459019)), tipik olarak proteinlerin yapışkan aktivitesine aracılık etmektedir. Sap, süper sargının derecesine ve yönüne (Hernandez Alvarez ve ark. 2010 ) bağlı olarak hepartan'tan pentadecad'a değişen periyodik üçlü üç boyutlu sargılı bir yapı oluşturur. Son olarak, C-terminal translokatör alanı, her bir altbirim bir amfipatik alfa-helis artı dört β-tabakaya katkıda bulunan bir trimerik β-namludur (Meng ve ark. 2008 ). Bu alan, proteinin geri kalan kısmının zar yoluyla translokasyonundan sorumludur ve tüm TAA'larda bulunur (Lehr ve diğerleri 2010 ). Son zamanlarda yapılan araştırmalar, Hsf'nin EM görüntülerine dayanan görünüşte yeni bir 'saç tokası benzeri' yapıya sahip olduğunu öne sürdü ( Singh ve diğerleri 2015 ). Paylaşılan bölgelerinde, Hia ve Hsf'nin% 72 sekans özdeşliği vardır (Hia161-1098 ve Hsf1484-2413, Ek Şekil S1), ancak tam uzunlukta trimerik Hsf (~ 750 kDa), Hia'nın (~ 340) iki katından daha büyüktür KDa). Hia'nın iki bağlayıcı alanı (HiaBD1 ve HiaBD2) de Hsf'de tanımlanmıştır (Laarmann ve diğerleri 2002 ); Bununla birlikte, Hia'nın aksine, Hsf'nin ek bir bağlanma alanı (HsfBD3) ve üç varsayımsal alanı vardır, yapısı ve fonksiyonu bilinmemektedir. Dahası, Hsf'nin alanlarını modellemeye yönelik sınırlı bir in silico yaklaşımı, ~ 200 nm'lik doğrusal bir TAA olmasının muhtemel olduğunu ortaya koymuştur (Singh ve diğerleri 2015 ). Buna rağmen, Hsf'nin elektron mikrografları H'de ifade edildi. Influenzae RM804 Hsf'yi doğrusal bir TAA olarak değil çift katlı bir saç tokası halkası yapısı olarak göstermiş görünüyor. Alan dizilişinin haritalanması, Hsf'nin N-ucunun zarın yakınında bulunması ve 'kıl tokası benzeri' hipotez ile tutarlı olmasını önerdi. Yapışkan işlevine ek olarak, Hsf'nin bağlandığı gösterildi. Kompleman inhibitörü vitronektin (Vn): etkileşim, HsfBD2 ve C-terminali Vn kalıntıları 352-374 ile eşleştirilmiştir (Hallström ve diğerleri 2006 ; Singh ve ark. 2014 ). Hem serumda hem de ECM'de bulunan bu glikoproteinin kazanılması, H'yi sağlar. Influenzae kompleman sisteminden kaçınmak ve epitelyal yüzeye daha iyi yapışmak suretiyle bakteri virülansını arttırmaktır. Bu kısmen Hia'nın aksine Hsf'nin en öldürücü, tiplendirilebilir H suşlarında ifade edildiğini açıklayabilir. Influenzae . Burada, bir Hsf varsayımsal alanının (PD1) kristal yapısını bildiriyoruz. Bu yapı, PD1, N-TrpRing: KG: TrpRing-C için yeni bir alan düzenlemesi ortaya çıkarır ve bu nedenle daha önce silico dizi analizi ile tanımlanan alan mimarisinin yerini alır. Bu çalışma, bu TAA'nın varsayımsallaştırılmış yeni 'saç tokası benzeri' yapıyı (Singh ve ark. 2015 kabul ettiği) belirlemek için Hsf'nin tam uzunluklu yapısını belirlemek için sürekli bir çaba oluşturmaktadır. 2. Gereçler ve yöntemler 2.1. Makromolekül üretimi 2.1.1. PD1-GCN4 Hsf alanı PD1, iki GCN4 bağlantı proteini arasında klonlandı. GCN4, doğal haliyle sargı bobini dimerini oluşturan iyi tanımlanmış bir maya transkripsiyon faktörüdür. Bununla birlikte, hidrofobik çekirdeğindeki spesifik kalıntıların mutajenezi GCN4'ün çeşitli oligomerik durumları benimsemesine olanak tanır. Bu nedenle, kararlı oligomerizasyonu kolaylaştırmak için füzyon proteinleri için ortak olarak GCN4 varyasyonları sıklıkla kullanılır. Bu durumda, fikir, HsfPD1'in dengeli trimerleşmesini kolaylaştırmak için hem N- hem de C-terminusuna iyi karakterize edilmiş trimer oluşturan bir GCN4 varyantı eklemek olmuştur (Hernandez Alvarez ve diğerleri 2008 (Hartmann ve diğerleri 2012 Koiwai ve diğerleri 2016 ) Lupas grubunun başarıyla kullandığı gibi. Bu füzyon proteini, PD1-GCN4, restriksiyonsuz (RF) klonlama kullanılarak üretilen bir pIBA-PD1-GCN4tri-His 6 plazmidinden eksprese edildi. PD1 geni, bir pET-16b- hsf polimeraz zincir reaksiyonu ile, 1-2414 plazmid. Primerler, hedef vektör olan pIBA-GCN4tri-His 6 (19459034) (Tamamlayıcı Tablo S1) tamamlayıcı çıkıntıları olan PD1 genini içeren bir 'megaprimer' üretmek üzere tasarlandı. 6 XhoI (New England Biolabs) ile restriksiyon sindirimi ile lineer hale getirildi ve PD1 genini (bunun içinde bulunan PIBA-GCN4tri-His 'Megaprimer') plasmid içine sokun. PD1-GCN4 ekspresyonu, 4 saat süreyle 8.6 μl M nihai konsantrasyona bir anhidrotetrasiklin hidroklorürün eklenmesiyle 0.6 OD 600 de indüklendi. Hücreler 193 K'de gece boyunca saklanan santrifüjleme (2000 g ile 10 dakika süreyle 277 K'de) ile toplanmış ve 50 m M 'den oluşan tampon [NaH 4 500 m NaCl, pH 8.0, 500 m . Hücreler sonikasyon ile parçalanmış ve süpernatanlar santrifüjleme (1600 g ile 10 dakika 277 K'de) ile toplanmıştır. Protein, immobilize metal iyon-afinite kromatografisi (IMAC) ile saflaştırıldı. PD1-GCN4 ihtiva eden temizlenen süpernatant, daha önce tampon A (2 x 6 ml; üç kolon hacmi) ile dengelenen bir Ni-NTA agaroz sütunu (GE Healthcare) üzerine tatbik edildi ve ajitasyon ile 1 saat süreyle bağlanmasına izin verildi. Proteinler, 50 m

NaH [500.04] NaCl'den oluşan tampon B ,% 10 gliserol, 300 m imidazol pH 8.0. Saflaştırılmış proteinin kalitesi, çok açılı bir lazer ışığı saçan (SEC-MALLS) aparatına (Şekil 1) bağlanan boyut uzaklaştırma kromatografisiyle değerlendirildi a ). SEC-MALLS, 50 m'lik Tris, 500 mM'lik NaCl, 50 mM Tris, 1 mM NaCl ve 1 mM NaCl'den oluşan tampon C ile dengelenmiş bir Superdex 200 5/150 …

Devamını Oku »

Biyologlar tuhaf mağara yaşamını 50 bin kişi bulabilir …

                                                                                                          Penny Boston tarafından sağlanan bu görüntü kelebek kristali olan bir mağarada kırmızı bir duvar gösteriyor. Bilim adamları, Fairyland ve cehennem olarak adlandırılan o kadar güzel ve sıcak bir Meksika mağara sisteminde, 50.000 yaşında olabilecek kristallerde sıkışıp kalan hayatı keşfettiler. NASA'nın Astrobiyoloji Enstitüsü başkanı Penny Boston, tuhaf ve eski mikropların Naica, Meksika'daki mağaralarda durgun olduğunu …

Devamını Oku »

Honda Two Wheelers Rolls 50. Lakh CB Shine; 2017 BS IV Modelini Başlattı

                         Honda Motosiklet ve Scooter Hindistan kısa bir süre önce CB Shine'ın 50. yüz binini bir araya getirerek dünyanın en büyük 125cc motosikleti haline geldi. En iyi sonucu almak için şirket, BS IV emisyon normlarına uyan ve standart olarak otomatik far özelliğini de (AHO) alan CB Shine modelinin 2017 modelini de piyasaya sürdü. 1 Nisan 2017'den itibaren, ülkede satılan iki …

Devamını Oku »

NASA ölümcül la sonra 50 yıl Apollo 1 mürettebat onur …

                                                                    Amerika'nın rockmenleri için anılacak sert bir hafta bu                                               Apollo 1 "width =" 648 "height =" 348 "height =" 348 "class =" article_img "                                                                     Cuma günü, NASA, Pilot Virgil "Gus" Grissom, Kıdemli Pilot Edward White II ve Pilot Roger Chaffee için yeni bir anıt düzenledi ve Apollo 1'de yangın çıktığında hayatını …

Devamını Oku »

Sana Nasıl Cinsel Olacak Söyleyecek 50 Kinky Sorunu …

Ne kadar çok sorunun EVET'e cevap verdiğini görün ve bunları gerçekten de ne kadar yaramaz olduğunu bulmak için ekleyin. Thought.is 1-10: Siz siz Cinsel tecrübesiz. Ya bakire biri ya da her gece saat dokuzda uzun süreli eşinizle misyoner seks yapıyorsunuz. İstisna yok 11-20: Arkadaşlarınız genellikle sünnet hikayelerini anlatırken kızmazlar, çünkü genellikle ilgilidirler. Yatak odalı alışkanlıklarınız oldukça ortalama – kötü bir …

Devamını Oku »