24 Eylül 2017,Pazar
Anasayfa » Tag Archives: 5

Tag Archives: 5

'Akıllı drone' yerli yazılımla 5 saniyede 100 kilometre hıza ulaşıyor | Bilim Teknoloji |

     Dünya Bülteni / Haber Merkezi Selçuk Üniversitesi (SÜ) Mühendislik Fakültesi'nde bir grup öğrenci, yapmış yazılımla belirlenen koordinatlara otomatik olarak giden, 5 saniyede 100kmye ulaşabilen, afet gibi acil olmak insani yardım malzemeye taşımaada kullanılabilecek drone geliştirdi. "Akıllı Drone" olarak isimlendirdikleri aracın yazılımını yapan öğrenciler, Türkiye Bilimsel ve Akademik Araştırma Kurumunun düzenlediği 2. Uluslararası İnsansız Hava Araçları (İHA) Yarışması'nda 2. oldu. …

Devamını Oku »

Google Nexus 5 Android Kiti LetsGoMobile

S Baskı ve LG Electronics Amerika Android Kiti İşletim sistemi Google Nexus 5 akıllı telefonun 16 GB hafıza versiyonunun 8 Aralık tarihinden itibaren Sprint satış kanalları için 149.99 USD / 300 TL fiyatla satışa sunulduğunu duyurdu. Telefonseverler Google Nexus 5 Android cep telefonuna iki yıllık sözleşme çerçevesinde vergiler hariç aylık 18.75 USD taksitlerle ve 50 USD sonradan ödemeli paket ileinde …

Devamını Oku »

En hızlı uluslar arası sahip 5 ülke!

İnternet çağımızda en büyük gereksinimlerinden birisi halini almışken, internet erişimi yok veya çok kısıtlı. Fakat bazı ülkeler internet hızlarıyla dünyanın en iyisi olmayı başarmışlar. Bağımsız bir araştırma şirketi tarafından yapılan çalışmaya göre 2017 yılında en yüksek internet hızı ortalamasına sahip olduğu ülkeler açıklandı. Birleşik Devletler İngiltere, Almanya ve Kanada gibi devletler bulunmuyor. Listenin en tepesinde Çin 'e bağı özel yönetim …

Devamını Oku »

OnePlus 5 kendisiyle yarışıyor! – ShiftDelete.Net

OnePlus 5 pazaraya sürülmesiyle birlikte oldukça büyük ses getirdi. Oldukça büyük bir ilgiyle karşılan yeni amiral gemisi bildiğiniz üzere 6 ve 8 GB bellek seçenekleriyle satışa sunulmuştu. Peki 6 ve 8 GB belleğe sahip modellerin arasındaki fark farkı hiç düşündünüz mü? OnePlus 5 modelleri karşı karşıya! Eğer düşündüyseniz, aradığınız cevabı bu haberde bulabileceksiniz. Timmers adlı kayıtlı YouTube kanalıyla birlikte yayınlanan …

Devamını Oku »

Xiaomi Redmi Not 5 özellikleri ortaya çıktı!

Xiaomi markasının satış başarısı ile ilgili kişi ile yüzünü güldüren Redmi Not serişin yeni üyesi olan Rendmi Note 5 hakkında sızıntılar detaylarılanıyor. 5,5 inçlik FullHD IPS ekran ve enerji tasarruflu yonga seti geleneğini bozmayacak gibi görünüyor ve enerji tasarruflu çipset konusunda kullanıcıların Snapdragon 630 ve 660 arasında bir seçim sunulacak . Önceki modeline göre pil kapasitesinde 310 mAh 'lik bir …

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Far Cry 5 oynayacaklara kötü haber!

Arkadaşlarımızla oyun oynamak istememizin önemli bir sebebi var; beraber ilerlemek . turla sıkmaya hazırlanıyor. Far Cry 5 Birlikte Oyun Oynarken Alacağınız keyfin üzerine resmen Far Cry 5 işbirliği sorunsalı! Far Cry 5 arkadaşınız ile senaryoda ilerlemenize izin verecek. Tıpkı Borderlands 2 gibi arkadaşlarınızla birlikte oyunla ilerleyerek keyifli vakit geçirebileceksiniz. Ama bu keyif dolu anlar oyununa geri döndüğünüzde son erecek. Far …

Devamını Oku »

OnePlus 5 özellikleri ve fiyatı

     OnePlus 5 sonunda tanıtıldı. OnePlus 5 Resmi olarak duyuruldu. Yeni Çıkan Amiral Gümüş OnePlus 5                           OnePlus 5 resmi olarak teşkil edildi! Kullanıcıların tanıtılmasını merakla beklediği yeni amiral gemisi artık tümü ile gün yüzüne çıktı. OnePlus 5 Snapdragon 835 İşlemcisi ile gümbür gümbür geliyor. Şimdiye kadar piyasa çıkmış olan Android telefonlar arasında en çok dikkat modeli birisi olan …

Devamını Oku »

Pahalı telefon şart mı? 5 Çayı # 132

     5 Çayı programımızda bu akıllı telefon satın almak isteyenüz için ihtiyaç görüşlerini seçmek ve pahalı telefon şartım soruları cevaplandıracağız. Kaçırdım diye üzülme Canlı yayında kaçıranlar için, yayın tekrarı kanalımıza olacak ShiftDelete.Net Facebook sayfası ShiftDelete.Net YouTube sayfası Hashtag'imiz #benimtercihim Canlı yayında konumuzla ilgili görüşlerinizi ekrana yansıtıyoruz ve yorumlarınızı okuyoruz. Yorumlarınız için Twitter ' da belirlediğimiz hashtag'i kullanmalıdır gerekiyor. SDN – …

Devamını Oku »

OnePlus 5 ve iPhone 7 Plus hız testinde!

Snapdragon 835 işlemcisi ve 8 GB RAM 'i ile tüm dikkatleri üzerine çeken OnePlus 5 şu Anda Androd'un dünyasının en donanımlı cihazı. HTC U11 ve Galaxy S8 ile yapılan testlerde iki ayrı amiral gemisi de geçmeyi başaran OnePlus 5, bu sefer de iPhone 7 Plus ile hız testine tabi tutuldu. OnePlus 5 hız testinde iPhone 7 Plus'ı geçti! Bir tarafta …

Devamını Oku »

OnePlus 5 hakkında şıkayetler bitmiyor!

OnePlus 5 Kullanıcıları tarafından ekrana arıyorsun tabir-i caizse ağdalı geçişler yaşıyor şikayetleri OnePlus açık ulaşmaya başladı. Twitter Aşağı yukarı kaydırma yaparken, bazı içeriklerin ekrandaki yerini daha geç aldığı belirtiliyor. Sorun çözülebilecek mi? XDA Developers'ın OnePlus'a sorunla ilgili olarak ulaştığı ve akıllı telefonun üreticisi olunin problemin kaynağını araştırmaya başladıklarını açıkladı. OnePlus 5 'in böyle bir problemle neden karşılaştığı henüz kazanılmadı resmiyet …

Devamını Oku »

5 Orta Ölçekli İşletme Nasıl Çalışır?

Orta ölçekli bir kurumsal işletme olarak başarmak, kolay bir başarı olamaz. Daha küçük bir organizasyonun şaşkınlığını somutlaştırmaya ihtiyaç duyuyorlar, ancak büyüme, üretkenlik ve risk gibi daha büyük organizasyonlarla (genellikle emrinde daha az kaynakla) karşılaşılan aynı güçlüklerle mücadele ediyorlar. Bu, orta ölçekli işletmelerin daha akıllı çalışması ve en verimli şekilde çalışmasına izin veren süreçler koyması için daha da önemli hale geliyor. …

Devamını Oku »

OnePlus 5, HTC U11 ve Galaxy S8 hız testine tabi tutuldu!

Geçmişte telefonlarında yaşanan donanım sorunlarıyla sıkça gündeme gelen OnePlus firması, günümüzde ise artık rakiplerin gözünü korkutan kaliteli bir akıllı telefon üreticisi konumunda . HTC U11 ve Galaxy S8 ile yapılan bir hız testi rakiplerinin OnePlus Tek yapraklı kuş 'I ne kadar çok ciddiye bir kez daha kanıtladı. OnePlus 5, HTC U11 ve Galaxy S8 hız testine tabi tutuldu! " Bir …

Devamını Oku »

OnePlus 5 yeni renk seçeneği belli oldu!

OnePlus 5 Tarihte Geçildiğimiz Günlerde Resmi Açılınca Teşekkür Açıldı. OnePlus 5 hakkında yeni ayrıntılar gelmeye devam ediyor. OnePlus 5'in yeni renk seçeneği ortaya çıktı! Kullanıcıların renkleri ve tonları ile çıkmayı tercih eden Teknoloji devi, daha gösterişli ve albenisi olan renk seçenekleri ile karşımıza çıkmaya hazırlanıyor. Bugün yapılan sızıntı ile birlikte yeni amiral gemisinin, altın rengi hakkında ilk bilgiler geldi. Kullanıcıların …

Devamını Oku »

OnePlus 5 optik yakınlaştırma nasıl çalışıyor?

OnePlus 5 bir çıkışın ardından konuşulmaya devam ediliyor. OnePlus 5 için hatırlayacağınız üzere New York'ta 'ta ta devamlı kuyruk oluşmuştu. OnePlus 5, optik yakınlaştırma özelliği nasıl çalışıyor? Snapdragon 835 işlemcisi ile oldukça kaliteli bir akıllı telefon deneyimi sunacak olan OnePlus 5 çift kamerasıyla da olsa dikkatleri üzerine çekmeyi başardı. OnePlus tarafından mühendisler tarafından ince elenip sık dokunulan bu çift kamera, …

Devamını Oku »

OnePlus 5 için büyük ilgi!

OnePlus 5 dün resmi olarak tanıtıldı. Binlerce kullanın merakla beklediği OnePlus 5 dikkat çekici özellikleri ve fiyatı ile kullanıcıların huzurunda resmiyet kazanmış oldu. OnePlus 5'e ilgi büyük! 6 ve 8 GB bellek Seçenekler ile karşımıza çıkacak olan OnePlus 5 'i satın almak isteyenansa New York ' ta metrecelerce Kuyruğa girmiş durumdalar. 'da iPhone ' dan sonra ilk defa bu kadar …

Devamını Oku »

Saçılar boyamadan önce bilmeniz gereken şey 5 şey

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağın yok yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 …

Devamını Oku »

ZTE Kis 5 Türkiye'de LetsGoMobile

Z, TE, en yeni ve Android Kit Kat 4.4'e ait giriş seviyesi akıllı telefonu Kis 3'ü tanıttı. ZTE Kış 3, akıllı telefonun deneyimini herkese sunmak için yaşatmayı hedefliyor. ZTE Kis 3 telefon ZTE'nin,, giriş, akıllı Seviyesi akıllı telefon Kategorisinde en iyi Performansı sunmak Için tasarladığı Kis 3 Qualcomm MSM 8210 1.2 GHz çift çekirdek işlemci 512 MB RAM ile akıllı …

Devamını Oku »

OnePlus 5 canlı bir şekilde görüntülendi!

OnePlus 5 hakkında yeni bilgiler gelmeye devam ediyor. Tanıtımına sayılı saatler kalan OnePlus 5 kutusu ile beraber görüntülendi. OnePlus 5'ten yeni görüntüler! Qualcomm 'un yeni nesil Snapdragon 835 işlemcisinden güç alacakanlar yeni telefon çok başarılı bir çıkış atmosferi iPhone 7 Plus 'den beri çift arka kamerası ile kullanıcılara kaliteli bir deneyim sunmak isteyen OnePlus 5 özellikleri ile tüm dikkatleri üzerine …

Devamını Oku »

GTA 5 krizi büyüyor – ShiftDelete.Net

Geçtiğimiz günlerde ve 2K Oyunları gibi firmaları bünyesinde barındıran Grand Theft Auto V ] EFLC ve Max Payne 3 gibi oyunlarının mod yüklemesi ve geliştirme aracı olan OpenIV programını mahkemeye taşımıştı. Mahkemede bu programın Grand Theft Auto V 'in güvenlik sistemlerine zarar verdiği, oyunun güvenliğini bozduğunu iddia ederek yasal yollar ile mahkemeye başvurarak, programın geliştiricisi tarafından OpenIV ' un yayından …

Devamını Oku »

OnePlus 5 ile çekilen fotoğrafları yayınlandı!

OnePlus 5 ile çekilen fotoğraflar, 5 'in kamera kalitesini merak ediyorsanız, şirketin CEO'su Pete Lau tarafından yayımlanan ve OnePlus Tam boy göremiyor. OnePlus HDR şovu! Fotoğrafların çözünürlüklerinin 16 MP'li ve bu yüzden artık OnePlus 5 'in en azından bir kamerasının 16 mpüyağının ortaya çıkmış olduğunu belirtmemek gerekiyor. Görsellere göz atacak olursanız cihazın şu anda mobil fotoğrafçılık konusunda rakipleriyle rahatlıkla çocuk …

Devamını Oku »

İnkılap tarihi 5. ünite test soruları

8. Sınıf Atatürkçülük Ünitesi Test Soruları, İnkılap 5. Ünit Test Soruları, Atatürkçülük Ünitesi Yazı Soruları ve Cevapları, İnkılap Tarihi 5. unite test soruları ve cevapları S.1) Bir bütündür, birbirlerinden ayrı çeşitlar. Akla ve mantığa uygundur. Bilimsel faaliyetlerde Batıyı taklit etmeyi esas alır. Tüm yeniliklerin İslam'a 'uygun bir olmasına uğratmayın. Yukarıdakilerden hangisi ya da hangileri, Atatürk ilkelerinin ortak özelliği gidermez mi? …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

OnePlus 5 için sevinçici açıklama!

Amiral gemisi katili olarak bilinen OnePlus'ın yeni akıllı telefonu OnePlus 5 için ön kayıtların alınmasına başlandığını ve henüz tanıtılmamış olmasına rağmen 75 bin kişiinin kayıt yaptırdığını sizlere duyurmuştuk. Pete Lau 'dan sevinçici açıklama geldi. Önceden gelecekdeki haftanın resmi tanıtımı gerçekleştirmek beklenilen OnePlus 5 hakkında şirketin CEO'su OnePlus kurucu ortağı ve CEO'su Pete Lau Weibo hesabı üzerinden stok sorunlarını yaşanacağına dair …

Devamını Oku »

Far cry 5 oynanis videosu yayinlandi

Ubisoft 'un E3 2017 basın konferansında ilk defa Far Cry 5 oyununa dair bir video oynadı videolar yayınlandı. Crew 2'nin ilk tanıtım videosu yayınlandı! Far Cry 5 İçin İki Yeni Video! Sunumda oyuna dair sadece oynanış videosu yayınlanmadı. Oyuna dair iki video yayınlandı. Yayınlanan ilk video daha önce yayınlanmış olan videolar gibi kısaydı. Fakat onun peşinden gelen video da oyunun …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

OnePlus 5 kamerası düşük ışıkta nasıl?

OnePlus 5 hakkında onun geçen günlerinde yeni bir ayrıntı ortaya çıkmaya devam ediyor. OnePlus CEO'su 'nın Peter Lau, OnePlus 5'in kamerasının altında düşük ışıkta nasıl performans sergilediğini kullanılır paylaştı. OnePlus 5'in kamerası çok konuşulacak! OnePlus CEO'su sunun paylaştığı görselle baktığımız da ise, yeni amiral gemisinin kamerasının ne kadar iddialı olur tıklayın. Düşük ışıklı ortamlarda 'un Galaxy S7 kenarı ' i …

Devamını Oku »

IOS 11 ve diğer yenilikler – 5 Çayı # 129

5 Çayı programımızın bu bölümünde WWDC 2017 etkinliğinde tanıtılan iOS 11 işletim sistemi ve etkinlikte tanıtılan HomePod, yeni MacBook Pro ve diğer ürünler konuşuyoruz! Kaçırdım diye üzülme Canlı yayında kaçıranlar için, yayın tekrarı kanalımıza olacak ShiftDelete.Net Facebook sayfası ShiftDelete.Net YouTube sayfası Hashtag'imiz # benceiOS11 Canlı yayında konumuzla ilgili görüşlerinizi ekrana yansıtıyoruz ve yorumlarınızı okuyoruz. Yorumlarınız için Twitter ' da belirlediğimiz …

Devamını Oku »

Galaxy Note 5 için yeni bir güncelleme yayınlandı!

Samsung'un 2015'le buluşturduğu Galaxy Note 5 modeli, güçlü donanımı ile Not 7 faciasından sonra halen phablet segmentinin en iyi cihazlarından birisi olmayı başarıyor. Galaxy Note 8 modeli için çalışmaya devam eden Samsung, bir yandan da Android 7.0 Nugası ile buluşturduğu Galaxy Note 5'i daha da istikrar kazanmaya devam ediyorsun, yeni güncellemeler yayınlamaya devam ediyor. Android 7.0 sonrasında Not 5 için …

Devamını Oku »

OnePlus 5 ne zaman tanıtılacak?

OnePlus 5 hakkında yeni bilgiler gün yüzüne çıkmaya devam ediyor. Bugün ortaya çıkan habere göre yeni amiral gemisinin tanıtım tarihi duyuruldu! OnePlus 5 ne zaman tanıtılacak? OnePlus 5 akıllı telefon pazarasına damgasını vurmaya hazırlanıyor. yeni amiral gemisi gümbür gümbür geliyor. Yeni amiral gemisi gümbür gümbür geliyor. Bugün OnePlus yetkilileri kullandı, OnePlus 5 'da tanıtım tarihi belli oldu. Yapılan açıklamaya göre …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 5 Haziran 2017 Pazartesi 08: 00-6 Haziran 2017 Salı 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 5 Haziran …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 5 Haziran 2017 Pazartesi 08: 00-6 Haziran 2017 Salı 08:00 Bir önceki yazımız 5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 5 Haziran 2017 Pazartesi Akçaabat nöbetçi eczane, 5 Haziran 2017 Pazartesi nöbetçi …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 5 Haziran 2017 Pazartesi 08: 00-6 Haziran 2017 Salı 08:00 Bir önceki yazımız 5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler 5 Haziran 2017 Pazartesi Akçaabat …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 5 Haziran 2017 Pazartesi 08: 00-6 Haziran 2017 Salı 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 5 Haziran 2017 Pazartesi …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 4 Haziran 2017 Pazartesi – 5 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 4 Haziran 2017 Pazar nöbetçi eczane, 4 Haziran 2017 Pazar Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler verilmektedir. …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımızda 4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 4 Haziran 2017 Pazar nöbetçi eczane, 4 Haziran 2017 …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ec …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 5 Haziran 2017 Pazartesi 08:00 – 6 Haziran 2017 Salı 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 5 Haziran 2017 Pazartesi 08:00 – …

Devamını Oku »

IBM 5 nm'lik çip geliştiriyor

Şu anda piyasada bulunan en küçük ve en gelişmiş çipler 10 nm uzunluğunda. Ancak IBM FinFET kullanıldığında yarı yarıya azalarak 5 nm'ye indirecek. 30 milyar transistör! Kullandığımız elektronik cihazlar (telefon, bilgisayar, tablet …) aslında birer transistör yığınından oluşuyor. IBM, çiplerin boyutunu 5 nm'ye indirerek, 30 milyar transistör sıkıştıracak bir proje üzerinde çalışıyor. Mevcut 10 nm çipler ile karşılaştırıldığında 5 nm'lik …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

5 Haziran 2017 Pazartesi – 6 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 4 Haziran 2017 Pazar 08:00 – 5 Haziran 2017 Pazartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 4 …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 4 Haziran 2017 Pazar 08:00 – 5 Haziran 2017 Pazartesi 08:00 Bir önceki yazımız olan 4 Haziran 2017 Pazartesi – 5 Haziran 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 4 Haziran 2017 Pazar Akçaabat nöbetçi eczane, 4 Haziran 2017 …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 4 Haziran 2017 Pazar 08:00 – 5 Haziran 2017 Pazartesi 08:00 Bir önceki yazımız olan 4 Haziran 2017 Pazartesi – 5 Haziran 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 4 …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 4 Haziran 2017 Pazar 08:00 – 5 Haziran 2017 Pazartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 4 Haziran 2017 …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler başlıklı makalemizde 3 Haziran 2017 Cumartesi nöbetçi eczane, 3 Haziran 2017 Cumartesi Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler verilmektedir. …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler başlıklı makalemizde 3 Haziran 2017 Cumartesi Nöbetçi eczane, 3 Haziran …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 4 Haziran 2017 Pazar 08:00 – 5 Haziran 2017 Pazartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 4 Haziran 2017 Pazar 08:00 – …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

5. Sınıf 1. Dönem 2. Yazılı Sınavı 2017-2018

…………………………… .. ORTAOKULU 2017-2018 EĞİTİM ÖĞRETİM YILI 5. SINIF SOSYAL BİLGİLER DERSİ I. DÖNEM II. SINAVI Adı ve Soyadı: SINIF: 5- …… NO: Notu: S1. Bir kabartmaucu koyu kahverengi ile gösterilen yerler aşağıdaki formatı dikkate alarak hangisi olabilir A) Akarsu ve göller B) Ovalar C) Ormanlık alanlar D) Yüksek dağlar S2. İnsanlar için çeşitli çevre düzenlemeleri. Aşağıdakilerden hangisi insanların doğal …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

4 Haziran 2017 Pazar – 5 Haziran 2017 Pazartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

OnePlus 5 kamerası ile büyüleyecek!

OnePlus 5 hakkında yeni gelişmeler yaşanmaya devam ediyor. OnePlus yeni telefon ile gümbür gümbür geliyor. OnePlus 5'in kamerası ile kullanıcılarının büyüleyecek! Bugünkü sızdırılan görüntüler ile birlikte yeni amiral gemi si OnePlus 5 'in kamerası ile çekilmiş, birbirinden güzel fotoğraflarken beraberinde. OnePlus kamera konusunda rakiplerine fark atmak istiyor. OnePlus 5 İle Birlikte Mesaj Gönder Edildi. Çift arka kamerası ile kullanıcılarına farklı …

Devamını Oku »

Xiaomi Mi 5 de indirimde! – ShiftDelete.Net

Xiaomi Mi5 modelinin geliştirilmiş sürümü ve fiyatının performansı açısından iyi bir seçim Xiaomi Mi5s modeli indirimde. Dilerseniz ilk olarak telefonun özelliklerini hatırlayalım. Xiaomi Mi5s özellikleri gümüş beyaz ve Gül Altın altın ] Renk seçenekleriyle geliyor. 5.15 inç boyutlu ekrananda Full HD çözünürlük esas telefon, IPS panel kullanıyor ve [n 600 nits parlaklık seviyesi sunuyor. 2,45 GHz saat hızında çalışıyor Snapdragon …

Devamını Oku »

CHRNA3 / 5 ve APO'ya yakın varyantlar …

Özet Yaşam boyu çok büyük kişisel ilgi alanlarından biridir. Bununla birlikte, insan ömrünün biyolojik temelini araştırmak, ölümün uzun sürmesiyle engellenmektedir. 40 yıllık yaşın ötesinde (272,081) ebeveynin hayat boyu kapasitesini katılımcı genotip üzerinde yeni bir büyük veri setinde (UK Biobank) geriletmenin yeni bir yaklaşımını kullanarak, burada apolipoprotein E ve nikotinik asetilkolin reseptör altbirim alfa 5 genlerinin yakınında bulunan yaygın varyantların ömür. …

Devamını Oku »

5 Numara Saç Modelleri

Kadınlar için de erkekler için saçlarının şekli ve yüzlerine yakışı belli değil önemli bir konu haline geldi. Erkek eğlenceleri belirlemekte önemli rol oynamakta. Erkek saç modelleri ne kadar şekillense de klasik kesimlerden vazgeçmeyen erkekler 5 numara saç modelini tercih et. Bu kesim klasik bir tarzda da sahibine ait spor bir görüntü verir. Kadınların erkeklere tercihleri. Bu model, spordan klasiğe bütün …

Devamını Oku »

Samsung Galaxy Note 5 akıllı telefon LetsGoMobile

S Amsung Electronics, Galaxy Note 5 ile ilgili olarak ABD'de düzenlenen "Ambalajsız Olay" ile gerçekleştirdi. 2011 yılındaki ilk Galaxy Note'un ortaya çıkışından bu yana Samsung'un büyük ekranlı akıllı telefon piyasasındaki güçlü inovasyonlar, yeni akıllı telefonda da kendisini gösterdi. Samsung, güçlü işlemci, hızlı ve kolay kablolu ve kablosuz şarj özellikleri, yüksek kaliteli fotoğraf ve videolar için en iyi kamera özellikleri, dünyanın …

Devamını Oku »

En iyi fotoğrafı konuşuyoruz! – 5 Çayı # 128

5 Çayı'nın 128. bölümünde fotoğrafçılık üzerine keyifli bir sohbet happenriteceğiz. Bu bölüm ve konuya özel olarak Canon Eurasia Ürün Uzmanı Mert Gündoğdu 'yu konuk edeceğiz. Mert Gündoğdu ile fotoğrafçılık ve fotoğraf makineleri üzerine konuşacağız ve fotoğrafçılık için gönül verenler için profesyonel tavsiyeler alacağız. Fotoğraf ve fotoğrafçılık tutkunlarını Perşembe günü saat 17:00 'da ShiftDelete.Net YouTube kanalımızda başlayacak. Konuğumuza sorularınızı Twitter'dan # …

Devamını Oku »

İşini beğenmeyip milyarder olan fırsatını öğrenir kaçıran 5 insan

    ABD'de, Silikon Vadisi'nde çalışmak da, piyangodan dolar dolarlık bileti almak veya ikramiyeyi tek rakamla kaçırmak gibi bir talih problemine dönüşmüş durumda. Işe girerken veya istifa ederken yanlış kararlar verenlerin milyarder varlık imkanları kaçırabildiği gerçeğini gösteren sayısal örnekler ve bu insanlara verdikleri yanlış kararlar nedeniyle ömür boyu pişman yaşıyorlar. İşte, yanlış karar vererek milyarder olan fırsatını kaçıran beş insan: 1- …

Devamını Oku »

Hindistan 5 Haziran'ı hea'yı birleştirme günü olarak belirledi …

                                  Hint Uzay Araştırmaları Örgütü, 5 Haziran'yı ülkenin ağır asansörlü roket inşa etme arzusundaki bir sonraki kilometre taşı olarak belirledi.                  İşte ISRO'nun GSRV III. Mark III, GSRV serisindeki bir fırlatıcının bu kadar büyük bir ağırlığa sahip olduğu ilk kez jeosenkron bir aktarma yörüngesine 3,136 kg GSAT-19 uydusundan çekilmek üzere geldi.                  Araç şu anda Andhra Pradesh'deki Sriharikota roket …

Devamını Oku »