18 Aralık 2017,Pazartesi
Anasayfa » Tag Archives: 3

Tag Archives: 3

Roma Konaklama Rehberi | İNGİLİZCE BÖLÜMÜ Lazio Bölgesi 'nin en büyük şehri Roma Bizans İmparatorluğu, Roman İmparatorluğu, İtalya Krallığı, bir ana metropol olan Papalık Yönetimi ve İtalya Cumhuriyeti'nin başkentliğini yapmış ve hala yapmakta. Üstelik İstanbul gibi 7 tepeli bir şehir. Aventino, Campidoglio, Palatino, Quirinale, Viminale, Celio ve Esquilino Tepeleri kuruldu. Her yıl milyonlarca turisti kendine çekiyor. Tarih, arkeoloji, sanat ve gastronomi için gezginlere sonsuz seçenekler sunan Romanlar seyahatinizde nerede kalacağınız is aslında hem kolay hem de zor bir seçim. Kolaylığı, onun bütçeye uygun alternatiflerin yapılmasıyken zorluk derecesi seçenekler çok fazla olmasından dolayı akıl karıştırıcılığı. Roma Konaklama Rehberi yaz fit için uygun konaklama seçeneklerini bölgeler özelinde anlatmaya çalışacağım. Konaklama bölgeleri ve otellere geçmeden önce kısaca şehrin ulaşımında altyapısından da bahsedeyim. Roma'da şehir içi ulaşım için metro ve otobüs seçenekleri mevcut. Metro 3 hatlı ancak hatlardan birisi turkey regionelerin çok dışında. Otobüs çok daha yaygın. Günlük, 48 veya 72 saatlik biletlerle her iki seçeneği de sınırsız kullanabilirsiniz. Roma Ulaşım Rehberi yazısında bu çok daha detaylı bilgiler bulmanız mümkün. Roma binası haritası

Aslında şehrin turistik bölgeleri Centro Storico (19459007)

Devamını Oku »

Vodafone Akıllı Tab 3 tablet LetsGoMobile

V Odafone Türkiye, kendi markasını taşıyan cihazlara yenilerini eklemeye devam ediyor. Güçlü donanımı, yüksek performansı ve 3G teknolojisini kullanan Vodafone Süper İnternet'le birlikte Vodafone Akıllı Tab 3 tabletleri, onun bütçeye uygun, ekonomik fiyatlarıyla dikkat çekiyor. Lenovo kalitesi ile üretilmiş Vodafone Smart Tab 3 tablet, 7 ve 10 inçlik modeli ve yüksek performansı ile uygun fiyatla sunuyor. Vodafone'un kendi markasıyla birlikte …

Devamını Oku »

Asus ZenFone 3 Deluxe için yeni güncelleme!

Asus, son dönem Zenfone serisi akıllı telefonlar için yayınladığı güncellemeler ve kullanıcıların şikayetçi oldukları sorunların üstesinden gelin, akıllı telefonları ile daha iyi bir deneyim sunmayı hedefliyor. Geçen Hafta Günlerde Zenfone 2 Laser ile yayınlanan güncellemenin ardından, Asus bu kez kullanıcıların kıyısına Zenfone 3 Deluxe modeli için hazırladığı yeni bir güncelleme ile çıktı. Gelin, yayınlanan güncelleme ile birlikte cihazda meydana geliyor …

Devamını Oku »

IOS 11 Beta 3 yayınlandı!

Apple, WWDC 2017 etkinliğinde duyurusu başarmış ve Eylül ayına ait buluşacak olan IOS 11 için test etmekine bugün yayınladığı üçüncü beta sürümü devam ediyor. Oldukça fazla geliştirme ve yeniliğe ev sahipliği yapan yeni IOS sürümü ile birlikte iPhone ve iPad 'IOS 11 Beta 3 sürümünü yayınladı. Apple, iOS 11 için test etmekine devam ediyor! 385 MB boyutunda bir güncelleme olarak …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

3 boyutlu basılan protez Üçüncü Thumb şaşırdıyor!

Teknoloji ile ile karşı karşıyayız. İlk bakışta tuhaf gelebilir ancak Üçüncü Başparmak adlı 3 boyutlu basılmış protez aslında hoş işlevsel olması şaşırtıyor . Üçüncü parça ile daha yetenekli elli! Kraliyet Koleji mezunu Dani Clode tarafından hayata geçirilen Üçüncü Thumb Projesi ile işsel bir üçüncü protez baş parmak tasarlanmış. Ürünü kullananların yetenekleri genişlerken, sunulan hareket çeşitliliği ise gerçekten şaşırtıcı. İki küçük …

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Avea inTouch 3 Büyük LetsGoMobile

Ç Ok yakın bir oranda kendi markasını taşıyan yeni akıllı telefonu Avea inTouch 3'ü tüketiciyle buluşturan ve çok başarılı sonuçlara ulaşmakan "operatör markalı ilk 5 inç, geniş ekranlı akıllı telefon" özel özelliğe sahip 'Avea inTouch 3 Büyükada satışa sunuyor. Avea inTouch 3 Büyük, 1,3 GHz çift çekirdekli işlemcisi, 5 MP flaşlı kamerası, gelişmiş kamera özellikleri, kişiselleştirilebilen arayüzü, pratikliği ve özellikleri …

Devamını Oku »

OnePlus 3 kullananlara müjde! – ShiftDelete.Net

OnePlus 3'üncüsü ün geleceği hakkındaydı Tek tuşla cevap etkinliği düzenleyen OnePlus'a OnePlus 3 ' ün geleceği hakkındaydı . Görünüşe göre OnePlus 3 kullanıcıları Android O güncellemesine bu yıl bitmeden kavuşacak. OnePlus sözünü tutmadı mi? '' yılına sonuna kadar OnePlus 3 ve 'nun yıl sonuna kadar ] OnePlus 3T modelleri için hazırlanmış gibiydi. Yine de Android O 'nun henüz tam sürümüyle …

Devamını Oku »

Samsung Messager 3 Akıllı Telefon LetsGoMobile

S Amsung Messager ve Samsung Messager 2 modellerinin devamı niteliğindeki yeni Samsung Messager 3 SCH-r570 cep telefonu siyah renkli zarif gövdesinde 2.4 inç boyutlu ekran, kayarak açılan yatay QWERTY fiziksel klavye, T9 metin giriş fonksiyonu ile hızlı ve kolay mesajlaşma özelliklerini bünyesinde barındırıyor. Yeni Samsung Messager 3 cep telefonunun dikkat çeken diğer özellikleri de müzik çalar fonksiyonu, 3.5mm kulaklık girişi, …

Devamını Oku »

ZTE Kis 3 Android cep telefonu LetsGoMobile

Z, TE, en yeni ve Android KitKat 4.4'e sahip ZTE Kis 3'ü, üstün akıllı telefon deneyimi sunmak için Avrupa ülkelerinde satışa sundu. oğul En renk seçeneklerini akıllı telefonlarına başarıyla yansıtan ZTE, yeni telefon serisinin lansmanını gece mavisi ile Yaptı. ZTE Kis 3, 1.2GHz Çift Çekirdekli işlemci ve 512 MB RAM ile çalışan akıllı telefonlar için uygulama ve çoklu işlemlerin kolay …

Devamını Oku »

Warcraft 3 ve Diablo 2 yeniden buluş!

StarCraft'ın yeniden hazırlanıp bu yaz tekrar satışa sunulacağının duyurusunu Geçtiğimiz aylarda yapan Blizzard firması, Oldukca sevilen ziyaretinde kült haline gelen on iki oyunu Warcraft 3 ve Diablo 2 'yi de yeniden hazırlama kararı aldı. Yeniden yapımlar ne zaman gelecek? Öncelikle Bu Konuda HERHANGİ Bir açıklama bulunmadığını belirtelim Çünkü Ortaya çıkan bu haber direkt Olarak Blizzard'ın resmi internet sitesinden duyurduğu Bir …

Devamını Oku »

Fena halde ağız sulandıran 3 salata tarifi

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağın yok yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 …

Devamını Oku »

ZTE Kis 3 Maksimum akıllı telefon LetsGoMobile

S Adece 9.1 milimetrelik akıllı tasarıma sahip ZTE Kis 3 Max, standart FWVGA 4,5 "ekran ve 5MP kamera donanımıyla parlak ve canlı fotoğraflar çekme olanağı sunuyor. Kullanıcının 2MP ön kamera ile kendi cihazını çekebildiği, ayrıca panoramik ve seri çekim gibi çeşitli özelliklere sahip olması. 1.3 GHz çift çekirdekli işlemci ve 4.4.2 Candy Bar işletim sistemi kullanıcıya hızlı ve sorunsuz bir …

Devamını Oku »

Sharp Galapagos 3 Boyutlu Telefon LetsGoMobile

S Harp Elektronik, dünyanın en büyük 3D görüntüsü Android'in akıllı telefonunu tanıttı. Android 2.2 Froyo işletim sistemi ile Sharp Galapagos akıllı telefon 3,8 inç büyük ekran LCD ekranında 3D grafikleri destekliyor. 3 boyutlu Sharp 3D akıllı telefonun 3,8 inç büyüklüğündeki LCD ekranı 480 x 800 piksel çözünürlüğünde çoklu temas dokunmatik özelliği sunuyor. Sharp Galapagos telefonun 3D ekranı özel gözlüklere gerek …

Devamını Oku »

Abdest ve Namaz Öğreniyorum – 3

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

LYS 3 Edebiyat Coğrafya sınavı bugün gerçekleşti

                      18 06 2017                                                                                                                                                           Bugün gerçekleşilen LYS 3 Edebiyat Coğrafya sınavının ardından ÖSYM 13:30 itibariyle sınav soru ve cevaplarını adayların girişine açtı. LYS, ÖSYM'nin sitesi üzerinden bu işlemi gerçekleştirtirebiliyor.

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Ramazan'a özel 3 leziz çorba

<! – düzenle 3: Bir sonraki reklam alanına yalnızca yazı içeriğinde sayfanın bir sonraki sayfaya gelinmesi. Bu alan şu bir reklamla boş bir alan gözükmeyecektir. Zaten reklam koymayacağım diyorsanız bir şey yaprağı yok. Eğer reklamın koyacağım derseniz ise alanın nasıl kullanılacağına dair bilgi ve açıklamaları okumaya devam ediniz: Eğer bu alan reklam yayınlamayı düşünürseniz Öncelikle 2 satır ve 12 satır …

Devamını Oku »

Sony SmartWatch 3 paslanmaz çelik akıllı saat LetsGoMobile

S Ony SmartWatch 3 Android giyilebilir teknoloji – Sony, giyilebilir teknoloji ürünleri ailesinin SmartWear akıllı cihazlar serinden yeni üyesini duyurdu. Zarif ve paslanmaz çelik gövdesi ile yeni SmartWatch 3 akıllı saat Lifelog işbirliği ile çoklu sensör, sugeçirmez başlık prototipi gibi özellikleri ile dikkat çekiyor. Sony SmartWatch 3 akıllı saatte ötesinde estetiği ile paslanmaz çelik malzemeden gövdede güzel tasarımı bir araya …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Samsung Galaxy S2 3 milyon satıldı LetsGoMobile

S Samsung Galaxy S2 (Samsung GT-I9100) akıllı telefon cep telefonu modeli piyasaya sunulacakken bu tüm dünyada çapında 3 milyon satış rakamını aşmış durumda. Piyasaya sürülmesinin ardından 55 gün içinde 3 milyon satış rakamını yakalayan Samsung Galaxy S2 akıllı telefon akıllı telefonda bu işlem 1,5 saniyede 1 adet satmış oldu. Samsung Galaxy S2 cep telefonu performansı ile kendinden önceki rekoru elinde …

Devamını Oku »

Alcatel OneTouch PIXI 3 LetsGoMobile

bir lcatel OT PIXI 3 akıllı telefonlar – Alcatel One Touch firması PIXI Ürün Ailesinin Üçüncü nesil akıllı cep telefonu modellerini tanıttı. 3G / 4G Bağlantıları çoklu ettik işletim sistemlerini Destekleyen yeni Alcatel OneTouch PIXI cep telefonları 3,5 inç Ekranı ile cepte kolayca taşınan modellerden 5 inç ekranlı modele Kadar uzanıyor. 3G / 4G LTE bağlantıya sahip PIXI 3 (4 …

Devamını Oku »

4.SINIF MATEMATİK 1. DÖNEM 3. YAZILISI

                     2017-06-10 19:59:00                                                                                   Adım Soyadım: …………………………………………. No: …………… MATEMATİK 1.DÖNEM 3. YAZILI DEĞERLENDİRMESİ 1) 78 <B <85 Sıralamasında B bir tek doğal sayıdır. Buna göre kullanılabilirlik hangisi B sayısı olamaz? A) 79B) 81C) 82D) 83 2) Aşağıdan doğal sayılardan hangisi çift doğal sayıdır? A) 200015 B) 79816 C) 2017 D) 641 3) Ardışık beş çift sayının en …

Devamını Oku »

4.SINIF MATEMATİK 2. DÖNEM 3. YAZILISI

                     2017-06-10 20:04:00                                                                                   Adım Soyadım: ……………………………………… Hayır: ……… 4-A SINIFI MATEMATİK 3. YAZILI DEĞERLENDİRME SORULARI için uygun değildir. Nokta yerlere, ifadeler doğru olur "D" yanlış ise "Y" yazınız. (….) 1 – 125 metre, 1205 santimetreye eşittir. (….) 2-7 kilometre, 700 metreye eşittir. (… ..) 3- Kenar uzunlukları 3 cm, 4 cm ve 5 cm olan üçgen ikizkenar …

Devamını Oku »

Huawei'den yeni akıllı bileklik: Onur Band 3

                     2017-06-08 12:12:00                                                                      Birleşmiş Milletler'in yeni akıllı telefonlarının çıkışına hazırlanan Huawei, bir yandan yeni akıllı bilekliği Onur Bandı 3'ü resmaya tanıtmaya hazırlanıyor. Geçici olarak yeni bir akıllı bilekliği Onur Bant 2'yi resmen tanıtan Huawei, daha Band 2'nin bir sonraki geçeceği yeni bir akıllı bileklik daha tanıtmaya hazırlanıyor. Huawei Şeref Grubu 3 adını taşıyan bu akıllı bileklik, …

Devamını Oku »

Alcatel Onetouch IDOL 3 akıllı telefon LetsGoMobile

bir Lcatel Onetouch, yeni nesil akıllı telefonu IDOL 3'ü teknoloji tutkunlarının beğenisine sundu. Sınıfının bileşenleri ve yazılımıyla üretilen IDOL 3 Alan lideri tasarımcıların imzasını taşıyor. Dünyada ilk defa karşılıklı yerleştirilen iki JBL hoparlörle konuşabilme imkanı sunuyor IDOL 3, kaliteli müzik dinlemeyi sevenleri ise yeni bir deneyimle buluşturuyor. Alcatel Onetouch IDOL 3 özellikleri 4.7 inç ve 5.5 inç'e ait iki modeli …

Devamını Oku »

Prada LG 3 LetsGoMobile

p rada LG 3 cep telefonu: Prada ve LG Electronics Kore'nin özel cep telefonu üretimli alanındaki işbirliği ve ortaklıklarını yenilediler. LG 3.0 ile yeni bir Prada cep telefonu geliştirecekleri açıklandı. LG ve Prada işbirliği 2006 senesinde başlamış ve 2007 ve 2008 yıllarında tanıtılan iki özel cep telefonu modeli ile meyvesini vermişti. Yeni Prada LG 3 cep telefonuunun 2012 yılının ilk …

Devamını Oku »

LG Prada 3 LetsGoMobile

L G Prada 3 cep telefonu PRADA'nın kendine has stilini, LG'nin yenilikçi teknolojisi ile birleştirerek, 4.3 inç ve 800-nit özellikleriyle dünyanın en büyük ve en parlak ekranını sunuyor. PRADA'nın temiz ve keskin dizayn felsefesiyle üretilen telefonların komple parlak dokunmatik ekranı ve PRADA'nın imzası üzerinden gelen Saffiano desenli arka tarafı, siyah rengin klasik şıklığıyla tamamlanıyor. LG Prada 3 Özenle işlendi. 8.5 …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Asus Zenfone 3 Lazer Özellikleri

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/asus-zenfone-3-lazer-ozellikleri.orgtr/ajax/specs/showcomments', { PostBody: 'spec_id = 4127', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev expand_comment (id) { Var disp = $ ('comment_content _' + id) .style.display; If (disp == 'none') { $ ( 'COMMENT_CONTENT _' + id) .style.display = "http://turkcebilgisi.com/wp-content/uploads/2017/06/asus-zenfone-3-lazer-ozellikleri.org"; $ ( 'C_e_i _' + id) .src = comment_close.src; $ ( 'C_h …

Devamını Oku »

Asus Zenfone 3 Max Özellikleri

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/asus-zenfone-3-max-ozellikleri.orgtr/ajax/specs/showcomments', { PostBody: 'spec_id = 4128', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev expand_comment (id) { Var disp = $ ('comment_content _' + id) .style.display; If (disp == 'none') { $ ( 'COMMENT_CONTENT _' + id) .style.display = "http://turkcebilgisi.com/wp-content/uploads/2017/06/asus-zenfone-3-max-ozellikleri.org"; $ ( 'C_e_i _' + id) .src = comment_close.src; $ ( 'C_h …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 3 Haziran 2017 Cumartesi 08:00 – 4 Haziran 2017 Pazar 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 3 …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 3 Haziran 2017 Cumartesi 08:00 – 4 Haziran 2017 Pazar 08:00 Bir önceki yazımız olan 3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 3 Haziran 2017 Cumartesi Akçaabat nöbetçi eczane, 3 Haziran 2017 …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 3 Haziran 2017 Cumartesi 08:00 – 4 Haziran 2017 Pazar 08:00 Bir önceki yazımızda 3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 3 Haziran …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 3 Haziran 2017 Cumartesi 08:00 – 4 Haziran 2017 Pazar 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 3 Haziran 2017 …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 2 Haziran 2017 Cuma nöbetçi eczane, 2 Haziran 2017 Cuma Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımızda 2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 2 Haziran 2017 Cuma nöbetçi eczane, 2 Haziran 2017 …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 3 Haziran 2017 Cumartesi 08:00 – 4 Haziran 2017 Pazar 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 3 Haziran 2017 Cumartesi 08:00 – …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

Haftalı Android Uygulamaları – 3 Haziran

Android işletim sistemli cihazınızın uygulama mağazası olan Google Play Store ' da öne çıkan uygulamalar sizler için önerdik. Her hafta düzenli olarak devam ettik Haftanın Android Uygulamaları ile siz değerli okurlarımızla yeniden birleştir. Haftanın en iyisi ve yeni Android uygulamaları! Shiftdelete.Net ekibi olarak, hafta için özler başarılı başarılı Android uygulamayıbir araya getireceğiz. İşte karşınızda Haftanın Android Uygulamaları! Mikser Oluştur Beta …

Devamını Oku »

3 Haziran 2017 Cumartesi – 4 Haziran 2017 Pazar Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

Autoweek Podcast ep. 3 konuk Spencer Pigot'la

     Hisse      Facebook          Cıvıldamak          Pinterest          e-posta             Autoweek Podcast'in bu bölümünde, ev sahibi Rory Carroll, Robin Warner ve Mike Pryson'la birlikte yarışın en iyi haftasonu – Coca-Cola 600, Indianapolis 500 ve Monaco Grand Prix – hakkında konuşuyor. Ayrıca, konuk oyuncusu Spencer Pigot da, tarih yarışları go-kartları ve direksiyonda nasıl bir kariyere yol açtığını konuşmak için …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 2 …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Bir önceki yazımızda 2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 2 Haziran 2017 Cuma Akçaabat nöbetçi eczane, 2 Haziran 2017 Cuma …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Bir önceki yazımız olan 2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 2 …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 2 Haziran 2017 …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 1 Haziran 2017 Perşembe – 2 Haziran 2017 Cuma Tunceli Nöbetçi Eczaneler başlıklı makalemizde 1 Haziran 2017 Perşembe nöbetçi eczane, 1 Haziran 2017 Perşembe Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımızda 1 Haziran 2017 Perşembe – 2 Haziran 2017 Cuma Uşak Nöbetçi Eczaneler başlıklı makalemizde 1 Haziran 2017 Perşembe günü nöbetçi eczane, 1 Haziran …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ec …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 2 Haziran 2017 Cuma 08:00 – …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi İzmir / Gümüşpala Nöbetçi Eczaneler | Türkiyenin En Yen …

35 İzmir Nöbetçi Eczaneler Adres : 1847/17 Sk 7 / B Postacılar Gerbay SO Karş İl / İlçe : İzmir / Gümüşpala Nöbet : 2 Haziran 2017 Cuma 08:00 – 3 Haziran 2017 Cumartesi 08:00 Bir önceki yazımız 2 Haziran 2017 Cuma – 3 Haziran 2017 Cumartesi İzmir / Gediz Nöbetçi Eczaneler başlıklı makalemizde 2 Haziran 2017 Cuma Aliağa nöbetçi …

Devamını Oku »

Real Racing 3 v5.3.0 Android Para Hile MOD APK indir

Gerçek Racing 3 v5.3.0 Android Para, Altın Hile MOD APK indir te " ücretsiz " olarak indirilmeye izin verilen en iyi araba yarışı oyunları ndan birisi şüphesizki Gerçek Racing 3 oyunudur. Diğer serileri gibi Gerçek Yarış 3 'de çok fazla indirilme sayısına ulaştı. Oyun içi grafiklerin ve efektlerin kalitesi, ses efektlerinin çok iyi olması, oyun içi çok fazla alternatifin olması …

Devamını Oku »

PlayStation 3 resmen bitti! – ShiftDelete.Net

2006 yılından beri bu yana pazarda olan PlayStation 3 oyunu konsolunun üretime resmi olarak durduruldu. PlayStation 3 üretimi durduruldu! Gematsu tarafından yayınlanan rapora göre 2006 yıl konsol pazarına giren PlayStation 3 oyun konsolunun üretimi resmi olarak durduruldu. Kasım 2006'da duyurulan PlayStation 3, satış bazında olmasa bile teknik donanım noktasında bir önceki model PlayStation 2'ye oranla çok ciddi bir gelişme gösterişti. …

Devamını Oku »

Sony PlayStation 3 incelemesi

Bölüm Seç: 1. Tanıtım 2. Kullanim & Bellek 3. SONUÇ Sony PlayStation 3 incelemesi | Tanıtım Yayın tarihi: Yazan: Dennis Hissink – Fotoğraf: Mark Peters S Incadair, atari ve commodore oyun konsolları zamanında büyümüş veya da oyun dünyası ile kişisel bilgisayarlar ilgileri tek başlarına veya çevrimiçi tanışmış olan ve aynı zamanda da dijital fotoğrafçılık "ciddi ve sorumlu" bir hobi olarak …

Devamını Oku »

Ankara keçiören baymak kombi servisi 0312 357 02 3 …

                          0 Takipçi | 29 Takip Kategorilerim                                              Diğer İçeriklerim (210)                          Tüm içeriklerim Takipçilerim (0)                        29 05 2017                                                                                   0312 357 0238 ankara baymak kombi servisi keciören-baymak-kombi-şifresi komşu bayraklar kombi servisi mamak baymak kombi servisi kayaş baymak kombi servisi tandoğan baymak kombi servisi polatlı baymak kombi servisi doğantepe baymak kombi servisi akyurt baymak …

Devamını Oku »

3 Numara Saç Modelleri

Günümüz koşullarında tek hanımlar değil artık erkekler de dış görünüşlerine büyük bir ehemmiyet vermeye başlamaktadır. Tepeden tırnağa onun anlamda daha bakımlı olmak ve görünmek isteyen erkekler için farklı saç modeli sözü mevzusu olmaya adım atmıştır. Son yıllarda uzun saçların farklı şekillendirici ürünleri ile biçimler elde edildiğinde saç modeli büyük birleş görmektedir. 3 numara traş da yapılmaktadır. Fakat klasikten asla çok …

Devamını Oku »

Fiyatı 500 bin Euro ve sadece 3 adet gelecek

                     2017-05-29 11:04:00                                                                      Japon üretici Honda'nın efsanevi süper spor otomobili Türkiye yollarına çıktı. Ülkemizde sadece 500 bin Euro karşılığında süper sporadın fiyatı. Japon üretici Honda'nın efsanevi süper spor otomobili Türkiye yollarına çıktı. Ülkemizde sadece 500 bin Euro karşılığında süper sporcunun fiyatı da 3 tane satıldı. Otomobil, otomobil, motosiklet, otomobil, otomobil, otomobil, çift turbo, beslemeli 3.5 litrelik …

Devamını Oku »

Tesla Model 3 yeniden yolda görüntülendi!

Tesla 'nın, geçtiğimiz yıl duyurusunu gerçekleştirdiği yeni otomobili Model 3 hakkında elde edilen her detay daha önce sizlere aktarmıştık. 35 bin dolar seviyesinden sonra siparişe açılan Model 3 için şimdiden 400 bine yakın sipariş alan Tesla, geliştirme çalışmalarına hız kesmeden devam ederken, otomobil bir kez daha yolda görüntülendi. 0-100 km / h'ye 6 saniyeden daha kısa bir sürede çıkarak uygun …

Devamını Oku »

Demet Akalın, Oğuzhan Koç, 3 Adam'a sert …

                     2017-05-28 10:50:00                                                                      Demet Akalın, sosyal medya hesabı boyunca '3 Adam' ekibinden Oğuzhan Koç'a yüklendi. Şarkıcı Demet Akalın, geride bıraktığımız günlerde Eser Yenenler 3 Adem yüklendi ve onları sevmediğini söylemişti. 3 Adam cephesinden Akalın'ın bu çıkışına şimdiye kadar bir tepki gelmemişti, sessizliği Oğuzhan Koç bozdu. Katıldığı bir etkinlikte Gülşen'in 'Bangır Bangır' şarkısıyla Demet Akalın'ı icat eden …

Devamını Oku »

Samsung Galaxy Folder 3 çıktı çıktı!

Gün geçmiyor ki bir sızıntı haberiyle daha sizlerin karşısına çıkmayalım. 'un ' un TENAA onayı alırken görünen yeni Klasör serisi akıllı telefonu. Bu gülümse, Samsung'un yeni telefonuyla çıktı! TENAA onayı alan SM-G9298 model etiket, Samsung marka yeni bir kapaklı telefon listelendi . Klasör serisinin yeni üyesi Galaxy Klasör 3 olduğu söyleniyor. İç dış taraftan olmak üzere 5 inç boyutunda ve …

Devamını Oku »

LG Stylo 3 Plus Özellikleri

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/05/lg-stylo-3-plus-ozellikleri.orgtr/ajax/specs/showcomments', { PostBody: 'spec_id = 4312', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev expand_comment (id) { Var disp = $ ('comment_content _' + id) .style.display; If (disp == 'none') { $ ( 'COMMENT_CONTENT _' + id) .style.display = "http://turkcebilgisi.com/wp-content/uploads/2017/05/lg-stylo-3-plus-ozellikleri.org"; $ ( 'C_e_i _' + id) .src = comment_close.src; $ ( 'C_h …

Devamını Oku »

Tesla Model 3, 5.6 Saniyede 0-60 MPH Gidebilir, Grafik Gösterir

215 milin üzerinde bir menzili var Ücretsiz Fiyat Teklifi bir Yerel Bayi No Obligation, Hızlı ve Basit Ücretsiz Yeni Araç Alıntı Aracı Değiştir Marka Seç Acura Alfa Romeo Aston Martin Audi Bentley BMW Buick Kadillak Chevrolet Chrysler Kaçma Ferrari FIAT Ford Genesis GMC Honda Hyundai Infiniti Jaguar Cip Kia Lamborghini Land Rover Lexus Lincoln Lotus Maserati Mazda McLaren Mercedes-Benz MİNİ …

Devamını Oku »

Tesla Model 3 En Az 215 Mil Aralığında Teklif Ediyor »AutoGuide.com News

Yakında çıkacak tüm elektrikli sedanların bazı özellikleri sızdırılmış. İlk önce InsideEVs tarafından rapor edilen bir iç kaynak, Model 3 Sahipleri Kulübü forumundaki bir kullanıcıya Model S ve Model 3 arasındaki bir karşılaştırma görüntüleri gönderdi. Kaynak, Tesla'nın Satış Temsilcileri tarafından Model 3'ü satması için grafik kullanacağını söylüyor; bu nedenle Tesla'nın yakın zamanda resmi olarak yayınlamasını beklemeyin. Road & Track bir Tesla …

Devamını Oku »

Divebomber Pushup'ları Yapmanın 3 Yolu

01:16, 24 Mayıs 2017 itibariyle en son revizyon Mütevazi itme vücut ağırlığı egzersizlerinin apaçık kahramanıdır. Güç oluşturmak ve daha hızlı uyum sağlamak isterseniz, egzersiz rejiminize biraz fazla itme varyasyonu eklemek bunu gerçekleştirmenin bir yoludur. Dalış bombacısı itme işlemi, yorucu bir bütün vücut egzersizi sağlayan böyle bir çeşitliliktir. Dalış-bombardıman güçlerini kontrol ettikten sonra çeşitlilik için rutininize ekleyebileceğiniz diğer itme varyasyonları arayın. …

Devamını Oku »

Türk Telekom K8 ve Stylus 3 cep telefonları LetsGoMobile

T Ürk Telekom, uygun fiyatlı ve üstün performanslı akıllı cihazlara yenilerini ekledi. LG tarafından Türk Telekom müşterilerine özel geliştirilen Türk Telekom K8 (2017) ve Stylus 3, çok yakında Türk Telekom'un buluşuyla buluşacak. Türkiye'de sadece Türk Telekom mağazalarında satışa sunulacak telefonlar, şık tasarım ve üstün performanslarının yanı sıra uygun fiyatıyla da öne çıkıyor. Ayrıca, Türk Telekom yeni müşterilerine özel 384 TL …

Devamını Oku »