14 Aralık 2017,Perşembe
Anasayfa » Tag Archives: 20

Tag Archives: 20

20 Beş Bileşenli Yan Yemek Tarifleri İğne

Yirmi kolay ve sağlıklı garnitür tarifleri beş maddeden azını gerektiren! Kitabımda, çok az, sağlıklı, kolay garnitür tarifleri bulunmamaktadır! Tatil masanızın mı, yoksa düzenli bir hafta içi akşam yemeğiniz olsun, burada yalnızca beş bileşenli yirmi benim favori yan yemek tariflerim var! Lemon Bowl'tan Kremalı Sarımsak Maskeli Patatesler Büyük Island'daki Görünümden Vanilya Fasülyesi ve Nutmeg ile Kabak Şaplakalı Kabak Bobbi'nin Kozy Mutfak'tan …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Van Nöbetçi Eczaneler

Eczane: Beşyol Eczanesi Telefon: +904322151971 Adres: Beşyol Meydanı Valilik Binası Yanı İl / İlçe: Van / Merkez Nöbet: 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane: Yaşam Eczanesi Telefon: +904322159383 Adres: Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yalova Nöbetçi Eczaneler

Eczane: Çimen Eczanesi Telefon: +902264656567 Adres: Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe: Yalova / Altınova Eczane: Arda Eczanesi Telefon: +902265312896 Adres: Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe: Yalova / Armutlu Eczane: Çiftlikköy Eczanesi Telefon: +902263520580 Adres: Çiftlik Mah. Stadyum Cad.No.31 İl / […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler

Eczane: Taner Eczanesi Telefon: +903543141464 Adres: İstiklal Cad.No:56 İl / İlçe: Yozgat / Akdağmadeni Eczane: Beştaş Eczanesi Telefon: +903544871695 Adres: Yeni Mah .Çekerek Cad.No:2 İl / İlçe: Yozgat / Aydıncık Eczane: Sağlık Eczanesi Telefon: +903546455556 Adres: Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe: […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler

Eczane: Yazicioğlu Eczanesi Telefon: +903723783630 Adres: Merkez Mah.Demırcıler Sok.No:2 İl / İlçe: Zonguldak / Alaplı Eczane: Tuba Eczanesi Telefon: +903726283330 Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe: Zonguldak / Çaycuma Eczane: Saltukova Eczanesi Telefon: +903726182010 Adres: Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl […] Kaynak

Devamını Oku »

Asus Zenwatch için Giyim 2.0 karmaşası!

sonra, geçtiğimiz yıl kullanıcıların kıyısına Zenwatch 3 ile ile ilgili görüşlerini tüm dünyayla paylaş. çıktı. Ancak, Google'ın giyilebilir cihazlar için geliştirmiş olduğu Android Wear 2.0 İşletim sistemi Zenwatch modelleri için yılan hikayesine dönüşmesi, firmanın kullanıcıların tepkilerine maruz kalmasına neden oldu. Zenwatch kullanıcıları Gelecek 2.0 için oldukça kızgın! Asus, Şubat ayında Android Wear 2.0 ile duyuruluyor güncellemesinin Zenwatch 2 ve 3 …

Devamını Oku »

Yumurta Yoğurmanın 20 Sağlıklı Yolu

Bugün sizin menü planınıza eklemeniz için yirmi sağlıklı ve lezzetli yumurta tarifleri! Dört kişilik ailemiz haftada yaklaşık dört düzine yumurta akıyor. Ve iyi niyet için! Bunlar, besin paketli, uygun fiyatlı, çok yönlü ve lezzetli heck gibi. Diyetinize daha fazla yumurta eklemek isteyip istemediğinizi veya bir yumurta tadında sıkıştığınızı düşünün, bugün yumurta kullanan yirmi yeni ve sağlıklı tariflerinizi deneyin! Türkiye ile …

Devamını Oku »

Bahar Ayları İçin 20 Örgü Saç Modeli

Bahar kapıda, hepimize bir sebep oldu safarmaya başladı. Kışın kasvetinden soğuğundan sonra insan güneşi özlemiyor değil. Güneşli bir havayla güne merhaba demek bile etkili bir detoks gibi bünyeye. Havaların güzelleşmesi dış görünüşümüze bile yansıyor. Özellikle de saçlarımıza . Kış aylarında malum hava durumlarından dolayı tarifini şemalini kaybeden saçlar, baharla birlikte canlanıyor, kendini buluyor. Bu bahar aylarında saçlarımıza da bahar getirelim, …

Devamını Oku »

Dövüş Kulübü – Dövüş Oyunları 2.0 Android Para Hile APK indir

Yazar: Gökhan Öğütcü Kategori: Android Aksiyon Oyunları, Android Dövüş Oyunları, Android Hileli Oyunlar 20 Haziran 2017 197 Görüntülenme Fight Club – Dövüş Oyunları 2.0 Android Para Hile MOD APK indir Dövüş Oyunları Dövüş Oyunları-Android-resim "width =" 300 "height =" 300 "/> ] Oyunda size bir dövüşçü olacaksınız. Rakiplerinizle maçlara çıkacak ve maçlarda rakiplerinizden daha iyi bir performans sergileyip çıktığında onun …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Bir önceki yazımız 19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Haziran 2017 Pazartesi Akçaabat nöbetçi eczane, 19 Haziran 2017 Pazartesi …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin E …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Bir önceki yazımız 19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 Haziran …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 Pazar Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi verilmektedir. …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nö …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Her 20 Küçük Şey 20 Bilmeniz Gereken Şeyler …

Seth Doyle 1 . Sadece diplomanız olduğu için sizi başka birinden daha iyi yapmaz. 2 . Bir diploma, rüya işini hemen koparmanızı garanti etmez. 3 . Hayalinizdeki iş sadece kucağınıza düşmeyecek. 4 . Sevdiğiniz birini bulmadan önce birçok boktan işten geçmeniz gerekecek. 5 . Kariyerinizde hata yapmak normaldir. 6 . Her geçen gün çeyrek ömür krizi yaşamak normaldir. 7 . …

Devamını Oku »

20 Sağlıklı Gözleme Tarifleri – Lemon Bowl®

Gluten içermeyen, paleo ve bütün tahıl çeşitleri de dahil olmak üzere internetteki en iyi sağlıklı gözleme tariflerinin bir koleksiyonu. Hayatta kabarık kreplardan daha iyi bir şey var mı? Kuşkusuz, doyurucu karabuğday krepleri yiyerek büyüdüm, bu yüzden bana inanmaya yönlendiren bütün tahıl çeşitliliğini tercih ediyorum – belki de tek değilimdir? İsterseniz onları sulu yaban mersini ile lekeli veya dilimlenmiş muz ve …

Devamını Oku »

Haftanın Android Uygulamaları – 20 Mayıs

Android işletim sistemli cihazınızın uygulama mağazası olan Google Play Store ' da öne çıkan uygulamalar sizler için önerdik. Her hafta düzenli olarak devam edeceğimiz Haftanın Android Uygulamaları ile siz değerli okurlarımızla buluşmaya devam edeceğiz. Haftanın en iyisi ve yeni Android uygulamaları! Shiftdelete.Net ekibi olarak, onun için hafta sizler için 5 başarılı Android uygulamasını bir araya getireceğiz. İşte karşınızda Haftanın Android …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – 21 Mayıs 2017 Pazar 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 20 …

Devamını Oku »

20 Mayıs 2017 Pazartesi – 21 Mayıs 2017 Pazar Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – 21 Mayıs 2017 Pazar 08:00 20 Mayıs 2017 Cumartesi nöbetçi eczane ve 20 Mayıs 2017 Cumartesi Trabzon'da nöbetçi eczane hakkında bilgi verilmektedir. Onun günleri güncel ve kesin bilgiyi vererek sizlere nöbetçi eczanelerin nerede olduğunu belirtiyoruz.Mobil …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – 21 Mayıs 2017 Pazar 08:00 20 Mayıs 2017 Cumartesi nöbetçi eczane ve 20 Mayıs 2017 Cumartesi Trabzon'da nöbetçi eczane hakkında bilgi verilmektedir. Onun günleri güncel ve …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni N …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – 21 Mayıs 2017 Pazar 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 20 Mayıs 2017 …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 19 Mayıs 2017 Cuma nöbetçi eczane, 19 Mayıs 2017 Cuma Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ec …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 19 Mayıs 2017 Cuma nöbetçi eczane, 19 Mayıs …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecz …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – 21 Mayıs 2017 Pazar 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 20 Mayıs 2017 Cumartesi 08:00 – …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

20 Mayıs 2017 Cumartesi – 21 Mayıs 2017 Pazar Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Mayıs 2017 Cuma Akçaabat nöbetçi eczane, 19 Mayıs 2017 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni Nö …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Mayıs 2017 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 16 Mayıs 2017 Salı – 17 Mayıs 2017 Çarşamba Tunceli Nöbetçi Eczaneler başlıklı makalemizde 16 Mayıs 2017 Salı nöbetçi eczane, 16 Mayıs 2017 Salı Tunceli nöbetçi ekzane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecz …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 16 Mayıs 2017 Salı – 17 Mayıs 2017 Çarşamba Uşak Nöbetçi Eczaneler başlıklı makalemizde 16 Mayıs 2017 Salı nöbetçi eczane, 16 Mayıs …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecza …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Mayıs 2017 Cuma 08:00 – …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi'nin Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi İzmir / Dikili Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

35 İzmir Nöbetçi Eczaneler, Dikili Nöbetçi Eczaneler Eczane : Dağlı Eczanesi Adres : İSMETPAŞA MH 9 SK NO 41 İl / İlçe : İzmir / Dikili Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi İzmir / Çiğli Nöbetçi Eczaneler başlıklı makalemizde 19 …

Devamını Oku »

1998 ve 2015 arasındaki çarpışma testi Ölüm hızı, eski araçlarda 4 kat daha yüksekti Avustralya ve Yeni Zelanda'nın bağımsız araç güvenlik grubu ANCAP, iki yıl arasında yapılan bir çarpışmayı, 1998 ve 2015 yılları arasında Corollas (2015 Corolla, İngiltere'de Toyota Auris olarak bilinir) yeni ve eski arabalar arasındaki güvenlik özelliklerinin arasındaki farkı sergilemek için. Çarpışma görüntüleri aşağıdaki videoda görülebiliyor – yolcuların modern eşdeğerlerinin yapısal katılıklarına sahip olmayan yaşlanan arabalara maruz kaldıkları muazzam gücü gösteriyor. 2000 yılı öncesinde yapılan araçların, ölümcül bir kaza geçirme olasılığının 2011 yılı sonrasına göre dört kat fazla olduğunu düşündüren analizle ilgili olarak, Corollas çifti birbirlerine 40 mil hızla başlatıldı. ] ANCAP CEO'su James Goodwin, "Eski araba, kukla göstergelerle katastrofik yapısal bozulmayı sürdürdü ve sürücüde ciddi kafa, göğüs ve bacak yaralanması riski çok yüksekti" dedi. "16 puantan sadece 0,40 puan – sıfır yıldız elde etti. "Bunun aksine, mevcut model 16 puantan 12.93'ü bulan beş yıldızlı bir koruma seviyesiyle çok iyi performans gösterdi. "Güvenlik, lüks değil, herkesi yolda güvende tutmak istiyoruz; bu nedenle tüketiciler, gündüzleri güvendiği en güvenli otomobil ve ihtiyaçlarına en güvenli otomobil arayın" Deney, Euro NCAP tarafından 2017 yılının başlarında gerçekleştirilen ve Rover 100'in 1997'den yeni Honda Caz tarafından 40 mil / saat hızla düşürülmesiyle sonuçlanan başka bir teste benzemektedir; bu durumda Bir duvarın içine. İzle: 40mph kazasında Rover 100 ve Honda Jazz Şu anda satışa sunulan en güvenli supermini olan Jazz, etkisinden sonra şeklini korurken, 20 yaşındaki Rover neredeyse parçalandı. Avustralya araç filosundaki verileri analiz eden ANCAP, ulusal araç nüfusunun yalnızca yüzde 20'sini temsil etmesine rağmen, 2000 yılı öncesi modellerin ölüm oranına neden olan kazaların yüzde 33'ünde yer aldığını tespit etti. Bununla birlikte, 2011 sonrası araçların Avustralya yollarındaki tüm arabaların yüzde 31'ini oluşturmasına rağmen, yalnızca birinin öldüğü çarpışmaların yüzde 13'ünde yer alırlar. Goodwin, "Ölümcül kazaların oranı eski araçlar için dört kat daha fazladır" dedi. "Ölümcül bir çarpışmaya karışan bir aracın ortalama yaşını takip ediyoruz ve sadece bir yılda ortalama 12.5 yıldan 12.9 yıla yükseldiğini gördük. Bu, yenilenen bir ulusal odağın ve daha güvenli araçlar için daha büyük desteğin gerekliliğini vurguluyor. " Benzer yol, Yeni Sürüş Yolcu Araçlarının Ortalama Yaşının 14.3 Yaş olduğu Yeni Zelanda'da Bulunmuştur, Fakat Ölümcül Çökmelere Yerleştirilen Aracların Ortalama Yaşı 15.6 Yıldır.

Yeni bir araba satın alırken modern güvenlik cihazları ne kadar önemlidir? Aşağıdaki yorum bölümünde bize bildirin … Kaynak

Devamını Oku »

BTK Başkanı, WanaCrypt0r 2.0 virüsü konusunda uyardı!

Dün sabah saatlerinde WanaCrypt0r 2.0 ya da kısa adıyla Wrocry virüsüne başlatılan saldırılar, 74 ülkeyi ve 50 bini aşkın bilgisayararı etkisi altına alarak, bir anda internetin ana gündemi haline geldi. Hastahane, telekominikasyon ve finans şirketleri gibi ülkelerin kritik kurumlarına düzenlenen siber saldırılarda kullanılan Wcry virüsü, dosyalar şifrelenerek Bitcoin ile oldukça yüklü miktarda fidye isteniyor. Bilgi Teknolojileri ve İletişim Kurulu Başkanı …

Devamını Oku »

WanaCrypt0r 2.0 virüsü nedir, saldırı kimleri etkisini?

Tüm dünya, WanaCrypt0r 2.0 saldırısı ile çalkalanıyor. Rusya ve Çin'deki devletlerin verdiği göre daha çok saldırı, diğer ülkelerde de yayılmış durumda. Yapılan açıklamalara göre 74 ülke, Crypt0r 2.0 saldırısından dolayı zarar görürken, ülkemizde de bu ataklardan etkilenen sistemler olduğu belirtildi. WanaCrypt0r 2.0 saldırısı için açıklama BTK'nın açıkladığı bilgilere göre, küresel siber saldırıları ülkemizde izleyen ve gerekçelerde önlemleri alanUlusal Siber Olaylara …

Devamını Oku »

20 Adorable Ash Kelebek Saç Stilleri Deneyin: Saç Rengi Fikirleri 2017

Saç sarması renk sarışın çok inanılmaz derecede çok yönlüdür. Buzlu bir ağartılmış sarışın, canlı bir altın sarışın veya süper serin bir kül sarısı içerebilirsin. İkincisi, inkar edilemez şekilde bizim favori rengimiz ve bu yüzden bugün bu muhteşem tarzı keşfetmeyi seçtik. Sarı sarışın olağanüstü bir gölge saçınıza boyamaya doğru itmeye yardımcı olmak için sarışın saç stili ilham fikirleri gibi süper şık …

Devamını Oku »

Huawei Watch, Beta olarak Android Wear 2.0 ile buluştu!

2015, Android Wear işletim sistemi ile çalışan ilk akıllı saati olan Huawei Watch için, Android Wear 2.0 güncellemesi uzun süredir bekleniyor. Nihayet güncelleme konusunda sessizliği bozan Huawei Android Wear 2.0 güncellemesi için test başlatmak için başlattığını duyurdu. Huawei Watch for Android Wear 2.0 test süreci! Geliştirici önizleme programına kayıtlı olan Huawei Watch modelleri için yayınlanan Android Wear 2.0 güncellemesi, normalde …

Devamını Oku »

20 Güzel Sarışın Balayage Saç Rengi Fikirleri

Blonde çok yönlü bir saç rengidir! Sıcak bir karamelden kül sarışına, canlı bir beyazlatıcıya ve buzlu bir beyaza kadar her biri sonuncusu harika olan çeşitli çarpıcı tonlarda gelir. Balayage, doğal olarak bir rengi diğerine karıştıran inanılmaz bir saç boyama geçişidir. Sarışın ve balayajı birleştirmek modanın en güzel saç modellerini oluşturabilir – bunları bu kullanışlı blog yazısında topladık. İşte sizin için …

Devamını Oku »

Kısa Saçlar İçin 20 Muhteşem Balo Saç stili Tasarımları: Prom Saç Stilleri 2017

Eğer baloya doğru gidiyorsanız hiç şüphesiz hayatınızın en özel gecelerinden biri olacak. İnanılmaz bir elbise seçeceksiniz, mükemmellik için makyaj uygulayacaksınız ve en iyi görünene kadar saçınızı şekillendireceksiniz, akşamınızı anılarınızdan sonsuza kadar çimentosuz hale getireceksiniz. Uzun saç, çeşitli şekillerde stil vermenize izin veren, çok yönlü olduğu için ünlüdür, ancak kısa saç tarzı için biraz daha zor olabilir. PoPular Haircuts, baloda göze …

Devamını Oku »

20 Muhteşem Yaz Saç Rengi Fikirleri

Sezonun değişmesi, bakışınızı değiştirmek ve biraz farklı bir şey seçmek için mükemmel bir fırsat sunuyor. Saç renginizi değiştirmek size tamamen yeni bir görünüm sunabilir. Makyaj rutini ona göre ayarlamanız, yeni giysinizle uyuşmak için yeni bir gardıropa yatırım yapmanız ve sonsuza kadar güven vermeniz gerekir. Bunun hakkında sevmeyecek ne var? İşte en iyi ilhamınız için yaz için 20 şaşırtıcı saç rengi. …

Devamını Oku »

20+ Çok Kısa Saç Stilleri Resimleri Her Leydi Görmeye İhtiyacınız Var | Kısa Saç Stilleri 2016 – 2017

Süper kısa saç kesimi yapmak ya da başınızı tıraş etmek için saçlarınızı kesmeyi hiç düşündünüz mü? Gerçekten yüz özelliklerini vurgulamak ve gerçek güzelliğini sergilemek için bir ömür boyu kısa süren bir saç kesimi ile gidebilirsiniz. 1. Soğuk Tıraşlı Kısa Saç Stilleri Tıraşlı stilin güzel yüzünü gösterebildiğini ve gözlerinin renginin açılmasını sağlayacak kadar yoğun olan bu saç dönüşümü. Kaynak 2. Çok …

Devamını Oku »

İşte Şevket Çoruh'un 20 yaşındaki kızı

                     2017-04-22 10:31:00                                           Kanal D ekranlarında 12 yıldır yayınlanan Arka Sokaklar dizisinde Komiser Mesut'u can düzenleyen Şevket Çoruh kız babası … 1993 yılında kendisi gibi oyuncu olan Günay Karacaoğlu ile evlenen Şevket Çoruh, o evliliğinden bir kız sahibi oldu. Ünlü çiftin 1997'de Gülenay ismini verdikleri bir de kızları oldu. Fakat sonradan Şevket Çoruh ile Günay Karacaoğlu ani bir …

Devamını Oku »

Yeni 2017 Volkswagen Polo GTI 2,0 litre güç için ayarlandı

Yepyeni bir Volkswagen Polo'nun bu yılın ilerleyen saatlerinde görünmesi planlanıyor ve doğal olarak yeni bir GTI rozetli sıcak kaportası sürümü izleyecek. Bir sonraki Polo GTI hakkında biraz bilgi sahibi olduğumuz halde VW, motor kaputunun altında ne bulacağımızı doğruladı. Önceki Golf GTI'sinden 197 bhp 2.0 TSI, bir sonraki sıcak süpermimisinde yer alacak; bu, onun yerine geçecek olanın daha güçlü ve belirgin …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 20 Nisan 2017 Perşembe 08:00 – 21 Nisan 2017 Cuma 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 20 …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni N …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 20 Nisan 2017 Perşembe 08:00 – 21 Nisan 2017 Cuma 08:00 Bir önceki yazımız olan 20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 20 Nisan 2017 Perşembe Akçaabat nöbetçi eczane, 20 Nisan 2017 …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 20 Nisan 2017 Perşembe 08:00 – 21 Nisan 2017 Cuma 08:00 Bir önceki yazımız olan 20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 20 …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 20 Nisan 2017 Perşembe 08:00 – 21 Nisan 2017 Cuma 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 20 Nisan 2017 …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Tunceli Nöbetçi Eczaneler başlıklı makalemizde 19 Nisan 2017 Çarşamba nöbetçi eczane, 19 Nisan 2017 Çarşamba Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecza …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Uşak Nöbetçi Eczaneler başlıklı makalemizde 19 Nisan 2017 Çarşamba nöbetçi eczane, 19 Nisan …

Devamını Oku »

20 Nisan 2017 Perşembe – 21 Nisan 2017 Cuma Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Eczan …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 20 Nisan 2017 Perşembe 08:00 – 21 Nisan 2017 Cuma 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 20 Nisan 2017 Perşembe 08:00 – …

Devamını Oku »

20 Kolay Avokado Tarifleri – Lemon Bowl®

Kahvaltı, öğle yemeği, akşam yemeği ve arasında her şey için yirmi sağlıklı ve kolay avokado tarifi listesine git! Avokado çılgınlığı hala tam güce ve iyi bir sebep! Avokados, kalp-sağlıklı omega-3 yağ asitleri ile birlikte, herhangi bir reçete ile zengin ve kremsi bir doku sağlar; böylece, tam ve memnun kalmanıza yardımcı olur. Bu yazıya yer işareti koyduğunuzdan ve bir sonraki haftalık …

Devamını Oku »