23 Kasım 2017,Perşembe
Anasayfa » Tag Archives: 2

Tag Archives: 2

1 Ağustos 2017 Salı – 2 Ağustos 2017 Çarşamba Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

67 Zonguldak Nöbetçi Eczaneler Bir önceki yazımız olan 1 Ağustos 2017 Çalşamba Zonguldak Nöbetçi Eczaneler başlıklı makalemizde 1 Ağustos 2017 Salı nöbetçi eczane, 1 Ağustos 2017 Salı Zonguldak nöbetçi eczane ve bugün Zonguldak nöbetçi eczaneler hakkında bilgi veriyoruz. Onun günleri güncel ve kesin bilgiyi vererek sizlere nöbetçi eczanelerin nerede olduğunu belirtiyoruz.Mobil uyumlu web sitemizden arama motorunu kullanma noktasında nöbetçi eczane …

Devamını Oku »

Stranger Things 2. Sezon Coğrafya Tarihi

İlköğretim bölümünde son bölümüne varıncaya kadar heyecan, korku ve merakı doruklarına kadar yaşatan dizi Yabancı Varlıklar için, netflix 'in resmi Twitter ] Hesaptan yapılışı bir paylaşım ile 2. Sezon başlangıç ​​tarihi resmi olarak duyuruldu. Stranger Things 2. Sezon Çıplak Tarihi! Birinci okunmamış sayılar – poster ve kısa fragmanla beraber sevilen Netflix dizisi Stranger Things İçin 2. Sezon başlangıç tarih olarak …

Devamını Oku »

Battlefield 1 ve Titanfall 2 bedava oynanacak

Battlefield 1 ve Titanfall 2 firmanın paralı üyelik sistemi olan EA Erişim Elektronik Sanatlar 'in geçtiğimiz sına sonu marketsaya sunduğu ve Kök Erişim 'ek ekleniyor. Aylık olarak Microsoft Xbox One için 12 TL ve yıllık 65 TL ödenerek üye olunan EA Erişim sisteminde ve aylık olarak ] 29.49 € ödenerek PC için bir üye olun Origin Access bir daha bir …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Huawei Ascend Mate 2 4G LetsGoMobile

C ES 2014 Fuarı – Huawei Ascend Mate 2 – 4G akıllı telefon – Huawei, Las Vegas'ta düzenlenen CES Tüketici Elektroniği Fuarında 6,1 inçlik ekrana sahip olan Huawei Ascend Mate 2-4G akıllı telefonun tanıtımını gerçekleştirdi. CES fuarında, phablet sınıfındaki öncü tasarım Ascend Mate, dev ekranına eşlik eden hafifliği ve yüksek kapasiteli pil performansı ile dikkat çekti. 7-10 Ocak tarihleri ​​arasında …

Devamını Oku »

Xiaomi Mi Mix 2 hız testinde göründü!

Xiaomi Mi Mix 2 hakkında yeni gelişmeler yaşanıyor. Yaşanan gelişmeler ile birlikte Xiaomi 'nin yeni amiral gemisi Mi Mix 2'nin özelliklerini tamamen ortaya çıktı. Xiaomi Mi Mix 2'nin teknik özellikleri belli oldu! Bu yıl yine kullanıcıların karşısına iddialı bir model ile çıkacak olan Teknoloji devi Mi Mix 2 modeliyle bu duruşunu bozmayı düşünmüyor. Kullanıcıların sunacağı yeni telefon bugün Benchmark testinde …

Devamını Oku »

Deniz Savaşı 2 1.5.6 Android Para Hile MOD APK indir

Deniz Savaşı 2 1.5.6 Android Para Hile MOD APK indir Deniz Savaşı 2 1.5.6 Android Para ve Kilitler Açık Hile MOD APK indir Oyunda siz rakiplerinizle deniz savaşlarına gireceksiniz. Rakiplerinize karşı mücadele edecek ve mücadeleleri kazanmaya çalışacaksınız. Sizde bu heyecan dolu oyunu oynamak ve alt linklerimizden oyunu indirip hemen oynamaya başlayabilirsiniz.

Devamını Oku »

Mad Skills Motocross 2 2.5.9 Android Hile MOD APK indir

Mad Skills Motocross 2 2.5.9 Android Hile MOD APK indir Mad Skills Motocross 2 "width =" 300 "height =" 300 "/> Mad Skills Motocross 2 2.5.9 Android Kilitler Açık Hile MOD APK indir Mad Skills Motocross 2 adlı oyunu "Turborilla" tarafından tasarlanmış bir yarış oyunudur. Oyunda 7 farklı hızlarda kullanımı ile 7 farklı bisiklet vardır. Siz de hızla başarınıza göre …

Devamını Oku »

Arka plan Bebe pedi idrar örneklerinin ilave tanı amaçlı programı Ve kirletilen oran bilinmemektedir. Amaç İdrar yolu enfeksiyonu (İYE) tanısı için bir klinik öngörme kuralı geliştirmek, Ped metodu Tasarım ve ayar 233 İngiltere'de birincil bakım alanlarına <5 yıl hapseten, tedirgin şekilde hasta çocuklar Yöntem İSİ ile semptomların, işaretlerin ve idrar ölçüm çubuğunun test sonuçlarının bağımsız bağlantılarını tanımlamak için lojistik regresyon; Diyagnostik programı, alıcı operatör eğrileri altında alan olarak nicelendirilir (AUROC). Sonuçlar Bebe pedi örnekleri 3205 çocuktan (% 82 yaşlı) elde edildi. <2 yıl;% 48 kadın), kültür sonuçları 2277 (% 71.0) için mevcuttu ve 30 (% 1.3) kültür üzerinde bir İYE vardı. AUROC değeri 0,81 (temiz bulmada 0.87) olan 0.87 (temiz temizlik için 0,90) olan iç doğrulama katsayısı modeli ile kadınlarda seks, kötü kokan idrar, koyu renkli idrar ve bez döküntüsü bulunmaması, ĐYE ile bağımsız olarak ilişkiliydi. Catch), dipstick sonuçları eklenerek. GP'lerin "tanı koyma" AUROC 0.63 (% 95 güven aralıkları [CI] = 0.53 – 0.72) idi. Nappy pad'inin toplam% 12.2'si ve temiz yakalama örneklerinin% 1.8'i 'açıkça kontamine' (risk oranı 6.66,% 95 GA = 4.95 ila 8.96; P <0.001) Sonuç Nappy pad idrar kültürü sonuçları, ebeveynler ve ölçüm çubuğu testleri tarafından rapor edilebilen özellikler ile klinik olarak yararlı olabilir, ancak temiz yakalamayla karşılaştırıldığında daha az doğrudur ve daha sık kontamine olurlar İdrar kültürü Anahtar kelimeler: antibakteriyel ajanlar, tanı, bebek, çocuk hastalıkları, birinci basamak sağlık hizmetleri, idrar yolu enfeksiyonları GİRİŞ Birinci basamak sağlık hizmetlerine başvuran çocukların% 80'inde idrar yolu enfeksiyonu (İYE) kaçırılabilir. 2 İYE'nin doğru teşhisi, antibiyotiklerle aşırı veya düşük tedaviden kaçınmak ve külfetli Pahalı araştırmalar. 3 Bu, tuvalet eğitimli olmayan ve özellikle spesifik olmayan semptomlarla başvuran, ĐY'yi araştırmak için hangi çocuğun araştırılması konusunda karar vermeyi öngören, daha genç, sözlü öncesi çocuklarda önemlidir. 3 Bir idrar örneğinin elde edilmesi, çoğu çocuğun ilk bulunduğu birincil bakımda zaman alıcı ve özellikle zorlayıcı olabilir. 4 Bebeklerdeki küçük bebek bezleri (bezler), 3 İdrar numunesinin basit, güvenilir ve kabul edilebilir olması gerekir ve ebeveynler bez bezlerini kolaylıkla bulurlar. 5 Günlük bebek bezi örneği, gündelik bakımda 1 ve bez bezi idrar koleksiyonunu kullanarak üzerinde raporlar hazırlıyor. Bebeğin% 40'ı. 3 5 Bununla birlikte, klinik yarar Idrar örneğinin bez bezi yönteminden elde edilen bilgiler net değildir, bulaşma oranları diğer örnekleme yöntemlerinden daha yüksek olabilir ve bezlerdeki çocuklar semptomları daha iyi tanımlayabilen ve temiz yakalama örneklemesi daha kolay yaşça büyük çocuklara farklılık göstermektedirler . Suprapubik aspirasyon veya kateterizasyon gibi daha invazif yöntemlerle idrar örnekleri almak, birincil bakım ayarlarının çoğunda uygulanabilir ya da kabul edilebilir değildir. Nasıl bu Birinci basamakta başvuran küçük çocuklarda üriner sistem enfeksiyonlarının (ÜİE) yokluğu. Aşırı veya eksik muamele ve soruşturmayı önlemek için zamanında ve doğru tanı gereklidir. Bu özellikle, tuvalet eğitimini almayan ve belirgin olmayan semptomlarla kendini gösteren ön sözlü çocuklarda zordur. GP'ler kullanıyor ve ebeveynler, hala bebek bezlerinden olan çocuklardan idrar toplamak için bez pedleri tercih ediyor ancak bez bezi örneklerinden türetilen verilerin klinik kullanımı, test çubuk testinin katma değeri ve kontamine numunelerin oranı bilinmemektedir. Bebeğin pedlerinden elde edilen idrarla elde edilen kültür sonuçlarının ebeveynler tarafından bildirilebilen özelliklerle birlikte, üriner inkontinans hastalığına yakalanmış ilköğretim okulunda görev yapan, akut olarak iyi durumda olmayan, okul öncesi çocukların belirlenmesinde klinik olarak yararlı olabileceği ancak Temiz yakalama örneklemesi. Bununla birlikte, kontaminasyon oranları bez pedlerinde temiz yakalama numunelerine göre yaklaşık yedi kat daha fazladır. Birinci basamak sağlık hizmetlerinde çocuklarda temiz tutulan idrar örneklemesi, bu nedenle bez bezi yöntemine göre önceliklendirilmelidir, ancak eğer bebek bezi örneği bez bezleri kullanılarak yapılırsa, test bezi testi ilavesi, tanısal doğruluğu önemli ölçüde geliştirir. Bu çalışmanın amacı, bu nedenle, doku ped yöntemini kullanarak örnekleme dayalı İYE tanısı için bir klinik öngörme kuralı geliştirmek ve "temiz yakalama" idrarı örneklerine dayalı benzer bir kuralla tanı yardımcı programını karşılaştırmaktı. 7 Buna ek olarak, bir bez örneği alınmasından sonra dip çubuğu testinin eklenen tanısal değeri tahmin edildi ve kontaminasyon oranları örnekleme yöntemi ile karşılaştırıldı. YÖNTEM

Devamını Oku »

Asus Zenfone 2 Laser için yeni güncelleme!

Asus, Android 6.0 Marshmallow sürümü ile çalışan Zenfone 2 serisini 7.0 Kullanıcı oyları sunmak için yeni güncellemeler yayınlıyor. ] Zenfone Max ve Zenfone 2 modelleri için yayınlanan güncellemeler ardından bu, Zenfone 2 Lazer modeli yeni bir güncelleme ile buluştu. Peki, Asus'un yayınladığı güncelleme ne gibi değişiklikler ile birlikte geliyor? Gelin, bu sorunun cevabı hep birlikte öğrenelim. Zenfone 2 Laser için …

Devamını Oku »

Haftanın iOS Uygulamaları – 2 Temmuz

iOS mobil işletim sistemi tabanlı cihazların uygulama mağazası App Store'da yer alan farklı kategorilerdeki eğlenceli ve işlevsel uygulamalar ile karşınızdayız. Haftanın en iyisi ve yeni ic uygulamaları ShiftDelete.Net ekibi olarak, hemşire için 5 başarılı iOS uygulamasını bir araya getiriyoruz. holo Çekiminize insanlara ya da hayvanlara ait hologramlar eklendi holrama uygulaması ile keyifli anlar sizleri bekliyor. Hatta oğlu güncellemesiyle 7 Temmuz'da …

Devamını Oku »

Battlefront 2 mikro ödeme sistemi sunacak

tarafından sunulacak Battlefront serisinin 17 Kasım tarihinde sunulacak yeni oyun Battlefront II hem oyuncular hem de Star Wars hayranları tarafından heyecanla ivme yakalaması bekleniyor. mikro ödeme sistemine dairlerin ortaya çıkmış oynanış içeriği çok oyuncunun canını sıkabilir. Battlefront 2 mikro ödeme sistemiyle geliyor! Son haberere göre, Yıldız Savaşları Battlefront 2 için mikro ödeme yapanlardan oyunculara birçok içeriğe hızlı ve daha kolay …

Devamını Oku »

Top Gun 2 vizyon tarihi belli oldu

'un, ' un, 1986 tarihinde Kelly McGillis ile başrol oynamış efsanevi film olan Top Gun 'ın devamı olan Top Gun: Maverick geçtiğimiz ay boyunca Cruise 'un yeni filmi The Mummy hakkında bir şey söyleyemeyiz Filmle ilgili resmi duyuru yapılır şu an Paramount Pictures tarafından geldi. Böylelikle Top Gun 2 çok yetenekli bir adam Top Gun: Maverick resmi olarak duyurulmuş oldu. …

Devamını Oku »

Samsung Intensity 2 LetsGoMobile

S Amsung Mobil ve Verizon Wireless, Samsung Intensity 2 cep telefonunda önümüzdeki haftalar içinde online satış mağazası ve satış kanallarında tüketicilerin beğenisine sunulacağına açıkladılar. Samsung Intensity 2 dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi, dijital fotoğraf makinesi. Samsung Intensity 2 …

Devamını Oku »

Asus Zenfone 2 için yeni güncelleme!

Asus, 2015 yılında kullanıcılarla buluşturduğu amiral gemisi modeli Zenfone 2 için Android 6.0 için Marshmallow'dan sonraki madde yeni güncellemeler yayınlamaya devam ediyor. Asus Zentalk'ta, ZE550ML model numarasına sahip olan Zenfone 2 modeli için yayınlanan yeni güncellemenin duyurusu gerçekleştirildi. Gelin, şimdi güncelleme ile birlikte Zenfone 2'de meydana karşında hep birlikte göz atalım. Zenfone 2 için yeni güncelleme yayınlandı! Daha önce belirttiğimiz …

Devamını Oku »

Motorola Droid 2 LetsGoMobile

V Erizon Wireless ve Motorola yeni modelleri Motorola Droid 2 Smartphone cep telefonu için 11 Ekim 2011 tarihinden itibaren satışına başlanacağını duyurdu. Motorola Droid 2 akıllı cep telefonu gelişmiş Q klavye tuş takımı, hızlı internet dolaşma performansı ve 3G bağlantı özellikleriyle e-posta ve mesajlaşma konularında kullanıcıların iş ve eğlence dünyasında rahatça hareket etmelerini sağlıyor. Motorola Droid 2 cep telefonunda Adobe …

Devamını Oku »

HTC One Mini 2 Android akıllı telefon LetsGoMobile

'H TC, ünlü HTC One ailesinin son üyesi HTC One Mini 2'yi tanıttı. Mükemmel 4.5 inç HD ekran, HTC BlinkFeed, Sense 6 ve etkileyici 5 megapiksel ön kamerasıyla gelen HTC One Mini 2, HTC One (M8) serisi ikonik metal iş çiliği ve sınıfının en iyisi olan akıllı telefon deneyimini daha ekonomik bir model isteyenler için bir araya getiriyor. HTC One'ın …

Devamını Oku »

Google Pixel 2 özellikleri ve fiyatı

Google'ın Google Pixel bir süredir serinin ikinci modeli Google Pixel 2 ile gündemde. Peki, Google'ın yeni amiral gemisi Google Pixel 2 özellikleri ne olacak? Bugün piyasaya çıkan bir rapor ışığında, bugüne kadar elde elde edilen tüm bilgileri sizler için topladık. Google Pixel 2 çıkış tarihi Her ne Pixel serisi henüz yeni değil Nexus serisinden bildiğimiz kadarıyla Google yeni cihazlar Eylül …

Devamını Oku »

Samsung Solstice 2 Akıllı Telefon LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-solstice-2-akilli-telefon-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 7109', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-solstice-2-akilli-telefon-letsgomobile.org"; Oy + = '+ sayfa [‘positive’] +'% '+ ' ' + sayfa [‘negative’] + '% ' + ' Oylandı !'; …

Devamını Oku »

Şalgam 2 Mandalina: Hawaiian BBQ Bratwurst Kabobs

Bugün Menüde ~ Hawaii Barbekü Bratwurst Kabobs Kaboblar ızgarada harika ve Burada Şalgam 2 Mandalina, Kabobların kolaylığını ve lezzetini kucakladık. Bu tarifi, herhangi bir bileşenlerin birlikte iyi çalıştığını kanıtlıyor, Harika ve lezzetli bir tatma kabobu yapmak. Bu tarifte hafifçe kabobları Tatlı Bebek Ray'in {New} Hawaii Tarzı Barbekü Sosu, Son 10 dakika ızgarada kalırken. İtalyan sosisini, Polonya Sosisini, ile değiştirebilirsiniz. Türkiye …

Devamını Oku »

2 Günde Ekonomik Paris Gezisi Nasıl Yapılır?

Otel fiyatlarını incelemek ettik Rezervasyon yaptırmak Için Click for . Hayaller kenti Paris Kültür ve Sanat Modanın ettik Başkentlerinden biri. 2 günde hayaller kenti Paris'te nasıl gezilir? Hem de en ekonomik şekilde. Bu yazıda moda, romantizm, kültür, tarih, sinema müzik ve deyince akla ilk gelen dünya başkentlerinden biri olan Paris'i 2 günde Ekonomik sekilde nasıl gezeceğinizi anlatacağım. Pek çok insan …

Devamını Oku »

Şalgam 2 Mandalina: Akdeniz Frittata

Bugün Menüde ~ Akdeniz Frittata Bir Frittata nedir? Seslendirilmiş halde [frih-TAH-tuh] Genellikle yumurta ile karıştırılan bir İtalyan omlet Bir Fransız omletinde olduğu gibi katlanmış olmaktan çok. Üst üste konabilir veya üst kısma birimi altında işlenebilir. Bir omlet orta derecede yüksek sıcaklıkta çabucak pişirilir ve Katlamanın düz taraflı yarım oval bir şekle sahip olması durumunda. Bir frittata daha sıktır, çünkü düşük …

Devamını Oku »

Çift SIM kartlı Samsung Galaxy Core 2 LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/cift-sim-kartli-samsung-galaxy-core-2-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 11077', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/06/cift-sim-kartli-samsung-galaxy-core-2-letsgomobile.org"; Oy + = '+ sayfa [‘positive’] +'% '+ ' ' + sayfası [‘negative’] + '% ' + ' Oylandı !'; …

Devamını Oku »

Samsung Galaxy Young 2 Android telefon LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-galaxy-young-2-android-telefon-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 11078', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-galaxy-young-2-android-telefon-letsgomobile.org"; Oy + = '+ sayfa [‘positive’] +'% '+ ' ' + sayfası [‘negative’] + '% ' + ' Oylandı !'; …

Devamını Oku »

Samsung Galaxy Star 2 LetsGoMobile

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-galaxy-star-2-letsgomobile.orgtr/ajax/news/showcomments', { PostBody: 'news_id = 11083', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev drawAVotes (sayfa) { Var opacityChange = yeni fx.Style ('oy', 'opaklık', {duration: 1000}); opacityChange.custom (0,1); Var vote = "http://turkcebilgisi.com/wp-content/uploads/2017/06/samsung-galaxy-star-2-letsgomobile.org"; Oy + = '+ sayfa [‘positive’] +'% '+ ' ' + sayfası [‘negative’] + '% ' + ' Oylandı !'; …

Devamını Oku »

Wonder Woman 2 kesin olarak geliyor!

Patty Jenkins tarafından yönetilen ve DC sinema evreninin en başarılı filimleri veren kabul edilen Wonder Woman, Gişede harikalar yaratınca devam filmi kaçınılmaz oldu. Wonder Woman 2'yi kim yönetecek? DC'den Geoff Johns'un yaptığı açıklamalara göre Wonder Woman'dan Patty Jenkins ile birlikte çalışmak istediğini öğrenildi. ayrıca "Patty Jenkins birlikte şu anda ikinci filmin ana hatlarını oluşturmaya başladık. Hedefimiz yepyeni fikirlerle dolu mükemmel …

Devamını Oku »

Google Pixel 2 HTC tarafından üretilecek

Google Pixel 2 ve Pixel XL 2 hakkında yeni detaylar gün yüzüne çıkmaya devam ediyor. Bugün ise HTC U11 sistem dosyalarına dosyalardan yola çıkılarak, yeni telefonun hangi firmaya üretileceği tekrar konuşulmaya başlandı. Google Pixel 2'yi hangi firma üretecek? Bildiğiniz üzere HTC Google Pixel t büyük bir başarı elde etti. Google 'in ilk akıllı telefonundan sonra yakalanan başarıyı tekrarla isteyen Teknoloji …

Devamını Oku »

Resident Evil 2 HD çok yakında geliyor!

Resident Evil Serisinin arkasında isim Hiroshi Kobayashi tarafından yapılan açıklamayla birlikte, Resident Evil'in ardından şimdi de Resident Evil 2 Nin yeniden hazırlanarak piyasaya sürüleceği ortaya çıktı. Resident Evil 2 ne zaman piyasaya sürülecek? Hiroshi Kobayashi'nin Collider'a adlı kitabı yazılmış kağıdın bir çıkış tarihi vermelerinin mümkün olmadığı belirtildi. Capcom İlk kez 2015 yılında Resident Evil 2 'nin HD Remake yani yüksek …

Devamını Oku »

Şalgam 2 Mandalina: Apple Cevizli Ekşi Muffin

Bugün Menüde ~ Elma Cevizli Ekşi Muffinler Elma Cevizli Ekşi Muffinler Malzemeler 1/4 fincan tereyağı, oda sıcaklığı 1/2 fincan şeker ve kahverengi şeker 1 yumurta 1/4 fincan süt 1 fincan aktif maya başlatıcısı 1 1/2 fincan un 2 çay kaşığı kabartma tozu 1 çay kaşığı kabartma tozu 1/2 çay kaşığı öğütülmüş tarçın 1/4 çay kaşığı öğütülmüş hindistancevizi 1/4 çay kaşığı …

Devamını Oku »

IOS 11 Beta 2 yayınlandı!

Apple, WWDC 2017 etkinliğinde duyurusunu gerçekleştirdiği iOS 11 için hazır bastırılmış beta sürümünü, geliştiricilerin kullanımına sundu. Geçmiş sürümlere oranla hayli büyük geliştirme ve yeniliklere ev sahipliği yapan iOS 11'i, Eylül ayında yayınlamayı planlıyor Apple, iPhone ve iPad'lere yeni bir boyut kazandırmak istiyor. Peki, iOS 11 Beta 2 ile birlikte ne gibi değişiklikler sunuluyor? Gelin, bu sorunun cevabı hep birlikte öğrenelim. …

Devamını Oku »

Warcraft 3 ve Diablo 2 yeniden buluş!

StarCraft'ın yeniden hazırlanıp bu yaz tekrar satışa sunulacağının duyurusunu Geçtiğimiz aylarda yapan Blizzard firması, Oldukca sevilen ziyaretinde kült haline gelen on iki oyunu Warcraft 3 ve Diablo 2 'yi de yeniden hazırlama kararı aldı. Yeniden yapımlar ne zaman gelecek? Öncelikle Bu Konuda HERHANGİ Bir açıklama bulunmadığını belirtelim Çünkü Ortaya çıkan bu haber direkt Olarak Blizzard'ın resmi internet sitesinden duyurduğu Bir …

Devamını Oku »

Samsung Star 2 LetsGoMobile

S amsung bugüne Kadar 30 milyon adet şeytan Yıldız modelinin devamı niteliğindeki yeni modeli Samsung Star 2 cep telefonunu tanıttı. Samsung Star 2 akıllı telefon Kullanım sosyal yaşamıyla ilgili her şeyi tek bir cihazda toplayan ve ağlara, gruplara vb anında bağlantıyı yaparken üst seviye mobil sosyal ağ deneyimi sunmak üzere tasarlanmış. Özelleştirilebilen Kullanıcı arayüzü ile Samsung Star 2 akıllı telefon …

Devamını Oku »

Şalgam 2 Mandalina: Karides Noodle Yüce

Bugün Menüde ~ Karides Noodle Supreme Bu tarif, 'nin tarifine göre en az bir kutu yoğunlaştırılmış çorba ile hazırlanmıştır Karides çorbası yoğunlaştırılmış bir krem ​​bu tarifte kullanılmıştır. Lezzetli bir tarifi arıyor, Bu konuklara hizmet verecek kadar özel mi? Sonra bu tarifi bir deneyin. Karides Noodle Yüce, Kremalı ve leziz bir kombinasyonudur; Ispanak fettuccini, krem ​​peynir, karides, ekşi krema, Yarım buçuk, …

Devamını Oku »

Yeni Tekniklerle Kur'an Öğreniyorum – 2

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

Abdest ve Namaz Öğreniyorum – 2

                           0 Takipçi | 0 Takip                                                        Kategorilerim                                                                            Diğer İçeriklerim (326)                                                   Abdest ve Namaz Öğreniyorum – 2 Abdest ve Namaz Öğreniyorum – 1 Yeni Tekniklerle Kur'an Öğreniyorum – 2 Yeni Tekniklerle Kur'an Öğreniyorum – 1 LYS soru ve cevapları yayınlandı! – ÖSYM 2017 LYS soru ve cevapl Mezun Olacak …

Devamını Oku »

Samsung Galaxy Tab Active 2 geliyor!

Samsung Galaxy Tab Active Serisinin devamı için çalışmalarının başladığı duyurdu. Samsung, Galaxy Tab Active 2'de çalışıyor! Samsung yeni dayanıklı Galaxy Tab Active 2 üzerinde titiz bir çalışma yürüttüğünü gün yüzüne çıkarttı. Yeni Sekme Aktif 2 ile önceki Aktif serilerinde olduğu gibi zorlu arazi ve askeri şartlara karşı pek dayanıklı olacak. Galaxy Tab Active 2 'nin iki farklı varyantı olacak. LTE …

Devamını Oku »

Apple iPad Air 2 tablet LetsGoMobile

bir Pple'in yeni tableti iPad Air 2'de iPad modeli oluştur iddiası taşıyor. Sadece 6,1 mm inceliğindeki ve 437 gram ağırlığındaki gövdesi ile dikkat çeken Apple iPad Air 2 tablet gelişmiş Retina ekranı ile zengin ve daha güçlü bir kontrast ve daha fazla canlı renkler ve göz alıcı dijital fotoğraf ve videolar çeken kamera özeliği sunuyor. Apple iPad Air 2 tablet …

Devamını Oku »

Samsung Galaxy S 2 LetsGoMobile

S Amsung Mobil MWC 2011 Dünya Mobil Kongresi'nde Samsung Galaxy S 2 smartphone modelini tanıttı. Samsung GT-I9100 modeli ile birlikte Samsung Galaxy S 2 akıllı telefon ile 8,49 mm inceliğindeki göz hoş hoş geldiniz hafif gövde yapısı ve benzersiz bir sunum sunuyor çift çekirdek performansı ile dikkat çekiyor. Samsung Galaxy S 2 cep telefonu Google'ın en hızlı büyüyen mobil işletim …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Samsung Galaxy Mega 2 akıllı telefon LetsGoMobile

[Y Eni Samsung Galaxy Mega 2 Android akıllı cep telefonu 6 inç büyüklüğünde HD dokunmatik parlak ekrana sahip. Samsung Galaxy Mega 2 ekstra bir işlemci performansıyla yüksek bir batarya seviyesi sergiliyor. Tel el ile kullanım ekranı uygulamaları parmaklarınızın ucuna getiriyor. Galaxy Mega 2'nin başlıca özellikleri olan Android 4.4 KitiKat işletim sistemi ve komplike uygulamaları için gerekli olan dört çekirdekli işlemcisi …

Devamını Oku »

Sezon 2 v1.1 Android Hile APK indir

Yazar: Gökhan Öğütcü Kategori: Android Bulmaca Oyunları, Android Hileli Oyunlar 15 Haziran 2017 20 Görüntülenme Cehennemden komşular: Sezon 2 v1.1 Android Kilitler Açık Hile MOD APK + DATA indir Cehennemden komşular: Sezon 2 heyecan dolu bir bulmaca oyunudur. Oyunda sizin zorlu görevleriniz olacaktır. Siz bu görevleri üstlenip tamamlamak için mücadele edeceksiniz. Sen bu amaç uğruna ilerlemeye çalışırken karşınıza çeşitli engeller …

Devamını Oku »

Hill Climb Racing 2 1.6.0 Android Para Hile MOD APK indir – Android APK indir

Yazar: Gökhan Öğütcü Kategori: Android Araba Yarışı Oyunları, Android Hileli Oyunlar, Android Yarış Oyunları 15 Haziran 2017 1,679 Görüntülenme Tepesi 2 1.6.0 Android Para Racing tırmanmaya, Altın Kilitler Açık ettik Hile MOD APK indir Tepesi tırmanın serisine Bir yenisi daha eklendi! zorluklarla geri döndü, ettik maceralar Yeni seri yeni! Siz Bu Oyunda yeni maceralara atılacaksınız. Engellerle dolu yolculuklarda başarılı Bir …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Şalgam 2 Mandalina: Akçaağaç ceviz peynirli Kekarte

Bugün Menüde ~ Maple Cevizli Cheesecake Tarts Bugün iki kolay yemek tarifini paylaşıyoruz Benim favori uygun ürünlerden birkaçıyla yapılmış. Philadelphia, Cheesecake Doldurma Hazır, Her iki tarif de o kadar kolaydır ki İlk tarifi, filonlu hamur kullanmayı gerektirir. Phyllo [FEE-loh] Gerçekten çevrilmiş Yunanca kelime phyllo "yaprak" anlamına gelir. Lezzet açısından, çeşitli Yunan tatlılarında kullanılan doku ince katmanlı hamur hamurunu ve En …

Devamını Oku »

Google Pixel XL 2 Android 8.0 cep telefonu LetsGoMobile

G Oogle Pixel XL2 premium akıllı telefon – Google, Eylül 2016 tarihlerinde yeni Pixel serisini tanıtmıştı. Google'ın kendi ismi altında pazaraya duyurulmuştu. Nexus cep telefonunun serisi. Ancak, Google Pixel ve Pixel XL modelleri asla yüksek satış rakamlarına ulaşamadı. Bunun nedeni bu prim akıllı cep telefonlarının iyi bir performans sergileyememekteki, aksine internette yayınlanmış olan Google Pixel ürün incelemeleri son derece olumlu …

Devamını Oku »

Google Pixel XL 2, LG tarafından üretilmiştir!

Nexus'a veda ederek yoluna Pixel serisi ile devam eden Google, merakla beklenilen yeni Pixel 2 ve Pixel XL 2 model akıllı telefonlarla uzun süredir gündemden düşmüyor. Geçmiş yıllar için cihazların üretimleri HTC ile iş birliğine gidiniz beğenildi Google'ın, yeni Pixel 2 serisinde Üretici değişikliğine gittiği ortaya çıktı. Google Pixel XL 2, LG tarafından üretilmiştir! Google'ın Taimen kod adına sahip olduğu …

Devamını Oku »

Mount & Blade 2 Banner lord ön inceleme

Teknosa sponsorluğunda E3 2017 içeriklerimizi sizlere ulaştırmaya devam ediyoruz. Sırada çoğumuzun büyük bir merak ve heyecanla beklediği Mount & Blade 2 Banner var! Tüm E3 haberlerine buradan ulaşabilirsiniz! Dağı ve Kılıç 2 Banner Lord ön inceleme Özellikle biz Türk oyuncuların daha bir heyecanla beklediği Bannerlord uzun süredir geliştirme aşamasında olan bir yapım. Ankaralıdan oyun stüdyosu Taleworlds tarafından bizlere sunulacak olan …

Devamını Oku »

Şalgam 2 Mandalina: Enginar ile Penne

Bugün Menü Yapın ~ Enginalı Penne Bu makarna tariflerini atma vakti … Hava daha da ısınıyor ve Sıcak, sıcaksın ~ Makarna salataları ve yaz sadece kitabımda bir araya geliyor. Dışarıda sıcak olduğunda ve ne için acıktığını bilmiyorsan, Lezzetli, serin bir makarna salatası her zaman yerinde olur Enginalı Penne Malzemeler      1 kavanoz (12 oz)      Dört bölmeli enginar kalpler      …

Devamını Oku »

LG G Flex 2 akıllı telefon LetsGoMobile

L G'nin yeni kavisli telefonu CES 2015'te görücüye çıktı. LG Electronics Las Vegas'ta düzenlenen CES 2015 Fuarı'nda tüketiciye beğenisine sunduğu yeni kavisli akıllı telefonu LG G Flex2 ile tüm endüstrinin sınırlarını zorlamaya devam ediyor. İnovatif tasarımıyla büyük beğeni toplayan orijinal G Flex'ten bir yıl sonra ortaya çıkan G Flex2, çok daha ileri tasarım, hızlı performans ve en önemlisi muhteşem rahatlığıyla …

Devamını Oku »

Wolfenstein 2: Yeni Colossus duyuruldu!

Wolfenstein 2 Bethesda'nın E3 konferansı çerçevesinde resmiyet kazandı. Yıllara meydan okuyan seri, yepyeni devam devam ediyor Wolfenstein 2: Yeni Kolossus ile gelen. Wolfenstein 2: Yeni Colossus duyuru fragmanı yayınlandı Nazilerin galip geldiği bir fantastik evrende geçen Wolfenstein, BJ Blazkowicz 'da Yeni Siparişle başlayan hikayesini devam ettiriyor. İlk oyunda Deathshead 'öldürmek hiç şekilde değiştirilmemiş, Naziler kolayca toparlanarak Amerika ve tüm dünyaya …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

Çürüme Durum 2 tanıtıldı

Undead Labs 'ın geliştirdiği ve Microsoft ' un dağıtımcılığını üstlendiği Çürüme Durumu 2 E3 'ün Microsoft konferansında tanıtıldı. Çürüme Durumu 2 zombi felaketinin başlangıcındaki 18 ay sonrasını konu alıyor. Askeri ordu tarafından bir ordu kampında başlatıldı oyundaki amacımız hayatta kalmak olacak. Bu amaç doğrultusunda da hayatta kalmaya çalışırken diğer insanlarla ilişkiler kuracağız ve bir grup olmaya çalışacağız. PlayerUnknown'ın Battlegrounds duyuruldu! …

Devamını Oku »

Asus ZenFone 2 LetsGoMobile

bir ZenFone 2 akıllı telefon – Asus ZenFone ürün yelpazemizi tanıtın. Tamamen baştan tasarlanan ergonomik ve göz alıcı tasarımı ile 5.5 inç Full HD IPS kullanıcıları olan Asus ZenFone 2 akıllı telefonda 13 MP ve 5 MP PixelMaster kameralar, 2.3GHz 64 bit Intel Atom işlemciye ve 4GB RAM'e yer verilmiş. Intel LTE-Gelişmiş modemi ile çok hızlı ve güvenli 4G / …

Devamını Oku »

Şalgam 2 Mandalina: Kök Kubalı Baş Kek

Bugün Menüde ~ Rhubarb Baş aşağı Kek ve Rhubarb 101 ~ Birkaç dakika daha var mıydı? Rhubarb'ı Kaşkırtmak için yeterli zamanınız var Hızlı, Kolay ve Lezzetli ~ Rhubarb 101 ~ Rhubarb [ROO-bahrb] Karabuğday ailesinin kalın, celerylike sapları 2 feet uzunluğa kadar ulaşabilir. Saplar bitkinin yenilebilir kısmıdır, Yapraklar oksalik asit içerir ve çok toksiktir. Ravar bir meyve olarak yenilmesine rağmen Botanik …

Devamını Oku »

4.SINIF MATEMATİK 2.DÖNEM 2. YAZILI

Adım Soyadım: ……………………… .. ……………… .. No: ……… 14.04.2017 4 / A SINIFI 2.DÖNEM MATEMATİK 2. YAZILI SORULARI 1. Bölüm (15×3 = 45P) 1. Yüksüz 2 t 500 kg bir kamyonetle kasalarla gelen portakal ile taşınmaktadır. Yüklü olduğken kamyonette 4 tona 15 kg olan kasalardan kaçtığı kaç A) 100 B) 1500 C) 2507 D) 6500 2. Bir çiftçi üretti 1 …

Devamını Oku »

4.SINIF MATEMATİK 2. DÖNEM 3. YAZILISI

                     2017-06-10 20:04:00                                                                                   Adım Soyadım: ……………………………………… Hayır: ……… 4-A SINIFI MATEMATİK 3. YAZILI DEĞERLENDİRME SORULARI için uygun değildir. Nokta yerlere, ifadeler doğru olur "D" yanlış ise "Y" yazınız. (….) 1 – 125 metre, 1205 santimetreye eşittir. (….) 2-7 kilometre, 700 metreye eşittir. (… ..) 3- Kenar uzunlukları 3 cm, 4 cm ve 5 cm olan üçgen ikizkenar …

Devamını Oku »

Google Pixel XL 2 göründü!

Google Pixel XL 2 hakkında yeni bilgiler gelmeye devam ediyor. Google'ın yeni akıllı telefonu Pixel XL 2, GFXBench testinde ortaya çıkış. Google Pixel XL 2 GFXBench'te ortaya çıktı! Pixel XL 2 ile ilgili yeni bilgiler ortaya çıkıyor. Snapdragon 835 işlemcisinden güç alacakı yeni amiral gemisi oldukça iddialı bir çıkışa hazırlanıyor. çözünürlüğe sahip 5.3 inçlik bir ekran ile karşımıza çıkacak olan …

Devamını Oku »

Stick Stunt Biker 2 2.4 Android Hile MOD APK indir

Yazar: Gökhan Öğütcü Kategori: Android Hileli Oyunlar, Android Yarış Oyunları 9 Haziran 2017 472 Görüntülenme Stick Stunt Biker 2 2.4 Android Kilitler Açık Hile MOD APK indir Çubuk Stunt Biker 2-Android-resim "width =" 300 "height =" 300 "/> ] Stick Stunt Biker 2 adlı oyun "Djinnworks GmbH" tarafından tasarlanmış bir yarış oyunudur. Oyunu bir bisiklet sürücüsü karakteri yönlendireceksiniz. Bisiklet ile …

Devamını Oku »

Payday 2 ücretsiz oldu – ShiftDelete.Net

'un ' un 'un ortaklığı ile geliştirdiği ve 505 Oyunları ' in dağıtımcılığını üstlendiği PAYDAY 2 anıdın serbest oldu ve 5 milyon adet orijinal kopya dağıtılmaya başladı. PAYDAY 2 'nin Steam sayfası ulaşarak oyunu ücretsiz olarak kütüphanenize ekleyebilirsiniz. Oyun kütüphanenize eklenir eklenmez ömür boyu sizin olacak. Oyuna ücretsiz sahip olmak için elinizi çabuk tutun! Ücretsiz PAYDAY 2 dağıtımı şu an …

Devamını Oku »

Angry Birds 2 2.14.0 Android Para Hile MOD APK indir

Yazar: Gökhan Öğütcü Kategori: Android Hileli Oyunlar, Android Macera Oyunları, İstek Hileler 8 Haziran 2017 2,703 Görüntülenme Angry Birds 2-Android-resim "width =" 300 "height =" 300 "/> Angry Birds 2 2.14.0 Android Para ve Enerji Hile MOD APK indir Çok sevilen ve çok oynamak Angry Birds serisine bir yenisi daha eklendi! Heyecan verici grafikleriyle ve zorlayıcı seviyeleri ile sizleri daha …

Devamını Oku »

Şalgam 2 Mandalina: Güneybatı Sezon Karıştırma

Bugün Menüde ~ Güneybatı Tercih Edilen Karışım Sezonluk karışımlar el altında olmak çok güzel ama bazen önceden hazırlanmış harmanlar tuzla dolu ve taze tadı yoksun . Bu yüzden kendi karışımlarımı yapmak isterim. Karışımdaki neyi biliyorum ve onları ailemin zevkine uydurabilir. Güneybatı Sezonu karışımı mükemmel bir örnektir. Bu baharat harmanı hiçbir tuz veya şeker içermez ve Paketlenmiş taco baharat harmanı yerine …

Devamını Oku »

Top Gun 2 geliyor – ShiftZiyaret.Net

Tom Cruise 'un, 1986 tarihinde Kelly McGillis ile başrolünde oynandı ve geçtiğimiz sene ise 30. sene sini kutlayan Top Gun filminin devamı nihayet geliyor. Günümüzde de kült bir yapım olarak yerini koruman filme dair ilk ayrıntılar, bizzat Cruise tarafından açıklandı. Yeni film Top Gun: Maverick olacak! 30 sene sonra devamı çekilecek olan Top Gun serisinin ikinci filmi, Top Gun: Maverick …

Devamını Oku »

Pantech Jest 2 cep telefonu LetsGoMobile

V Erizon Wireless ve Pantech dijital klavyeye 2.4 inç ekrana sahip yeni modelleri Pantech Jest 2 cep telefonunu duyurdular. Aşağıya doğru kayar mekanizmalı QWERTY fiziksel klavyesi ile Pantech Jest 2 cep telefonu hızlı ve kolay mesaj yazma olanağı sunarak sosyal ağlarda kolay paylaşım imkanı tanıyor. Telefonseverler Pantech Jest 2 ile cep e-postalarına ulaşabiliyor ve hareket halindeyken sürekli internete bağlı kalabiliyorlar. …

Devamını Oku »

Samsung Convoy 2 cep telefonu LetsGoMobile

V Erizon Wireless ve Samsung Mobile'ın bas-konuş form telsiz benzeri görüşme desteği sunuyor yeni modelleri Samsung Convoy 2 (Samsung SCH-U660) sahip çektiğinizde askeri spesifikasyonlar ve dayanıklı yapısıyla dikkat çekiyor. Samsung Convoy 2 cep telefonu arayan kullanıcılara yönelik olarak tasarlanmış. Yeni Samsung Convoy 2 cep telefonu hem iç yapısıyla hem de dış tasarımyla her türlü çalışma ortamına dayanıklılık sergileyecek ve sürekli …

Devamını Oku »

Kök Bölge Sürümü 2 için Etiket Oluşturma Kuralları

Etki Alanı Adı Sistemi Uluslararasılaştırılmış Etki Alanı Adı, IDN "IDN'ler, kullanılan karakterleri içeren etki alanı adlarıdır. Temel Latin alfabesinin yirmi altı harfi ile yazılmayan dillerin yerel gösterimi "" Az "" Bir IDN, pek çok Avrupa dilinin gerektirdiği aksi işaretli Latin harfleri içerebilir ya da olmayan karakterlerden oluşabilir Arapça veya Çince gibi latin senaryoları.Birçok dilde Avrupa "" 0-9 "" dan başka …

Devamını Oku »