16 Aralık 2017,Cumartesi
Anasayfa » Tag Archives: 19

Tag Archives: 19

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Van Nöbetçi Eczaneler

Eczane: Beşyol Eczanesi Telefon: +904322151971 Adres: Beşyol Meydanı Valilik Binası Yanı İl / İlçe: Van / Merkez Nöbet: 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane: Yaşam Eczanesi Telefon: +904322159383 Adres: Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yalova Nöbetçi Eczaneler

Eczane: Çimen Eczanesi Telefon: +902264656567 Adres: Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe: Yalova / Altınova Eczane: Arda Eczanesi Telefon: +902265312896 Adres: Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe: Yalova / Armutlu Eczane: Çiftlikköy Eczanesi Telefon: +902263520580 Adres: Çiftlik Mah. Stadyum Cad.No.31 İl / […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler

Eczane: Taner Eczanesi Telefon: +903543141464 Adres: İstiklal Cad.No:56 İl / İlçe: Yozgat / Akdağmadeni Eczane: Beştaş Eczanesi Telefon: +903544871695 Adres: Yeni Mah .Çekerek Cad.No:2 İl / İlçe: Yozgat / Aydıncık Eczane: Sağlık Eczanesi Telefon: +903546455556 Adres: Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe: […] Kaynak

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler

Eczane: Yazicioğlu Eczanesi Telefon: +903723783630 Adres: Merkez Mah.Demırcıler Sok.No:2 İl / İlçe: Zonguldak / Alaplı Eczane: Tuba Eczanesi Telefon: +903726283330 Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe: Zonguldak / Çaycuma Eczane: Saltukova Eczanesi Telefon: +903726182010 Adres: Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl […] Kaynak

Devamını Oku »

Doğal bağışıklığın rolü … Tip 19 diyabet (TYD), T hücresinin aracılık ettiği organa spesifik bir otoimmün hastalıktır

Özet Insülin üreten pankreatik β hücrelerinin imhası. Genetik ve çevresel faktörlerin bir kombinasyonu sonuç olarak işlevsel β hücreleri kütlesinin ve hipergliseminin kaybına yol açar. T1D gelişiminde hem doğuştan hem de adaptif bağışıklık rol oynar. Bu derlemede, doğuştan gelen bağışıklığın, özellikle kalıp tanıma reseptörlerinin (PRR'ler) hastalık gelişimindeki rolü hakkındaki en son bulguları vurguladık. Sıçan modellerinde ve insan çalışmalarında, toll benzeri reseptörler …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Y …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Bir önceki yazımız 19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Haziran 2017 Pazartesi Akçaabat nöbetçi eczane, 19 Haziran 2017 Pazartesi …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin E …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Bir önceki yazımız 19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 Haziran …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 Pazar Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi verilmektedir. …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar nöbetçi eczane, 18 Haziran 2017 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – 20 Haziran 2017 Salı 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Haziran 2017 Pazartesi 08:00 – …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

19 Haziran 2017 Pazartesi – 20 Haziran 2017 Salı Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nö …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin E …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 18 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran 2017 Pazar Akçaabat nöbetçi eczane, 18 Haziran 2017 Pazar …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Bir önceki yazımız 18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 18 Haziran …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 18 Haziran 2017 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler başlıklı makalemizde 17 Haziran 2017 Cumartesi nöbetçi eczane, 17 Haziran 2017 Cumartesi Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 17 Haziran 2017 Cumartesi – 18 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler başlıklı makalemizde 17 Haziran 2017 Cumartesi Nöbetçi eczane, 17 Haziran 2017 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 18 Haziran 2017 Pazar 08:00 – 19 Haziran 2017 Pazartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 18 Haziran 2017 Pazar 08:00 – …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

18 Haziran 2017 Pazar – 19 Haziran 2017 Pazartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni N …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Mayıs 2017 Cuma Akçaabat nöbetçi eczane, 19 Mayıs 2017 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni Nö …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Mayıs 2017 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 16 Mayıs 2017 Salı – 17 Mayıs 2017 Çarşamba Tunceli Nöbetçi Eczaneler başlıklı makalemizde 16 Mayıs 2017 Salı nöbetçi eczane, 16 Mayıs 2017 Salı Tunceli nöbetçi ekzane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecz …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 16 Mayıs 2017 Salı – 17 Mayıs 2017 Çarşamba Uşak Nöbetçi Eczaneler başlıklı makalemizde 16 Mayıs 2017 Salı nöbetçi eczane, 16 Mayıs …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecza …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Mayıs 2017 Cuma 08:00 – …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi'nin Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »


                     2017-05-19 08:21:00                                                              19 mayıs 1919 da Atatürk Mustafa Kemal istiklal savaşını başlatmak üzere samsuna geldi.19 Mayıs 1919 tarihi, Türkiye Cumhuriyeti tarihindeki dönüm noktalarından … bu yolculuk Türk Milleti için bir dönüm noktası ve kurtuluşun başlangıcıydı. 16 mayıs 1919 da bandırma vapuru ile yola getir mustafa kemal ve arkadaşları 19 mayıs 1919 da samsundaydı..Türkiye Cumhuriyeti'nde önemli bir …

Devamını Oku »

19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi İzmir / Dikili Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

35 İzmir Nöbetçi Eczaneler, Dikili Nöbetçi Eczaneler Eczane : Dağlı Eczanesi Adres : İSMETPAŞA MH 9 SK NO 41 İl / İlçe : İzmir / Dikili Nöbet : 19 Mayıs 2017 Cuma 08:00 – 20 Mayıs 2017 Cumartesi 08:00 Bir önceki yazımız olan 19 Mayıs 2017 Cuma – 20 Mayıs 2017 Cumartesi İzmir / Çiğli Nöbetçi Eczaneler başlıklı makalemizde 19 …

Devamını Oku »

1. Sınıf Türkçe 19 Mayıs Metin Çalışması Ve Zıt An …

1. Sınıf Türkçe 19 Mayıs Metin Çalışması Ve Zıt An Açıklama 1. Sınıf Türkçe 19 Mayıs Metin Çalışması Ve Sınıfı 19 Mayıs ile ilgili metin çalışmaları ve zıt taşları Etkinliği Zıt anlamlı kelimeleri eğitimhaneden bir arkadaştan aldım alıntıdır. Mamisan Bölüm 1. Sınıf Türkçe Etkinlik ve Çalışma Kağıtları Tarih 17 Mayıs 2017 Boyut İndirme 479 Teşekkür 5 ] Kaynak

Devamını Oku »

19 Mayıs Pano Çalışması – Egitimhane.Com

Ana Sayfa Dosyalar Forum Haberler Menü Ana sayfa Dosyalar Yerler Haberler Öğrenci Portalı Okullar Okul Yardım İlkokuma Videolar Arama İndir! Atama Rehberi İletişim Serbest Kürsü Dernek Siteler Kitaplığımız Galeri Test Çöz Yerel Forum Üyelik Giriş yap Üye Ol Şifremi unuttum 19 Mayıs Pano Çalışması Ana sayfa Son Dosyalar Dosya Ekle Dosya Menü Son Dosyalar Dosya Gönderenler Çok Çok İndirilenler Yönetim …

Devamını Oku »

19F-NMR, Mo'nin Rolünü ortaya çıkarır … β-laktamaz antibiyotiklerine direncin en önemli mekanizmalarından biri olan β-laktamazlar tarafından katalizlenen hidroliz. [1] Her ne kadar β-laktamazlar, Bir nükleofilik serin (sınıf A, C ve D), β-laktamlara dirençli olarak iyi bilinen roller taşımaktadır; B sınıfı Zn II'ye bağımlı metallo-β-laktamazlar (MBL'ler) daha yakın zamanda ortaya çıkmıştır Önemli bir klinik problemdir (Şekil ). A sınıfı β-laktamazların (örn klavulanik asit) klinik olarak yararlı önleyicileri yaygın olarak kullanılmaktadır ve avibactam'ın yakın zamanda geniş spektrumlu bir serin β-laktamaz inhibitörü olduğu bildirilmiştir; Bununla birlikte, MBL'ler için böyle bir inhibitör mevcut değildir.4 A) Metalo-β-laktamazlar (MBL'ler) için anahat mekanizması. B'de "açık" (PDB ID: 2FHX) 8a ve C "kapalı" (PDB ID: 4BP0) 8b konformasyonları … ] São Paulo MBL-1 (SPM-1) ilk olarak β-laktam dirençli Pseudomonas aeruginosa 5 ve SPM-1 üreten P'de tanımlandı. Aeruginosa Brezilya hastanelerinde endemiktir.6 Avrupa, Asya ve Kuzey Amerika'da SPM-1 aracılı dirençle ilgili yakın tarihli raporlar, küresel yayılımını ortaya koymaktadır.7 SPM-1, inhibisyon perspektifinden dolayı belirli bir zorluktur; Substrat özgüllüğü (penisilin, sefalosporin ve karbapenem hidrolizi katalizörü) hem B1 hem de B2 alt aileye ait MBL'lere karakteristik özelliklere sahiptir (Şekil 1, Destekleyici Bilgi). 8 SPM-1, di-Zn II iyon gereksinimi ve (mevcut kanıtlara dayalı olarak) kinetiğine göre 9 SPM-1 olağandışı ikinci küre kalıntılarına 10 sahiptir ve mobil aktif bölge bölgelerine göre B1 MBL'ler arasında benzersizdir; SPM-1, B2 MBL'lerin karakteristik özelliklerini oluşturan genişletilmiş bir "α3 bölgesi" (kalıntılar 223-241, BBL numaralandırma) ve nispeten kısa bir L3 döngüsüne (kalıntılar 61-66, BBL numaralandırma) sahiptir.8a SPM-1'in yapıları yoktur Substratlar / önleyiciler ile kompleksleşmiş halde, α3 bölgesinin aktif bölgeye göre open8a ve closed8b konformasyonlar benimsediği yapılar bildirilmiştir (Şekil B, C). İçerdiği Duyarlılık, rezonans eksikliği ve NMR cihazlarındaki ilerlemeler ve prob tasarımı, protein gözlemleme 19 F-NMR (PrOF NMR) konformasyonel değişiklikler ve protein-ligand etkileşimleri incelenirken artan bir yarar sağlar. , Verimli bir şekilde flor etiketleri (Şekil S2A) .8b, 12 tanıtmak için 3-bromo-1,1,1-trifloroaseton (BTFA) tarafından sistein alkilasyon kullanarak MBL dinamikleri incelemek için PrOF NMR kullanımı hakkında rapor Burada, biz PrOF NMR çalışmaları Göreceli imp hakkında bilgi veren SPM-1 Farklı sınıflarda MBL substratlarının / inhibitörlerinin bağlanmasında L3 döngüsü ve α3 bölgesinin ortansı. Önemlisi, MBL katalizörünün hidrolize β-amino asit ürünlerinin, L3 döngüsünü içeren bir süreçte SPM-1'e bağlanabileceğini ortaya koymaktadır. L3 döngüsünde (Y58) ve α3 bölgesindeki (F151) rezidüler 19 F ile değiştirme ve etiketleme için seçilmiştir (Şekil S2B). İlk çalışmada biz Y152; 8b'yi etiketledik, ancak daha ileri çalışmalar için F151'i seçtik, çünkü SPM-1 kristal yapılarının analizi8 F151 yan zincirinin hareketli olduğunu ve Tyr152'ninkinden daha aktif alan çinko iyonlarına yakın projeleri ima ettiğini gösterir (Şekil S3 ). BTFA (sırasıyla Y58C * ve F151C *) kullanılarak Y58C ve F151C SPM-1 varyantlarının selektif etiketlenmesi intakt protein ve tripsin-digest kütle spektrometrisi ile doğrulanmıştır (Şekil S4-11). Dikkat çekici olarak, SPM-1'deki doğal olarak var olan sistein (Cys221), BTF ile reaksiyon göstermedi, muhtemelen Cys221'in karbamidometilasyonu ile kanıtlandığı üzere Zn II'yi kenetlediği için Y58C * ve F151C * 'nin MS analizlerinde Cys58 ve Cys151 değil (Şekiller S8-11). Yabani tip (wt) SPM-1, Y58C * ve F151C * 'nin dairesel dikroizm spektrumları13 benzerdi (Şekil S12), dolayısıyla Y58C'nin kristalografik analizleri ile desteklenen benzer toplam kıvrımları ima eder (Şekil S13,14 ve Tablo S1). Kinetik analizler14 (Şekil S15), CH 3 COCF 3 etiketinin eklenmesinin substrat afinitesini büyük ölçüde değiştirmediğini, yani benzer wt SPM-1 ve her ikisi de etiketli varyant ile meropen için M değerleri elde edildi. k 'nin 2.5 kat azalması, Her iki SPM-1 * varyantı ile meropenem için kedi muhtemelen enzim-ara komplekslerinde modifiye edilmiş kalıntıyı içeren etkileşimleri yansıtmaktadır. Kombine biyofiziksel ve kinetik çalışmalar, Y58C * ve F151C * 'nin özelliklerinin, PrOF NMR çalışmalarını haklı çıkarmak için ağırlıkça SPM-1'e yeterince benzediğini ortaya koymuştur. BTFA'nın protein alkilasyonuyla ilgili önceki çalışmalarla birlikte bu sonuçlar, BTFA'nın, translasyon sonrası sistein alkilasyonu yoluyla 19 F etiketlerinin etkili bir şekilde verilmesi için kullanışlı olduğunu ortaya koymaktadır. 19 F-NMR spektrumları, -83.15 ppm'de (Y58C *) ve -84.75 ppm'de (F151C *; Şekil S16) ana protein gözlem tepeleri ortaya çıkardı ve böylece varyantların işaretlenmiş halkaları / bölgeleri ağırlıklı olarak tek bir konformasyonda mevcut olduğunu gösterdi Veya daha muhtemel olarak, etiketli kalıntıların NMR kaydırma zaman ölçeğine göre hızla ilerlediğini görürsünüz. F151C * varyantı, muhtemelen konformasyonel hareketi yansıtan -84.75 ppm'de daha keskin zirvelerin her iki tarafında da geniş sinyaller verdi; Bununla birlikte, değişken sıcaklık çalışmalarında (277 K – 310 K) sinyalin çizgi genişliğinde ve yoğunluğunda değişiklikler gözlemedik. Kristalografik kanıtlarla uyumlu olarak, solvent izotop değişim çalışmaları (Şekil S17) maruz kalan α3 bölgesinde bulunan F151C * 'nin, daha az maruz kalan L3 döngüsünde bulunan Y58C *' ye daha kolay çözülebilir olduğunu ortaya koymuştur. Daha sonra temsili MBL ligandlarının Y58C * ve F151C * SPM-1'e bağlanmasını araştırmak için PrOF NMR (Şekil S18) kullandık (Tablo S2, K için Tablo S3'e bakınız) D değerleri). Başlangıçta, ligand bağlanmasını araştırmak için SPM-1 * varyantlarının kullanımını doğrulamak için rapor edilen MBL inhibitörlerini test ettik. Çinko kenetleme maddesi 1,10- o -fenantrolin ile hem Y58C * (Şekil A) hem de F151C * (Şekil 19459005) B) için yeni NMR tepeleri gözlemlendi. Bu zirveler, çözeltide 1,10- ile tahmin edilen Zn II ekstraksiyonuyla tutarlı olan apo -SPM-1 * spektrumunda gözlemlenenlerle aynıdır. -fenantrolin; 1,10- o -fenantrolinin kendisinin apo [Madde -Y58C * (Şekil 19459005) A ve Şekiller S19,20'ye bağlandığı gözlemlenmemiştir. Bu sonuçlar, metalo-enzim inhibisyon çalışmaları yoluyla her zaman kolayca erişilemeyen çözelti ve / veya protein içindeki metal şelasyon / bağlanmanın tespit edilmesinde PrOF NMR'nin faydasını ortaya koymaktadır. Rodanin ML302 ve tioenol ML302F ile, sırasıyla, Y58C * ve-F151C * için -83.75 ppm ve -84.40 ppm'de 16 yeni zirve gözlendi (Şekil S21). Bu gözlemler, kuluçka koşulları altında tioenol ML302F'yi vermek üzere ML302'nin hidrolizi ile tutarlıdır.17 -1 MBH'leri inhibe eden, ancak SPM-1'i (IC505) inhibe eden -Captopril,> 500 μ m 18 ve alt sınıf B2 MBL'leri 19, önemli değil SPM-1 * varyantlarının herhangi biri için 19 F spektrumundaki değişiklikler (Şekil S22). SPM-1 * 'e bağlanan inhibitörün PrOF NMR monitörizasyonu. 19 1,10- -fenantrolinin A) Y58C * SPM-1 ve B) F151C * SPM-1 ile etkileşimlerinin F-NMR spektrumları. 19 … 'nin F-NMR spektrumu. İzokinoller, geniş spektrumlu MBL inhibitörleri, 13,14, ancak bağlayıcılarıdır Modu bilinmiyor. İzokinolin ( 1 ) 13, 14'ün Y58C * ile titre edildiğinde, ara değişimde bir sistemin tipik olan önemli çizgi genişlemesi gözlemlendi. ML302F17'nin Y58C * ve 1'i içeren bir numuneye eklenmesi, ML302F'ye bağlı kompleksin zirve karakteristik özelliğinin ortaya çıkmasına ve Y58C * zirvesine göre 1.1 ppm ile deshield edilen yeni bir zirvesinin ortaya çıkmasına yol açtı (Şekil C). F151C * ile, 1 genişleme ve kimyasal kayma değişiklikleri indükledi (Şekil D). Böylece, 1 'nın bağlanması hem α3 hem de L3 bölgelerini etkiler (Şekil S22-24). Bununla birlikte, ilginç bir şekilde sonuçlar, 1'in aktif saha çinko iyonlarına bağlandığı bilinen ML302F'nin varlığında SPM-1'e bağlandığını ima etmektedir.17 Bu gözlem ile birlikte ]Çizginin genişlemesi ile (Şekil 19459005) gösterildiği gibi apo -Y58C * 'ya bağlanır; sonuçlar, SPM-1'e benzeri görülmemiş şekilde bağlanıp eklenmediğini ima eder Sonra, sınıf A, C'yi ve bazı Dp-laktamazları inhibe eden avibactam ile örneklenen zayıf SPM-1 inhibitörlerinin bağlanmasını izlemek için PrOF NMR'nin yararını test ettik, 3b, 4c'ye sahip ancak çoğu MBL için afinitesi düşüktür.4b Avibactam ve Y58C * ile açık bir kimyasal kayma değişikliği gözlemlendi, bu nedenle avibactam bağlanmasının L3 bölgesinde ancak α3 bölgesindeki değişiklikleri indüklediğini gösterdi (Şekil S25, 26). Y58C * ile muhtemelen orijinal protein zirvesine geri dönüş, muhtemelen SPM-1.4b ile katalize edilen avıbactamın yavaş hidrolizinin bir sonucu olarak gözlendi Reaksiyona giren solüsyona yeni avibactam ilavesi, tepeyi orijinal olarak avibactam'dan doğana doğru kaydırdı Sonra, β-laktam substratlarının [a carbapenem (meropenem), a penicillin (piperacillin), and mechanism‐based inhibitors of class A β‐lactamases (tazobactam and clavulanic acid)] SPM-1 * varyantlarına eklenmesini araştırdık. Onların SPM-1 * 'e ilavesi, Y58C * için çizgi genişletme ve kimyasal değişim değişikliklerine neden olurken, F151C * (Şekil) için 825 meropenem muamelesi (400 μ m ) (saptama limitleri dahilinde değil) * Y58C * 40 μ m ), 0,2 ppm 19 F kaydırmasına (-83.15 ppm'den -82.95 ppm'ye) yol açtı ve böylece hızlı değişim (Şekil 19459005) A, E gösterildi. Zaman-kurs analizi 12 saat boyunca kararlı olan spektrumları ortaya çıkarmıştır (Şekil 19459005). Bu durumda yeni zirveye muhtemelen bir enzim ürünü kompleksini yansıttığını düşündürmektedir (Şekil S27-31). Piperacillin (400 μ m ) ile 0.4 ppm'lik bir kayma da gözlenmiştir (Şekil B, F). Bununla birlikte, meropenem'in aksine, zaman-gidiş analizi, ilave çizgi genişlemesi ve -82.75 ppm'den -82.57 ppm'e (Şekil D ve Şekil S32) ürün karmaşık zirvesine göre 0.18 ppm'lik bir başka kimyasal kayma ortaya koymuştur; bu nedenle, Yeni bir SPM-1 bağlanma türünün üretilmesi. PrOF NMR ile analiz edildiği gibi (hidrolize edilmiş) β-laktamların SPM-1 * varyantlarıyla olan etkileşimleri. A) meropenem ve B) piperasilinin Y58C * SPM-1 ile titrasyonu, L3 bölgesi ile etkileşimleri ortaya koymaktadır. Önceki çalışma, piperacillin hidroliz ürününün penisilin-bağlayıcı proteinlere, "epimerize" protein ile bağlanabileceğini ortaya koydu. Başlangıçta oluşan (5 (19459020)] – penisiloik asite (PA) tercih edilene göre ürün bağlanmasıdır. Böylece, 1 'yı kullandık.' H NMR'den Piperasilinin zaman bağımlı SPM-1 ile katalize edilen hidrolizini değerlendirir (Şekil S33). Sonuçlar SPM-1'in piperasilin hidrolizini katalize ederek muhtemelen bir enzim haricinde (5 – ) – PA verecek şekilde nispeten yavaş epimerize olan (5 ) – PA'yi vermesi için katalizlendiğini ortaya koymaktadır Katalizli yol. (5 (19459019) S ) -PA ve SPM-1'e bağlanmayı araştırmak için, Bacillus cereus [BcIIMBL14PADahasonrasaflaştırılmıştırSonuçtakiY58C*karışımınailaveedilenpiperasilinzamanperiyodunda12saatsonragözlemlendiğigibi-8257ppm'debirzirveyeyolaçan(PA52C*'ye)(Şekil) 1 H ve su LOGSY analizleri, her ikisinin de (5 (19459020) PA ve (5A) SPM-1'e bağlanmasını ortaya çıkarmıştır (Şekil S34). 19 Hidrolize piperacillin ile etkileşen Y58C * SPM-1'in F-NMR spektrumları. Piperasilin ve hidrolize ürünlerin yapıları [5(19459019)R) – PA ve 5 (19459020] – PA] yapıları gösterilmektedir. Deney karışımları: 40 μ m Y58C * SPM-1

Daha sonra PrOF NMR'yi, SPM-1 substratları olan A sınıfı SBL inhibitörleri klavulanik asit ve tazobaktam ile SPM-1.89 Hat büyütme ve -83.15'den -83.02 ve -82.98 ppm'e geçiş, 19 F Y58C'de Sırasıyla tazobaktam ve klavulanik asit tayfları; 12 saat sonra başka hiçbir önemli değişiklik görülmedi. F151C * için böyle bir etki görülmedi (Şekil S35-39). Klavulanik asit ve tazobaktamın kompleks parçalanmaya uğradığı eğilimi21 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Nisan 2017 Çarşamba 08:00 – 20 Nisan 2017 Perşembe 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Nisan 2017 Çarşamba 08:00 – 20 Nisan 2017 Perşembe 08:00 Bir önceki yazımız olan 19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Nisan 2017 Çarşamba Akçaabat nöbetçi eczane, 19 Nisan 2017 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Nisan 2017 Çarşamba 08:00 – 20 Nisan 2017 Perşembe 08:00 Bir önceki yazımız olan 19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Nisan 2017 Çarşamba 08:00 – 20 Nisan 2017 Perşembe 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Nisan 2017 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Tunceli Nöbetçi Eczaneler başlıklı makalemizde 18 Nisan 2017 Salı nöbetçi eczane, 18 Nisan 2017 Salı Tunceli nöbetçi ekzane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Uşak Nöbetçi Eczaneler başlıklı makalemizde 18 Nisan 2017 Salı nöbetçi eczane, 18 Nisan …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 19 Nisan 2017 Çarşamba 08:00 – 20 Nisan 2017 Perşembe 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 19 Nisan 2017 Çarşamba 08:00 – …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

19 Nisan 2017 Çarşamba – 20 Nisan 2017 Perşembe Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 18 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni N …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Bir önceki yazımız olan 18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 18 Nisan 2017 Salı Akçaabat nöbetçi eczane, 18 Nisan 2017 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Bir önceki yazımız olan 18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 18 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 18 Nisan 2017 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 17 Nisan 2017 Pazartesi – 18 Nisan 2017 Salı Tunceli Nöbetçi Eczaneler başlıklı makalemizde 17 Nisan 2017 Pazartesi nöbetçi eczane, 17 Nisan 2017 Pazartesi Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi verilmektedir. …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ecza …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 17 Nisan 2017 Pazartesi – 18 Nisan 2017 Salı Uşak Nöbetçi Eczaneler başlıklı makalemizde 17 Nisan 2017 Pazartesi nöbetçi eczane, 17 Nisan …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Eczan …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 18 Nisan 2017 Salı 08:00 – …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ec …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi Ec …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Mardin / Ömerli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

47 Mardin Nöbetçi Eczaneler Adres : Ömerlı Ilçesı Hastane Yanı No: 3086 Ömerlı -Mardın İl / İlçe : Mardin / Ömerli Nöbet : 18 Nisan 2017 Salı 08:00 – 19 Nisan 2017 Çarşamba 08:00 Bir önceki yazımız olan 18 Nisan 2017 Salı – 19 Nisan 2017 Çarşamba Mardin / Nusaybin Nöbetçi Eczaneler başlıklı makalemizde 18 Nisan 2017 Salı Artuklu nöbetçi …

Devamını Oku »

19 Nisan'da geçmiş dünyayı savuşturmak için büyük asteroid

                                                                                                          Dünya, haftada birkaç kez geçip giden asteroitlerle doludur ama bunlar, 19 Nisan'da beklenen bir boyutta daha küçüktür.      Kaynak

Devamını Oku »

RNA helikazları, RNA yapılarını modüle etmek ve RNA-protein (RNP) kompleks montajını kolaylaştırmada temel roller oynamaktadır ] In vivo . Daha önceleri, laboratuarımızda S'de DEAD-box RNA helikaz Dbp2 gösterildi. Cerevisiae ko-transkripsiyonel olarak ilişkili mRNA'ya bağlanan protein Yra1, Nab2 ve Mex67'nin poli (A) + RNA üzerine etkili bir şekilde birleştirilmesini teşvik etmek için gereklidir. Ayrıca, Yra1'in doğrudan Dbp2 ile ilişkili olduğunu ve Dbp2'nin çözülme ve inhibisyon döngüsünü düşündüren Dbp2'ye bağlı dupleks çözme inhibitörü olarak işlev gördüğünü bulduk. Bunu test etmek için birlikte transkripsiyonel mRNP montajında ​​Dbp2 olaylarının sırasını aydınlatmak için bir dizi deney yaptık. Şimdi, Dbp2'nin RNA yoluyla kromatin içine alındığını ve Yra1 ve Mex67 ile geniş, RNA'ya bağlı bir kompleks oluşturduğunu gösteriyoruz. Dahası, tek moleküllü (smFRET) ve toplu biyokimyasal analizler, Yra1'in Dbp2'nin tek sarmallı RNA ile ilişkisini engelleyerek konsantrasyona bağlı bir tarzda çözmeyi engellediğini göstermektedir. Bu inhibisyon, Dbp2'nin mRNA üzerinde aşırı birikmesini ve RNA Pol II transkriptlerinin bir alt grubunun stabilize edilmesini önler. Yra1'in, mRNA'nın bir araya getirme işlemini Dbp2 ile sonlandırdığı bir model öneriyoruz. Anahtar kelimeler: DEAD-box, helicase, RNA-Protein kompleksi, kromatin, RNA [Giriş Gen ifadesi sayısız, koreografi yapılan basamakları içeren son derece karmaşık bir süreçtir . Giriş Ökaryotlarda transkripsiyon sırasında, yeni sentezlenmiş haberci RNA'ya (mRNA), nükleer ihracat ve çeviriden önce 5 'kapak, ekleme ve 3' son oluşumu da dahil olmak üzere çeşitli birbirine yakından bağlantılı işleme olaylarına rastlanır [1–3]. Bu adımların her biri boyunca, mRNA, her olgunlaşma evresinde kompozisyonu sürekli değişen haberci ribonükleoprotein kompleksleri (mRNP) oluşturmak için RNA-bağlayıcı proteinlerle bağlanır [4]. Uygun mRNP oluşumu gen ekspresyonu için kritiktir ve uygun biyolojik zaman noktasında doğru yapılandırılmış mRNA gerektirir [2,5]. Fiziksel özelliklerine bakıldığında, RNA molekülleri, uzun ömürlü ve alternatif konformasyonları açıp tekrar konrol etmek için büyük miktarda enerjiye ihtiyaç duyan kararlı ikincil yapılar oluşturma eğilimindedir [6,7]. Bu, hücrelerdeki RNA yapısal dönüşümlerini hızlandıran proteinlere ihtiyaç duyar. Tomurcuklanan mayada S. Cerevisiae mRNA, anormal yapıların oluşumunu önlemek için aktif mekanizmaların dahil edilmesini düşündüren, termodinamik tahminlerden farklı olarak in vivo olarak . Sürekli olarak, mayalanma maymundaki ATP tükenmesi, mRNA'da artmış sekonder yapıya neden olur [2]. Dahası, mRNA sekonder yapısının son genom analizleri, yapısal sapmaların gen regülasyonunu değiştirebileceğini gösteren düzenleyici bölgelerdeki tek nükleotid polimorfizmleri ile değiştirilmiş RNA yapısı (yani, miRNA-bağlanma alanları) arasında çarpıcı bir korelasyon bulmuştur Hücresel mRNA'ların yapısal yeniden düzenlenmesi için olası adaylar, RNA çözen veya RNA-protein (RNP) yeniden şekillendirme enzimleri olarak işlev gören ATP'ye bağımlı RNA helikazlarıdır [10,11]. DEAD-box proteinleri insan hücrelerinde yaklaşık 40 üyeyle (mayada 25) RNA helikaz familyasındaki en büyük enzim sınıfını oluştururlar. Bu sınıfın üyeleri, yaşamın tüm alanlarında bakterilerden memelilere kadar her yerde bulunur ve pre-mRNP meclisi [12] dahil olmak üzere RNA metabolizmasının her alanında yer alırlar. Örneğin, insan Tau proteinini kodlayan pre-mRNA'nın alternatif bağlanması, ekzon 10'un 5 'ek yeri [13]' in aşağısındaki bir kök-ilmek yapısıyla düzenlenir. U1 snRNP'nin tau ekzonunun 5 'ekleme sitesine erişebilmesi için, bu kök-döngünün DEAD-proteini DDX5 [13] tarafından çözülmesi gerekir. tau genindeki eklemenin yanlış düzenlenmesi, demans ile ilişkilidir ve doğru gen ifadesi için yeniden modellemenin önemini vurgulamaktadır [14,15]. Bununla birlikte, pre-mRNA / mRNA yeniden şekillendirme biyokimyasal mekanizması (lar) ımız konusundaki anlayışımız, birlikte transkripsiyonel süreçlerin karmaşık ve oldukça birbirine bağımlı doğası nedeniyle engellenmiştir. Dahası, bireysel DEAD-kutusu protein ailesi üyeleri, düzenleyici yardımcı proteinlerin verdiği biyolojik fonksiyonların çeşitlendirilmesiyle birlikte RNA tavlama, nükleotid algılama ve RNP yeniden biçimlendirme dahil olmak üzere geniş biyokimyasal farklı aktiviteler sergilemektedir S. DDX5'in cerevisiae ortologu Dbp2 [19] 'dır. Laboratuvarımız daha önce, Dbp2'nin kromatin kopyalama ile ilişkili olan aktif bir ATPaz ve RNA helikazının olduğunu tespit etmiştir [17,20]. Üstelik mRNA'ya bağlanan protein Yra1 ve Nab2'nin yanı sıra mRNA ihracat reseptörü Mex67'nin mRNA üzerine birleştirilmesi için Dbp2 gereklidir [17]. İlginç olarak, Yra1 doğrudan Dbp2 ile etkileşime girer ve bu etkileşim, Yra1'in Dbp2'nin çözülmesini kısıtladığını gösteren çoklu döngü, toplu analizlerde Dbp2'nin çözülmesini engeller [17]. Bununla birlikte, Yra1'e bağlı inhibisyonun mekanizması ve biyolojik rolü anlaşılamamıştır. Biyokimyasal, moleküler biyoloji ve biyofiziksel yöntemlerin bir kombinasyonunu kullanarak, şimdi Yra1'in Dbp2'nin aktivitesini -transkripsiyonel mRNP montaj adımları. Bu inhibisyon, transkript seviyelerinin bakımı için önemlidir in vivo . Tek moleküllü (sm) FRET ve floresan anizotropi çalışmaları, Yra1'in Dbp2'nin RNA ile ilişkisini önleyerek Dbp2'nin çözülmesini engellediğini göstermektedir. Sürekli olarak, maya hücrelerindeki Yra1-Dbp2 etkileşiminin kaybı, mRNA üzerinde Dbp2'nin transkripsiyon sonrası birikmesine neden olur. Birlikte ele alındığında, bu, Yra1'in in vivo olarak Dbp2'ye bağımlı mRNP birleşiminin bir döngüsünü sonlandırdığını düşündürmektedir

Sonuçlar Dbp2 işe alındı DEAD-box RNA helikaz Dbp2 ağırlıklı olarak aktif olarak transkripsiyona uğramış genler ile çekirdekte lokalizedir [20–23]. Dbp2'nin başlangıçtaki RNA aracılığıyla kromatin ile işe alınıp alınmadığını belirlemek için, RNaz ile veya olmadan RNase ile kromatin immünopresipitasyon (ChIP) analizleri yaptık [24]. Kısaca, endojen DBP2 kodlama bölgesinin 3 'ucuna kaynaşmış bir 3XFLAG epitop etiketi barındıran maya hücreleri, bilinen gen olan …

Devamını Oku »

19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 Mart 2017 Pazar 08:00 – 20 Mart 2017 Pazartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 19 …

Devamını Oku »

19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Yeni N …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 19 Mart 2017 Pazar 08:00 – 20 Mart 2017 Pazartesi 08:00 Bir önceki yazımız olan 19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 19 Mart 2017 Pazar Akçaabat nöbetçi eczane, 19 Mart 2017 …

Devamını Oku »

19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En Yen …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 19 Mart 2017 Pazar 08:00 – 20 Mart 2017 Pazartesi 08:00 19 Mart 2017 Pazartesi – 20 Mart 2017 Pazartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 19 Mart 2017 Pazar Akçaabat …

Devamını Oku »

19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 19 Mart 2017 Pazar 08:00 – 20 Mart 2017 Pazartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 19 Mart 2017 …

Devamını Oku »

19 Mart 2017 Pazar – 20 Mart 2017 Pazartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 18 Mart 2017 Cumartesi – 19 Mart 2017 Pazar Tunceli Nöbetçi Eczaneler başlıklı makalemizde 18 Mart 2017 Cumartesi nöbetçi eczane, 18 Mart 2017 Cumartesi Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler …

Devamını Oku »