22 Ağustos 2017,Salı
Anasayfa » Tag Archives: 10

Tag Archives: 10

Microsoft'un yeni Windows 10 Mobile üzerine üzerine çalışıyor!

Microsoft'un yeni windows 10 mobile cihazı ile karşımıza çıkmaya hazırlanıyor. Teknoloji devine yakın olan kaynaklardan gelen bilgilere göre, şirket yeni üst sınıf cihazı üzerinde sıkı bir çalışma yürütüyor. Microsoft'tan yeni Windows 10 telefon! Thurrott.com Yönetici Editörü Brad Sams Tarafından sunulan bilgilere göre, yeni üst sınıf Windows 10 Birinci okunmamış Mesaja git iş sisteminiz var telefonun prototipinin şirketi tarafından incelenmekte olup …

Devamını Oku »

Genom çapında ilişki çalışması, bağışıklık sistemini etkiler … İnflamatuar bağırsak hastalığı (IBD), iki ortak hastalık alt tipi olan Crohn hastalığı ve ülseratif koliti içeren gastrointestinal sistemin kronik, zayıflatıcı bir bozukluğudur. Hastalık patogenezi tam olarak anlaşılamamıştır, ancak genetik olarak duyarlı bireylerde bilinmeyen çevresel tetikleyicilere yönelik düzensiz bir bağışıklık tepkisi ile tahrik edilmektedir. Tedavi rejimleri semptomların hafifletilmesini sağlamak ve sürdürmek için genellikle güçlü immüno-modülatörler kullanır. Bununla birlikte, hastalar sıklıkla yan etkilere maruz kalır, tedaviye yanıt vermez veya IBD'nin komplikasyonlarını geliştirebilirler ve birçoğu büyük karın cerrahisi gerektirir. Önceki genom çapında ilişkilendirme çalışmaları (GWAS) ve İmmunocip kullanılarak hedefe yönelik takip, IBD için genetik risk lokusunu belirlemede çok başarılı olmuş, ancak artmış biyolojik anlayışın, bu bozukluklar için tedavide henüz önemli bir etkisi olmadı. Bu bozuklukların biyolojisi konusundaki anlayışımızı daha da genişletmek için bugüne kadar IBD'nin genom çapında bir meta-analizine dahil edilmemiş olan, Avrupa kökenli 13.144 popülasyon kontrolu 12.160 IBD olgusu içeren bir GWAS gerçekleştirdik (Ek Tablo 1, Çevrimiçi Yöntemler). 4.686 IBD vakasından 9 ve 6.285 halka açık popülasyon kontrolünden 10 11 tüm genom dizilerini içeren bir referans paneli kullanarak genotipleri yerindeydik. Kalite kontrolünü takiben (Çevrimiçi Yöntemler) 9.7 milyon siteyi birliktelik için test ettik. International IBD Genetics Consortium 1 (19459006) tarafından yapılan son meta-analizde 232 IBD'ye eşlik eden SNP'lerde 228 verilerimizde aynı yönde etkilere sahipti, 188 en azından nominal replikasyon bulgusu gösterdi (P <0.05) Ve hiçbiri Cochrane Q testi ile heterojenite etkisi açısından önemli bir kanıt göstermemiştir. Bu çoğaltılmış lokuslar arasında, Doğu Asya kökenli bireylerde sadece daha önceden Crohn hastalığı ile ilişkili olan 10q25 kromozomunda genom çapında önemli bir ilişki vardı 7 , Bu da popülasyonlardaki genetik risk lokuslarının neredeyse tamamen paylaşılmasını desteklemektedir 1 . Yeni GWAS verilerimizi, 1.000 Genomes Projesi referans paneli 1 (19459006) (Ek Tablo 1-3, Ek Tablo 2) kullanılarak atıf yapılan 12.882 IBD vakasından ve 21.770 popülasyon kontrolünden önceki yayınlanmış özet istatistikleriyle meta analiz ettik. Özet istatistiklerinin (sırasıyla, Crohn ve ülseratif kolit için GC = 1.23 ve 1.29) enflasyonunu gözlemledik, ancak LD puanı gerilemesi, bunun karıştıkları popülasyon alt yapısından ziyade geniş polijenik sinyalden kaynaklandığını ortaya koydu Kesişme = 1.09, Çevrimiçi Yöntemler). Genom çapında önemi olan 25 yeni lokus tespit ettik (). Nedensel varyantları, genleri ve mekanizmaları tanımlamak için, bu lokuslar ve daha önce keşfedilen lokuslar üzerinde, verilerimizde genom çapında önemli olan ancak ince haritalama henüz yapılmamış olan lokuslar üzerinde bir özet istatistik ince haritalama analizi yaptık Denendi 12 (Çevrimiçi Yöntemler, Ek Tablo 3). İnce eşlem çıkarımlarından emin olmak için sonraki analizleri, ilişkili tüm varyantlar için yüksek kaliteli atıf edilen verilere sahip olduğumuz 12 sinyale sınırladık (Çevrimiçi Yöntemler). Bu 12 lokasyondan 6'sında nedensellik olasılığı>% 50 olan tek bir varyant tespit ettik (Ek Şekil 4-6). Bunların arasında tek bir varyantın nedensel olma ihtimalinin>% 99 olduğu iki lokus vardı: SLAMF8 (rs34687326, p.Gly99Ser,) ve protein fonksiyonlarını etkilediği tahmin edilen bir missense varyantı Th17 hücre farklılaşmasının anahtar düzenleyicisi, RORC 13 . SLAMF8 aktifleştirilmiş miyeloid hücreler üzerinde eksprese olan bir hücre yüzeyi reseptörüdür ve enflamasyon bölgelerine göçünü inhibe ederek inflamatuar yanıtları olumsuz bir şekilde düzenlediği ve reaktif oksijen türlerinin üretimini (ROS) baskı altına aldığı bildirilmiştir ] 15 . Risk azaltma alleli (MAF = 0.1) 'in protein fonksiyonunu etkilediği (CADD = 32.0, 92 ve missense varyantlarının persentil yüzdesi 16 ) olduğu gözlemiyle birlikte bu, Olası bir işlev kazanımı mekanizmasını değerlendiren başka deneyler yapmak da faydalı olabilir. RORC Th17 hücrelerinin ana transkripsiyonel düzenleyicisi olan RORγt 13 ve grup 3 doğuştan gelen lenfoid hücreleri 17 kodlar. Bu hücre tiplerinin her ikisi de, özellikle bağırsakta mukozal yüzeylerde savunmada önemli rol oynar ve bağırsak bağışıklık sistemi ile bağırsak mikrobiyolojisi 18 arasındaki homeostaza katkıda bulunduğu gösterilmiştir. 19 iltihaplı bağırsak hastalığında kaybolduğu bilinen bir dengedir 20 . RORγt'ın farmakolojik inhibisyonunun fareden bağırsak iltihabı modellerinde terapötik fayda sağladığı gösterilmiştir ve IBD hastalarının primer bağırsak örneklerinden izole edilen Th17 hücrelerinin sıklığını azaltmıştır .

Muhtemel nedensel missense varyantları

Devamını Oku »

Windows 10 güvenli model nasıl açılır?

Windows ve Linux işletim sistemlerinde sorun gidirken kullanılmış en önemli yöntemlerden biri olan Güvenli Mod bilgisayarardaki böcek ve virüslerden kurtulmanın kolay kolay yollarının bir tanesi. ] Güvenli mod ile daha minimal bir arayüze sahip, sadece gerekli olan servis ve sürücülerin çalışmasıyla ilgili. Bilgisayarardaki hatayı daha çabuk teşhis edebiliyor. Güvenli mod windows 10 işletim sistemi öninde bilgisayarın açılması zaman F8'e basarak …

Devamını Oku »

Windows 10 için sevindirici yenilikler!

Popüler işletim sistemi windows 10 için büyük değişimlere hazırlanan Microsoft 'un, bu yılın başlarında tanıtımı gerçekleştirilen Zaman Tüneli özelliğini ilerleyen bir kişinin kaderini ertelediğini boyutlara duyurmuştuk. Geçmişe karşı günümüze yayınlanan Windows 10 ön tanımlama sürümü 16237 ile birlikte yüksek çözünürlükte yaşanan sorunların giderilmesini sağlar yenilikler işletim sistemi eklenmiş durumda. Gelin, şimdi Windows 10 Build 16237 ile birlikte kullanıcılara sunacak olan …

Devamını Oku »

Dünya Savaşı Heroes 1.0 Android Cephane Hile MOD APK indir

Dünya Savaşı Kahramanları 1.0 Android Cephane ve Premium Hesap Hile MOD APK + DATA indir Dünya Savaşı Heroes heyecan dolu bir aksiyon, savaş oyunudur. Oyunda siz düşmanlarınıza karşı savaşacaksınız. Çok oyunculu bu savaşlarda düşmanlarınıza karşı pes etmeden mücadele etmelisiniz. Savaş esnasında düşmanlarınızdan daha dikkatli ve daha iyi performans sergileyip savaşları kazanmanız gerekiyor. Sizde bu heyecan dolu oyunu oynamak ve alt …

Devamını Oku »

AliceInCube 1.0 Android Full APK indir

AliceInCube 1.0 Android Tam APK indir AliceInCube 1.0 Android Tam APK indir AliceInCube heyecan dolu bir bulmaca oyunudur. Oyunda sizin zorlu görevleriniz olacaktır. Tamamlamaya çalışmaya hazırsın. Bu amaç uğruna gerekli bulmacaları çözmeniz gerekiyor. Karşınıza çıkan olaylara karşı görevlerinizi tamamlayıp seviyelerde ilerleyerek oynamak bir performans sergileyebilirsiniz. Sizde bu oyunu oynamak disk oyun mağazalarında 4,59 TL ücretli olan bu oyunu Viyaza.com'dan ücretsiz …

Devamını Oku »

Spotify kullanmanın 10 yaratıcı yolu

Yalnızca kendine uygun bir şekilde çalmak için bir hesap oluşturun, yanılıyorsunuz. Spotify dinleyicileri bugüne kadar aşklarını ilan etmekten, ayrılmak isteyenlere dile getirmeye ve hatta denemek istediklerini belirten kişilere. İşte, Spotify çalma listelerinin dışına alışılagelmişin hariç 10 farklı kullanımı: Aşkınızı itiraf edin – Nuh, Joanne ve Lazy Dog, Spotify'ı aşklarını ilan etmek için kullananlar arasında yer alıyor. Hannah Woodley, çalma listesindeki …

Devamını Oku »

Panthera Frontier 1.0 Android Para Hile MOD APK indir

Yazar: Gökhan Öğütcü Kategori: Android Hileli Oyunlar, Android Strateji Oyunları 5 Temmuz 2017 3 Görüntülenme Panthera Frontier 1.0 Android Para Hile MOD APK + DATA indir Panthera Frontier heyecan dolu bir strateji oyunudur. Maceralara gireceksiniz. Girdiğiniz her macerada görevlerinizi tamamlamanız gerekiyor. Siz bu amaç uğruna mücadele edeceksiniz. Kendinize bir strateji oluşturun ve oluşturun strateji ile mücadele edip görevlerinizi tamamlamaya çalışın! …

Devamını Oku »

Windows 10 Zaman Tüneli özellik ertelendi!

Bu yılın başlarında tanıtımı gerçekleştirilen Zaman Tüneli (Zaman Çizgisi) özelliğinin beklendiği gibi Sonbahar Creators Güncellemesi yer almayacağı açıklanmış DURUMDA . Peki, beklenen Windows 10 özelliklere ne zaman sunulacak? Windows 10 için Sonbahar Creators Güncellemesi'nde önemli eksiklik Android için ve iOS akıllı telefonlar da dahil birden fazla cihaz arasında geçiş yapabilmesi sağlanacak. Öte yandan Microsoft, sonraki büyük Windows 10 güncellemesi olarak …

Devamını Oku »

10 Dalgalı Lob Saç Stilleri

Dalgalı lob saç stili sadece stil yapmakla kalmaz, aynı zamanda son derece modaya uygun! Tüm saç tiplerine uygun bir stildir ve iyi bir stilist yüz şeklinize ve cilt tonu için en iyi versiyonunu size bildirecektir. Bugünün dalgalı lob saç modelinin galerisi kalın, orta ve ince saçlar için farklı uzunluklar, dalga desenleri ve şekilleri içerir. Ancak sadece bu değil! Bu loblar, …

Devamını Oku »

Windows 10 fidye virüsü çözümü kırıldı

Windows son ​​dönemlerde fidye virüsleri yle ardı arkası kesilmez bir şekilde problemler yaşıyor. windows 10 için güvenlik önlemi hazırladı. Korunan klasörler is minimiz taşıyan özellikli güncel Windows 10 Insider sürümüyle kullanıma açıldı. Pratikte çok basit ve etkili bir şekilde çalışması amaçlanan bu yeni özellik, sınıfta kaldı. Korunan yazı tipi seçtiğinizde fidye virüsleri tarafından silinemeyen ve şifrelenemeyen bu devreye müdahale etmek …

Devamını Oku »

İlk iPhone, 10 yıl önce olanlarla buluştu!

Bundan 10 yıl önce San Francisco 'da düzenlenen Macworld Expo 2007 etkinliğinde sahneye çıkardı Steve Jobs, ilk iPhone modelinin duyurusunu gerçekleştirdi. Steve Jobs 'un' Dokunmatik kontrollere sahip geniş ekranlı bir iPod, devrim niteliğinde bir cep telefonu ve devrim niteliğinde bir internet iletişim cihazı. Bunların tamamı tek bir cihaz haline geldi. 'Ifadeleri şüphesiz telefon sektöründe büyük bir hareketlenmenin başlangıcını sağladı. 29 …

Devamını Oku »

Microsoft Windows 10 için yeni tema mağazası!

Microsoft Windows işletim sistemi ile geçmişten günümüze kullanıcı adı geniş bir özelleştirme destek sunmakta. Bu bağlamda windows 10 Creators Güncellemesi ile ilgili ve çok kullanıcıyı çok sevindirecek yeni tema mağazasına yakından bakıyoruz. Windows 10 için yeni tema mağazası! Microsoft'un her ondan daha önceki Winodws sürümlerinde kullanıcılarına geniş bir özelleştirme seçeneği sunmuş olsa da, Windows 10 Creators Güncellemesi ile gelen Tema …

Devamını Oku »

Eğlenceden Sahnelere 10 En İyi Örgülü Saç Stilleri

Bugünün canlı galerisi, tüm dünyadaki kadınlar tarafından oylanan En İyi Örgülü Saç Stilleri 'ten seçilen en son eğilimleri getiriyor! Bu yüzden bu görüntü sıcak! Bu yıl, ombré'nin ve balayage'ın örgülü haldeyken yaptığı muhteşem renk modellerini görüyoruz. Ve kesinlikle daha önce görmediğimiz yepyeni renk kombinasyonları, çok iyi bir göz atın. Günlük örgüleri cazırlamak için yeni bir bükülme, tamamen şok edici bir …

Devamını Oku »

Kritik Windows 10 açığı keşfedildi!

windows 10 Tarafında keşfedilen bir güvenlik zafiyeti nedeniyle hackerlar Windows'un köklü koruması aşarak bilgisayarınıza sızabiliyor! Windows 10 geçtiğimiz dönemlerde gerçekleşen WannaCry saldırgan etkisini göster yeni atabiyleken yeni bir güvenlik zafiyeti ile karşı karşı kaldı. GhostHook Bu saldırıyla birlikte Windows 10 'da bulunan ve rootkit güvenli hale getirmek sistem atlatarak sisteme sızmak mümkün hale geliyor. Windows 10 büyük tehlike altında! Sadece …

Devamını Oku »

32 terabayt gizli Windows 10 kaynak kodu çalındı!

marka veya kuruluşların kabusu haline gelen siber saldırılara bugün bir yenisi daha eklendi. Ancak bu seferki sadırının kurbanı hiç beklenmedik bir şekilde Microsoft oldu! Yakın çevrenin yaşlanması bu saldırıyla beraber korsanlar kapalı kaynak kodlu Windwos 10 iş sisteminin tescilli yaklaşık 32 Terabayt 'dan fazla kaynak kodunu ele geçirilmiş bulunmakta. donanımsal sürücülerinden kullanıcı Kural yönetilmesine kadar çok farklı verinin korsan mecrasında …

Devamını Oku »

10 Zırhlı Saç Stilleri – Seveceksiniz Oldukça, Posh, Eğlenceli ve Vintage Görünüyor

At kuyruğu saç stilleri sizin gibi basit veya gösterişli olabilir, çünkü her zaman moda. Bununla birlikte, en moda at kuyruklu saç modellerini giymek isterseniz, günümüzün yeni at kuyruğu fikirleri galerisine bakmanız gerekiyor. Bu saç biçimi, kadınlar için en eski saç modellerinden biri olabilir, ancak yine de kendi kişisel dokunuşumuzu eklemeyi seviyoruz! Gündelik saçlı saçlı saç modelleri için 4 sevimli detaylar

Devamını Oku »

Dünyadaki 10 Film Temalı Otel Otel tarafından inceleme ve rezervasyon yaptırmak için

Sinemanın endüstriyelleşmesiyle birlikte filmi kahramanlarının oyuncakları ve eşyalarının satılması bir yana, artık film Temalı otel odaları da yapılmaya başlandı. Film temalı otel odalarıyla birlikte; Insanların hayran sahipleri film karakterlerinin hayatını daha da yakından tecrübe etlerini amaçlanıyor. Ya da insanlar filmi izlerken kendilerinin yerine koydukları karakter gibi hissetmek için bu özenerek yapılmış otel odalarında istedi. Öyleyse okuma bakalım, otel odalarının içlerinde …

Devamını Oku »

Yaz Saç Renklerinde Uzun Saç İçin 10 Katmanlı Saç Stili ve Kesim Kafası

katmanlı saç modelini icat edenler mutlak bir deha idi! Saçlarınız kalın ve kontrol edilemiyorsa, inceltme katmanları güzel, doğal bir şekil oluşturur ve saçınızın güzelliğini ortaya çıkarır. Ve eğer saç ince ve kolayca tartılırsa, iyi yerleştirilmiş birkaç katman kiloyu kaldırır, böylece ipeksi trisepsleri yumuşatır ve hacimlendirir! Bugünün trend saçan, uzun saçlar için katmanlı kesim en iyi ince, orta veya kalın saç …

Devamını Oku »

IOS 11 vs iOS 10 depolama alanı Karşılaştırması!

ve yenilik denildiği zaman akla gelen ilk isimlerden biri olan Apple, bu yılki WWDC etkinliğinde tanıttığı yeni işletim sistemi ] IOS 11 ile de, kullanıcılarına birçok yeni özellik ve avantaj sunmaktan geri kalmadı. iOS 11 'in, bir önceki nesil iOS 10 ' a göre depolama performansı kıyaslandı. iOS 11 vs iOS 10 depolama alanı karşılaştırması! geliştirici betasının yüklenmesinin ardından yapılan …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Süper Seksi Renklerde Kalın Saçlar İçin 10 Orta Boy Saç Stilleri

Gözü kandıran özel FX'den, yüz yumuşatma bejine, şirin altın, alev alevlenen kırmızı ve buzlu kül sarışları – bunlar en taze orta saç kesimleridir! Hemen adım atın ve fab, yeni dalga desenleri, tüylü, fırtınalı stiller ve tamamen trendy smoothies ile dolu orta saç modelleri galerimizin tadını çıkarın! Ve bazı çok şirin ve seksi yeni saç rengi fikirleri! Kalın saçlar için orta …

Devamını Oku »

Leviathan Reef 1.0 Androi Full Hile APK indir

Lies Yalanı: Leviathan Reef 1.0 Androi Tam Hile APK indir Lies Yalanı: Leviathan Reef 1.0 Androi Tam Hile MOD APK + DATA indir Yalan Denizi: Leviathan Reef heyecan dolu bir macera oyunudur. Oyunda annenizin ölümünden sonra babanızı ziyarete gideceksiniz. Deniz yolculuğunda yapacağınız zorla tehlikeler sizi bekliyor olacaktır. Siz bütün tehlikeleri bilerek bu yola çıktınız. Amacınıza ulaşabilmek için yapacağınız yolculukta karşınıza …

Devamını Oku »

Lightning League 1.0 Android Yakıt Hile APK indir

Yazar: Gökhan Öğütcü Kategori: Android Aksiyon Oyunları, Android Araba Yarışı Oyunları, Android Hileli Oyunlar, Android Macera Oyunları, Android Yarış Oyunları 16 Haziran 2017 4 Görüntülenme Otomobiller: Lightning League 1.0 Android Yakıt Hile MOD APK indir Otomobiller: Lightning League 'Disney' tarafından tasarlanmış bir araba yarışı oyunudur. Sevilen çizgi filmi kahramanı Şimşek McQuin yine yarışlarda! Siz onu yönlendirip yarışları kazanabilirsiniz sağlamaya çalışacaksınız. …

Devamını Oku »

Commercial Bus Simulator 17 1.0 Android Hile APK indir

Yazar: Gökhan Öğütcü Kategori: 2017 Android Oyunları, Android Hileli Oyunlar, Android Simülasyon Oyunları 16 Haziran 2017 12 Görüntülenme Ticari Otobüs Simülatörü 17 1.0 Android Kilitler Açık Hile MOD APK indir Ticari Otobüs Simülatörü 17 heyecan dolu bir simülasyon oyunudur. Oyunda sen bir otobüs şoförü olacaksınız. Bir ticaret şehir otobüsünü yönlendireceksiniz. Otobüste yolcuları yolcuları ve gidecekleri yere götürmeye çalışacaksınız. Otobüsü doğru …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Fab Yeni Kalın Kuşlardaki Kalın Saçlar İçin En İyi 10 Kısa Saç Stilleri

Daha sıcak havalarda arkadaşlarımızla ve ailenizle daha fazla sosyalleşmemizi istiyoruz, şimdi saç kesiminizi ve renginizi güncellemenin zamanı geldi! Renkliler kül sarışınlı ve kül renginin sanatsal renk karışımlarıyla bu sezon limiti yaratıcılık altına alıyorlar. Cildiniz sıcak bir tonlamaya sahipse, gorgeously yumuşak, zarif ve gülünç bej renkleri arasından seçim yapabilirsiniz. Scarlet red şu anda esmerler için güçlü bir trend. Ve gerçekten maceraperestlik …

Devamını Oku »

Infinity Alive 1.0 Android Altın Hile MOD APK indir

Infinity Alive 1.0 Android Altın Hile MOD APK indir Infinity Alive 1.0 Android Altın Hile MOD APK indir Infinity Alive heyecan dolu bir RPG oyunudur. Oyunda size düşmanlarınıza karşı hayatta kalma mücadelesi vereceksiniz. Öncelikle özel güçlerini öğrenin. Düşmanlarınıza karşı mücadele ederken bu özel güçleri kullanmalısınız. Bu şekilde mücadele etmek için sizin için kazanmak daha kolay olacaktır. Sende bu durumun bilincinde …

Devamını Oku »

Kalıtsal pankreatit (HP), hem akut hem de kronik pankreatitin özelliklerini gösteren otozomal dominant bir hastalığıdır . İnsan katyonik tripsinogenindeki mutasyonlar HP ile ilişkilidir ve pankreatit patogenezinde bazı bilgiler sağlamıştır ancak pankreatitin başlatılmasından sorumlu mekanizmalar aydınlatılamamıştır ve apoptoz ve nekrozun rolü şu şekildedir: (19459007) PRSS1 Çok tartışılan. Bununla birlikte, pankreatik akinar hücre içerisinde erken tetiklenen, tripsinogen'in başlatma sürecinde önemli bir rolü olduğu genel olarak kabul edilmiştir. HP'nin işlevsel çalışmaları, hastalığın gelişimini otantik olarak taklit eden bir deney sisteminin bulunmaması nedeniyle sınırlandırılmıştır. Bu nedenle, sıçanın akinar hücrelerinde insan katyonik tripsinogen ekspresyonunun pankreatiti teşvik edip etmediğini belirlemek için, vahşi tip (WT) insan PRSS1 veya iki HP ile ilişkili mutant (R122H ve N29I) kullanarak yeni bir transjenik fare modeli sistemi geliştirdik. Sıçan elastaz promotörü üretilen üç transgenik suş içerisinde pankreatik asinar hücrelere transgen ekspresyonunu hedeflemek için kullanıldı: Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg (Ela-PRSS1 * N29I) NV. Fareler, immünohistokimyasal ve biyokimyasal olarak histolojik olarak analiz edildi. Transgen ekspresyonunun pankreatik asiner hücrelerle sınırlı olduğunu ve transjenik PRSS1 proteinlerinin pankreas salgı yolunu hedeflediğini bulduk. Tüm transgenik suşlardan alınan hayvanlar, asiner hücre boşalması, inflamatuvar infiltratlar ve fibroz ile karakterize pankreatiti geliştirdi. Transgenik hayvanlar aynı zamanda düşük doz serulein ile tedavi edildiğinde kontrollere göre daha ağır pankreatit geliştirdiler ve ödem, inflamasyon ve genel histopatoloji açısından anlamlı derecede yüksek skorlar sergilediler. Asit hücrelerinde PRSS1, WT veya mutantların ekspresyonu, pankreatik dokularda ve izole asiner hücrelerde apoptozu arttırdı. Üstelik, izole akinar hücreler üzerine yapılan çalışmalar, transgen ekspresyonunun nekrozdan ziyade apoptozu teşvik ettiğini göstermiştir. Bu nedenle, murin asiner hücrelerde WT veya mutant insan PRSS1'in ekspresyonunun apoptozu indüklediğini ve hücresel hakarete yanıt olarak artmış olan spontan pankreatiti teşvik etmek için yeterli olduğuna karar verdik. Anahtar kelimeler: [19459013Herediterpankreatit(HP)akutpankreatit(AP)tekrarlayanataklarlakarakterizedirvebuataklarınsıklıklailerlemekaydettiğiakutpankreatit(AP)ataklarıilekarakterizedir Ekzokrin ve endokrin yetersizliği olan kronik pankreatit (CP) 1, 2, 3 HP, insan katyonik tripsinojen geninde (proteaz serin 1) mutasyonlar ile ilişkilidir PRSS1 . HP hastalarında en sık rastlanan iki mutasyon PRSS1 R122H ve N29I'dir. 5 Biyokimyasal çalışmalar, her iki mutasyonun da, 'tryp' için artan bir eğilimin neden olduğu bir 'kazanç' ile ilişkili olduğunu göstermiştir Sin aracılı tripsinojen otoaktivasyonu. 6, 7 Buna ek olarak, R122H mutasyonu, tripsini otomatik hidrolize dirençli hale getirir ve protein stabilitesini arttırır. 4, 8, 9 Trypsinojen aktif olmayan bir prekürsördür Duodenal enterokinaz ile aktive tripsin haline getirilen pankreasın asinar hücreleri tarafından salgılanır. 10 Tripsin, kendisini ve diğer pankreas sindirim enzimi prekürsörlerini harekete geçirme kabiliyeti nedeniyle sindirimde önemli bir role sahiptir. Bu, tripsinojenin uygun olmayan intra-asinar aktivasyonunun, aşı hücresinin, tripsin aktivitesinin% 20'sine kadarını inhibe edebilen PSTI (pankreas salgı tripsin inhibitörü veya SPINK1) gibi koruyucu mekanizmaları bastırabilecek bir kaskad başlattığına ilişkin hipoteze yol açmıştır , 11, 12, 13, 14 pankreatit ile sonuçlanır. 15, 16 Pankreatit başlandıktan sonra, inflamatuar hücre infiltrasyonu, pro-inflamatuar mediatörlerin salınması ve hücre ölümü gibi sekonder olaylar 17, 18, 19 AP'nin deneysel modelleri, asinar hücre ölümünün hem apoptoz hem de nekroz yoluyla ortaya çıkabileceğini ve bunun da daha ciddi bir sonuç ile korele olduğunu göstermiştir. , 20, 21 Deneysel pankreatitte tripsinogenin intra-asinar aktivasyonu gösterilmiş olmasına rağmen, kesin aktive mekanizması ve tripsinin pankreatit gelişimindeki rolü açıklığa kavuşmamıştır. Archer ve ark. 22 trypsinojenin in vivo rolünü araştırmak için, mutasyona uğramış bir fare tripsinogen geninin akinara spesifik ekspresyonuna dayanan bir model geliştirdi , Insan R122H mutasyonuna denk düşen ve hayvanlarda yaş arttıkça fibrotik değişikliklerin kanıtlanması ile akut pankreas hasarının erken başlangıçlı olduğunu bildirmiştir. İnsan katyonik tripsinogeninin R122H mutantının ekspresyonuna dayanan bir başka fare modeli de geliştirildi; Bununla birlikte, bu hayvanlar muhtemelen düşük transgen ekspresyonu nedeniyle spontan bir fenotip geliştirmede başarısız oldu. 23 Bu çalışma, vahşi tip (WT) insan katyonik tripsinojeni PRSS1, spontan pankreatit ile sonuçlanacak mı, yoksa PRSS1'in mutant formlarının (özellikle HP'ye bağlı PRSS1 R122H ve N29I) ekspresyonunun hastalığın teşvik edilmesi için gerekli olup olmayacağı yeterli olacaktır. Çalışmalarımızı iki ana nedenden ötürü insan tripsinojeni (PRSS1) üzerine kurmayı tercih ettik: (1) diğer memeli tripsinojenlerle karşılaştırıldığında 24, 25 otomatik aktivasyon eğiliminin yüksek olması ve (2) çünkü Bilinen fare tripsinogen genlerinden hangisinin mutasyon HP'ye neden olabilen ana insan tripsinojeni olan PRSS1 ortologudur belirsizdir. Her üç suşun hayvanlarının spontan pankreatit geliştirmeye daha yatkın olduklarını ve serülan meydan okumadan sonra bunun arttığını göstermektedir. Verilerimiz, WT veya mutant olsun, insan PRSS1 geninin ekspresyonunun bu hayvanları pankreatit geliştirmesine yatkınlaştırdığını göstermektedir. Buna ek olarak, çalışmalarımız, nekroz yerine asinar hücre apoptozunun, transgen ekspresyonuyla ve dolayısıyla model sistemimizde pankreatit gelişimi ile ilişkili olduğunu düşündürmektedir.

Sonuçlar PRSS1 transgenik fareleri, insan PRSS1'i dokuya spesifik bir şekilde eksprese ettik. Üç transgenik fare suşu Tg (Ela-PRSS1) NV, Tg (Ela-PRSS1 * R122H) NV ve Tg'yi (Ela-PRSS1 * N29I) NV, transgen ekspresyonunu hedeflemek için bir sıçan elastaz promotörünü kullanarak pankreasın asinar hücrelerinde WT'yi veya PRSS1'in iki mutasyona uğratılmış formundan (R122H ve N29I) birini ifade etmiştir. Bundan böyle bu suşlar Sırasıyla …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin E …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 10 Haziran 2017 Cumartesi 08:00 – 11 Haziran 2017 Pazar 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 10 …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 10 Haziran 2017 Cumartesi 08:00 – 11 Haziran 2017 Pazar 08:00 Bir önceki yazımız olan 10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 10 Haziran 2017 Cumartesi Akçaabat nöbetçi eczane, 10 Haziran 2017 …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 10 Haziran 2017 Cumartesi 08:00 – 11 Haziran 2017 Pazar 08:00 10 Haziran 2017 Cumartesi nöbetçi eczane ve 10 Haziran 2017 Cumartesi Trabzon'da nöbetçi eczane hakkında bilgiler verilmektedir. Onun günleri güncel ve …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 10 Haziran 2017 Cumartesi 08:00 – 11 Haziran 2017 Pazar 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 10 Haziran 2017 …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız olan 9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Tunceli Nöbetçi Eczaneler başlıklı makalemizde 9 Haziran 2017 Cuma nöbetçi eczane, 9 Haziran 2017 Cuma Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgi …

Devamını Oku »

Haftanın Android Uygulamaları – 10 Haziran

Android işletim sistemli cihazınızın uygulama mağazası olan Google Play Store ' da öne çıkan uygulamalar sizler için önerdik. Her hafta düzenli olarak devam ettik Haftanın Android Uygulamaları ile siz değerli okurlarımızla yeniden birleştir. Haftanın en iyisi ve yeni Android uygulamaları! Shiftdelete.Net ekibi olarak, onun hayranları için başarılı Android uygulamasını bir araya getireceğiz. İşte karşınızda Haftanın Android Uygulamaları!

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız olan 9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Uşak Nöbetçi Eczaneler başlıklı makalemizde 9 Haziran 2017 Cuma nöbetçi eczane, 9 Haziran …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 10 Haziran 2017 Cumartesi 08:00 – 11 Haziran 2017 Pazar 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 10 Haziran 2017 Cumartesi 08:00 – …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbe …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

10 Haziran 2017 Cumartesi – 11 Haziran 2017 Pazar Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni N …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Şükraniye Eczanesi Adres : Ahi Evren Kalp Damar Ve Ğögüs Hast.Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 9 Haziran 2017 Cuma 08:00 – 10 Haziran 2017 Cumartesi 08:00 Eczane : Poyraz Eczanesi Adres : Yenimahalle Sahil Yolu Alyans Düğün Salonu Karşısı İl / İlçe : Trabzon / Ortahisar Nöbet : 9 …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler | Türkiyenin En Ye …

61 Trabzon Nöbetçi Eczaneler Adres : Çamlıca Mah. Hükümet Cad.No:65/A İl / İlçe : Trabzon / Sürmene Nöbet : 9 Haziran 2017 Cuma 08:00 – 10 Haziran 2017 Cumartesi 08:00 Bir önceki yazımız olan 9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Ortahisar Nöbetçi Eczaneler başlıklı makalemizde 9 Haziran 2017 Cuma Akçaabat nöbetçi eczane, 9 Haziran 2017 …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Vakfıkebir Nöbetçi Eczaneler | Türkiyenin En …

61 Trabzon Nöbetçi Eczaneler Eczane : Vakfıkebir Merkez Eczanesi Adres : Çarşı Mah. 14 Şubat Kurtuluş Cad. Şadırvan Yanı İl / İlçe : Trabzon / Vakfıkebir Nöbet : 9 Haziran 2017 Cuma 08:00 – 10 Haziran 2017 Cumartesi 08:00 Bir önceki yazımız olan 9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Sürmene Nöbetçi Eczaneler başlıklı makalemizde 9 …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Trabzon / Yomra Nöbetçi Eczaneler | Türkiyenin En Yeni …

61 Trabzon Nöbetçi Eczaneler Eczane : Burcu Eczanesi Adres : Kanuni Eğitim ve Araştırma Hastanesi Yanı İl / İlçe : Trabzon / Yomra Nöbet : 9 Haziran 2017 Cuma 08:00 – 10 Haziran 2017 Cumartesi 08:00 Eczane : Şifa Eczanesi Adres : Trabzon Cad. No: 53 / B İl / İlçe : Trabzon / Yomra Nöbet : 9 Haziran 2017 …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Tunceli Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbet …

62 Tunceli Nöbetçi Eczaneler Eczane : Gündoğan Eczanesi Adres : Moğultay Mah. Hastane Cad.No.14 Merkez İl / İlçe : Tunceli / Merkez Bir önceki yazımız 8 Haziran 2017 Perşembe – 9 Haziran 2017 Cuma Tunceli Nöbetçi Eczaneler başlıklı makalemizde 8 Haziran 2017 Perşembe nöbetçi eczane, 8 Haziran 2017 Perşembe Tunceli nöbetçi eczane ve bugün Tunceli nöbetçi eczaneler hakkında bilgiler verilmektedir. …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Uşak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi …

64 Uşak Nöbetçi Eczaneler Adres : Hakkı Yasğcı Cad. Ziraat Bankası Aralığı İl / İlçe : Uşak / Merkez Adres : İsmet Paşa Cad. Belediye Binası Karşısı İl / İlçe : Uşak / Merkez Bir önceki yazımız 8 Haziran 2017 Perşembe – 9 Haziran 2017 Cuma Uşak Nöbetçi Eczaneler başlıklı makalemizde 8 Haziran 2017 Perşembe nöbetçi eczane, 8 Haziran 2017 …

Devamını Oku »

Dilimleme 1.0 Android Para Hile MOD APK indir

Yazar: Gökhan Öğütcü Kategori: Android Hileli Oyunlar, Android Macera Oyunları 9 Haziran 2017 22 Görüntülenme Dilimleme 1.0 Android Telefon ve Reklamsız Hile MOD APK indir Dilimleme 'Ketchapp' tarafından tasarlanmış bir macera oyunudur. Oyunda kendi seviyede zorlu görevleriniz olacaktır. Siz bu görevleri tamamlayıp seviyelerde ilerlemeye çalışacaksınız. Onun seviyesinde görevleriniz ve karşınıza çıkan engeller daha da zorlaşacaktır. Siz bütün bu zorluklara rağmen …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Van Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetçi E …

65 Van Nöbetçi Eczaneler Eczane : Beşyol Eczanesi Adres : Beşyol Meydanı Valilik Binası Yanı İl / İlçe : Van / Merkez Nöbet : 9 Haziran 2017 Cuma 08:00 – 10 Haziran 2017 Cumartesi 08:00 Adres : Zübeyde Hanım Caddesi Özel Lokman Hekim Hast. Karşısı İl / İlçe : Van / Merkez Nöbet : 9 Haziran 2017 Cuma 08:00 – …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Yalova Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

77 Yalova Nöbetçi Eczaneler Adres : Şehitlik Mah. Fatih Cad.No.13 / A İl / İlçe : Yalova / Altınova Adres : Karşıyaka Mah. Okul Cad.No.4-2 İl / İlçe : Yalova / Armutlu Eczane : Çiftlikköy Eczanesi Adres : Çiftlik Mah. Stadyum Cad.No.31 İl / İlçe : Yalova / Çiftlikköy Eczane : Çınarcık Eczanesi Adres : Harmanlar Mah. Vali Akı Cad.No.3 …

Devamını Oku »

Wİndows 10 için büyük değişim zamanı!

Microsoft windows 10 için büyük değişimeye hazırlanıyor. Microsoft bugün yayınladığı güncelleme ile birlikte, büyük değişiklikler adına ilk adımı attı. Windows 10 için büyük değişim vakti! Microsoft 16215 numaralı Windows 10 ' yeni bir test sürümü piyasaya sürdü. Windows İçeriği Bu makalede güncelleştirmek indirebilir ve tüm yeniliklerden, herkesten önce faydalanabilirsiniz. Yeni güncelleme ile hangi yenilikler kullanıcıları? Hemen açıklayalım! Yeni yayınlanan güncelleme …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Yozgat Nöbetçi Eczaneler | Türkiyenin En Yeni Nöbetç …

66 Yozgat Nöbetçi Eczaneler Adres : İstiklal Cad.No:56 İl / İlçe : Yozgat / Akdağmadeni Eczane : Beştaş Eczanesi Adres : Yeni Mah.Çekerek Cad.No:2 İl / İlçe : Yozgat / Aydıncık Eczane : Sağlık Eczanesi Adres : Bahçeler Mah. Çeşme Sokak No: 30 İl / İlçe : Yozgat / Boğazlıyan Adres : Barbaros Mah. Dr. Mehmet Murat Cad. No: 22 …

Devamını Oku »

9 Haziran 2017 Cuma – 10 Haziran 2017 Cumartesi Zonguldak Nöbetçi Eczaneler | Türkiyenin En Yeni Nöb …

67 Zonguldak Nöbetçi Eczaneler Eczane : Yazıcıoğlu Eczanesi Adres : Merkez Mah.Demırcıler Sok.No:2 İl / İlçe : Zonguldak / Alaplı Adres : Mıllı Egemenlik Cad. No: 4 / A Karapınar İl / İlçe : Zonguldak / Çaycuma Eczane : Saltukova Eczanesi Adres : Kokaksu Mah. Uzunmehmet Cad.No:48/A Saltukova İl / İlçe : Zonguldak / Çaycuma Eczane : Hisarönü Eczanesi Adres …

Devamını Oku »

Samsung Galaxy S6 10 Nisan'da Vodafone'da LetsGoMobile

D abonelerine oğul Teknolojiyi sunmayı ilke edinen Vodafone Tarafından 10 Nisan'da Vodafone COK tr Samsung Galaxy S6 Teknoloji 1 Mart Tarihinde Samsung'un Gerçekleştirdiği “Ambalajsız” etkinliğiyle Lansmanı Yapılan oğul Barselona'da Düzenlenen Dünya Mobil Kongresi Kapsamında Tarafından Unya GSM Birliği (GSMA), Satanlar Masası avantajlarıyla satışa sunulacak. Vodafone Galaxy S6 kampanyası Üstün Donanımı ettik şık tasarımıyla dikkat çeken Samsung Galaxy S6, 23 Mart-10 …

Devamını Oku »

Futuremark PCMark 10 duyuruldu! – ShiftDelete.Net

En iyi sistem benchmark yazılımları denince ilk akla gelen isimlerden birisi tabii ki Futuremark PC Mark . yazılımının 10. sürümüyle karşımızda . Geleceğe dönük olarak, Futuremark PCMark 10 ile daha hızlı ve gelişmiş benchmark pencere 10 için güncellendiğin altı çizilen PCMark 10, çok daha hızlı ve kullanımı kolay olarak tanıtılıyor. Geniş çeşitliliğe rağmen kapsamlı teste sahip olan yazılım hızlı, genişletilmiş …

Devamını Oku »

10 Lob Saç Döküş Fikirleri – Edgy Cuts & Sıcak Yeni Renkler

Stilistler kendi yaratıcı fikirlerini ekledikçe, trendy kesimlerin ne kadar gelişip değiştiğini görmek heyecanlı! Bugünkü saç stüdyosu, uzun bob süper-taze tutan en yeni, en sıcak lob saç kesimi fikirlerine odaklanmaktadır. Tüylü, uzunlamasına ve dalgalı, dokulu ipuçları içeren keskin kesimler çağdaş trendlerin ön planında. Ancak pürüzlü çizgiler bej sarışın ve yumuşak bakır / kırmızı esmer vurgularla sık sık yumuşatılır. Ve günümüzde en …

Devamını Oku »

Üç yeni Windows 10 sürümü geliyor!

Son olarak windows 10 S sürümü sunulan Windows 10 için şu anda 11 farklı sürüm bulunuyor. Bununla birlikte, üç yeni sürüm daha okuceğiz. Twitter kullanıcısı AndItsTito 'nun Windows 10 Yapı 16212 pkeyconfig ' de keşfettiği için işletim sistemi için üç yeni sürüm yolda. Yeni sürümler ne olacak? Windows 10 Pro ve Windows 10 Pro sürümleriyle birlikte bir deularular için Windows …

Devamını Oku »

Uyarıcı ilaçlar beynin dopamin nörotransmisyonunu şiddetlice artırır ve kronik kullanım mezolimbikte nöro-adaptif değişikliklere yol açar. [1945900] Dopamin sistemi ve bazal ganglia yapılarındaki morfolojik değişiklikler. Bu değişikliklerin altında yatan mekanizmalar hakkında çok az şey biliniyor, ancak klinik öncesi kanıtlar, dopamin sentezi ve depolamasında koenzim olan demirin aday arabulucu olabileceğini gösteriyor. Demir bazal gangliyonlarda yüksek konsantrasyonlarda bulunur ve uyarıcı ilaçlar demir homeostazını etkileyebilir. Kokain bağımlılığında görülen morfolojik beyin değişikliklerinin beyindeki ve çevredeki anormal demir düzenlenişiyle ilişkili olduğunu varsaydık. Kemik bağımlılığı olan 44 hasta ve 44 sağlıklı kontrolte kantitatif duyarlılık haritalaması ve çevredeki kan dolaşımındaki demir markörleri kullanılarak beyinde demir konsantrasyonu tespit edildi. Kokain bağımlısı bireyler, globus pallidus'unda, kokain kullanım süresi ile güçlü korelasyon gösteren aşırı demir birikimi ve kırmızı çekirdekte düşük demir seviyeleri ile ilişkili olan periferik hafif demir eksikliği gösterdi. Bulgularımız, kokain bağımlılığında demir bozukluğunun oluştuğunu ve bunun kronik kokain kullanımından kaynaklandığını ortaya koymaktadır. Bu bireylerde Putamen'in genişlemesi demir konsantrasyonlarıyla ilgisizdir ve bu durumun, sırasıyla kokain bağımlılığının yatkınlığını ve sonuçlarını yansıtan eş zamanlı ortaya çıkan morfolojik değişiklikler olduğunu ileri sürmektedir. Kokainin demir metabolizmasını etkilediği mekanizmaları anlamak, yeni terapötik hedefleri ortaya çıkarabilir ve kokain bağımlılığının progresyonuna ve tepkisine ek olarak, zayıflıkların biyolojik belirteçleri olarak beyindeki ve çevresindeki demir seviyelerinin değerini belirleyebilir. Giriş Uyarıcı uyuşturucu bağımlılığında yapılan nörobilimsel araştırmalar, bağımlılığın nörobiyolojisi konusundaki anlayışımızı geliştirmiştir. Bu gelişmeler henüz daha etkili tedavilere veya önleme stratejilerine dönüşmese de, bağımlılığın bir beyin bozukluğu olduğuna açıkça gösterdiler. 1 Bunun için kritik olan, morfolojik beyin değişikliklerinin uyarıcı ilaçlarla ilişkili olduğunun kanıtı olmuştur 2, 3, 4, 5, 6, 7, 8 Klinik öncesi hayvan modelleri, bu bağımlılığın, en sıklıkla uyarıcı madde bağımlısı bireylerde görülen putamenin genişlemesidir. Ventral striatumdaki dopamin D2 reseptöründeki uyarıcı maddeden kaynaklanan düşüşün direkt olarak dorsal striatumdaki (putamen) hacim artışı ile bağlantılı olduğu anormallik, ilaç etkilerinden kaynaklanmaktadır. 9 Bu, hipotezi Gönüllü uyuşturucu kullanımından zorlayıcı ilaç alımına davranışsal değişimdeki ventral-dorsal ilerleme 10 ve putamen hacminin artması transitin sinirsel bir alt tabakasını yansıtabilir Bağımlılık üzerine. Bununla birlikte, uyarıcı madde bağımlısı bireylerden etkilenmeyen birinci derece akrabalarında 5 ve obsesif kompulsif bozukluk (OKB) olan hastalarda 11 putamen genişlemesinin kısmen temsil edilebileceği düşünüldüğünden Zorlayıcı davranışlar için predispozan bir faktör. Bağımlılıktaki bu morfolojik beyin değişimleri iyi karakterize edilmiş olsa da, primer farmakolojik etkisi dopamin iletimini arttırmak olan uyarıcı ilaçların bu değişikliklere neden olduğu mekanizmaları bilinmemektedir. Potansiyel bir aday arabulucu, dopamin metabolizması ve depolanması için enerji sağlayarak dopamin sentezi de dahil olmak üzere birçok fizyolojik süreçte yaşamsal bir role sahip olan demir olabilir. 12 Demirin her ikisinde de oynadığı önemli rol göz önüne alındığında Sağlık ve hastalık, metabolizması çok sıkı düzenlenir. Temel bir mikro besin maddesi olan demir diyetten alınmalıdır ve atılabilir (kan kaybı hariç). Aşırı demir, reaktif oksijen türleri 13 üretimiyle nöronal ölümle sonuçlanabileceğinden ve demir eksikliği dopamin sentezini ve monoamin metabolizmasını etkiler. 14 Homeostaz Bu nedenle, çeşitli, oldukça karmaşık ulaşım sistemleri ve geribildirim döngüleri aracılığıyla dikkatlice kontrol edilir. 15, 16 Demiri düzenlemedeki bozulmalar bu nedenle çeşitli seviyelerde ortaya çıkabilir ve bunların arasında nörodejeneratif olan belirgin çeşitli patolojiler ortaya çıkabilir 17, 18 Demirin düzenlenmesinde kritik olan, kan-beyin bariyeri olup, çevresel demir düzeylerini beyinden ayırmaktadır. Demir, transferrin reseptörleri (TfR1) ve çift değerli metal taşıyıcı 1 (DMT1) yoluyla diferansiyel transferrin (Tf) olarak beyine girer. Transmbran proteini ferroportin 1, demiri luminalden abluminal yönde bir demir atomuna nakleder. 16, 20 burada ferritin olarak, esas olarak oligodendrositlerde, fakat aynı zamanda mikroglia ve astrositlerde depolanmaktadır. 21 Beyin, en çok metabolik açıdan aktif organlardan biri olduğu için Vücuda demir talebi genellikle transferrin alım oranını aşar, bu da stokların iç depolamadan düşürülmesi anlamına gelir. 22 Dahili deponun talebi karşılayabilmesini sağlamak için, İnflamasyon veya hipoksi olayı, beyin parankimindeki demir taşınımı, peptid hepcidin tarafından düzenlenir. 20, 23 Ancak demirin beyindeki bölgesel dağılımı eşit değildir. Bazal gangliyonlar gibi dopaminle zengin beyin bölgeleri özellikle demir birikimine açıktır, ancak demirin bölgesel dağılımını belirleyen faktörler halen kaçınılmazdır. 12 Çeşitli kanıtlar, demirin düzensizliğini Uyarıcı madde bağımlılığında homeostaz. İlk olarak uyarıcı ilaçların düzenli kullanılması kan-beyin bariyerinin geçirgenliğini arttırarak daha fazla demirin beyin parankimine girmesini sağlar. 13, 24 İkincisi, hayvan modellerinde uyarıcı maruziyetin demir ile ilişkili olduğu gösterilmiştir Esas olarak oligodendrositlerde bazal gangliyonlarda birikim. 25 Üçüncü olarak uyarıcı ilaçlar doğuştan gelen bağışıklığı bozuyor 26 kronik uyarıcı kullanıcıları enfeksiyona ve kronik enflamasyona karşı savunmasız hale getiriyor 27 rahatsız edici Demir emilimini veya heam sentezini azaltarak periferik demir homeostazını azaltır ve bu azalmış serum demir ve transferrin doygunluğuyla yansıtılır. 28 Son olarak, kronik uyarıcı ilaç kullanımı diyet tercihlerini özellikle yağlı gıdalara değiştirebilir 29 , 30, 31 demir taşıyıcı ve biyoyararlanım eksikliği nedeniyle demir absorpsiyonunu etkiliyor. Kokain bağımlılığının bozulma ile bağlantılı olduğunu varsaydık Bu, beyindeki demir konsantrasyonunun artması ve kandaki demir seviyesinin azalması ile yansıtılır. Bu nedenle, kantoksik bağımlılığı olan yaş ve sağlıklı kontrol gönüllüleri bulunan hastalarda, kantitatif duyarlılık haritalaması 32 ve çevresel olarak kan dolaşımındaki işaretleyicileri kullanarak beyindeki demir konsantrasyonunu belirlemeye çalıştık. Kokain bağımlısı hastalarda beyin demir seviyesinin artmasının kokain kullanım süresiyle ve bazal gangliyon hacmiyle ilişkili olacağını öngördük. Malzemeler ve yöntemler Kokain bağımlılığı için DSM-IV-TR ölçütlerini karşılayan, kronik bir kokain öyküsü olan 44 bireyi (% 95 erkek) ve 44 eşleştirilmiş sağlıklı kontrol gönüllüsünü (% 93'ü eşleştirilmiş) araştırdık Çalışma örneği ve prosedürleri Erkek) ilaç ya da alkol bağımlılığı öyküsü olmayan bir gruptur. Kokain bağımlılığı tanısı, DSM-IV için Yapısal Klinik Görüşme kullanılarak belirlendi ve bu kişilere daha sonra kokain kullanım bozukluğu (CUD) adı verildi. Kontrol katılımcılarından hiçbiri madde bağımlılığı için DSM-IV-TR kriterlerine hiç uymadı; Ayrıntılı bilgi için Ek Malzeme sayfasına bakınız. Bütün katılımcılar tıbbi bir gözden geçirme ve psikiyatrik taramadan önce yazılı bilgilendirilmiş onam vermiştir. Dışlama kriterleri, başlıca medikal veya nörolojik hastalık, psikotik bozukluğun ömür boyu öyküsü, travmatik bir kafa travması öyküsü ya da MR taramaya yönelik herhangi bir kontrendikasyon içermektedir. Diyetle alınan demir miktarı, Gıda Frekansı Anketi'nden (http://www.srl.cam.ac.uk/epic/nutmethod/FFQ.shtml) hesaplanmıştır. Demir absorpsiyonundaki diyetle ilgili varyasyonlar, Hallberg ve Hulthen tarafından geliştirilen algoritmalar kullanılarak tahmin edildi. 33 Tüm katılımcılar, serumdaki demir proteinlerinin (yani, ferritin, demir, transferrin), hepcidin'in -25, akut enflamasyon (yani C-reaktif protein (CRP)) ve hematolojik durum. Nörogörüntüleme veri toplama Tüm katılımcılar, manyetik rezonans beyin taramalarına tabi tutuldu (12 / EE / 0519, PI: KDE) 3T Siemens Magnetom Tim-Trio tarayıcısı kullanarak Cambridge Üniversitesi (İngiltere) Wolfson Beyin Görüntüleme Merkezi'nde. Tüm katılımcılar için T1 ağırlıklı görüntüler (MPRAGE) ve duyarlılık ağırlıklı görüntüler (SWI) elde edildi. Beyin taramaları nöroradyologlar tarafından normal radyolojik görünüm için tarandı. Bir kontrol katılımcısından ve üç CUD hastasından alınan veriler, kalitesizlik nedeniyle kaldırıldı ve toplam 84 katılımcı bırakıldı (43 kontrol, 41 CUD). Ayrıntılı beyin görüntüleme yöntemleri Ek Malzemede verilmektedir. İstatistiksel analiz Veriler aşağıda özetlenen beş adımlı bir strateji kullanılarak analiz edildi ve tam olarak açıklandı Ek Malzemede. Tüm istatistiki testler iki taraflıydı. Birden fazla istatistiksel testin ışığında ilk P eşik değerini (0.05) 10 olarak bölerek P değerini uyguladık ve sonuçta eşiğin P <0.005. Bununla birlikte, bu bir keşif analizi olduğu için, tartışmada önemli olarak değinilmemesine rağmen P <0.05 eşiğine ulaşan sonuçlar da bildirilmiştir. Demografik özellikler, klinik veriler ve periferik demir işaretleyicileri bağımsız örnek t testleri veya Mann-Whitney kullanılarak SPSS (v21) U -test. Kategorik veriler için ki-kare veya Fisher kesin testleri kullanıldı. Bütün beyin seviyesinde, gri madde hacmi karşılaştırmaları, permütasyon testi için FSL-VBM ve CamBA kullanılarak MPRAGE görüntülerinde yapıldı. Kantitatif duyarlılık haritaları (QSM), beyin demir konsantrasyonunun onaylanmış bir ölçüsüdür, 32 SWI verilerinden yeniden oluşturuldu. 34 Kısaca, çok kanallı karmaşık veriler değiştirilmiş uyarlamalı bir algoritma kullanılarak birleştirildi. [35] Birleştirilen faz görüntüleri sürekli bir Laplace yaklaşımıyla, 36 ve yerel alan küresel ortalama değer filtreleme ile arka plan alanının küresel ekstraksiyonu ile ortaya çıkmıştır. 37 QSM, morfolojik olarak etkin, doğrusal olmayan dipol inversiyon yöntemi, ile tahmin edilmiştir 38 ve haritalar daha önce tarif edilen bir işleme akışı ile çalışma açısından bir alana çarpıldı 34 ANT kullanan (v2.1). Son olarak, QSM istatistiksel analizi için FSL Randomize (v2.9) kullanılmıştır. Büyük grup farklılıklarının tüm beyin haritaları. ( a ) Tüm beyin seviyesinde modüle edilmiş gri cevher hacminin grup karşılaştırması. Mavi renkte olan vokseller, kokain kullanım bozukluğu (CUD) olan hastaların gri cevher hacmini azalttığı beyin bölgelerini gösterir QSM grubu şablonu üzerinde manuel olarak izlenen dokuz demir açısından zengin yapılar için ilgi bölgeleri (ROI'lar) tanımlandı. Buna ek olarak, putamen ve globus pallidus (GP) 'deki gri cevher olasılıklarına karşı QSM'yi doğrudan doğruya karşılaştırmak için, FSL-FIRST (ve)' yi kullanarak MPRAGE şablonuna subkortikal segmentasyon için otomatik ve tekrarlanabilir bir algoritma uyguladık. Her ROI için ortalama ve medyan değerler, grup karşılaştırması ve korelasyon analizi için SPSS'ye aktarıldı. Demir konsantrasyonundaki bölgesel grup farklılıkları. ( a ) Demir açısından zengin beyin bölgelerinin ilgi alanındaki (ROI) tabanlı bir yaklaşımdaki demir konsantrasyonunun grup karşılaştırması. CUD hastaları globus pallidusunda% 14'lük QSM'de anlamlı bir artış gösterdi ] Kokainle ilgili anormallikler. ( a ) İlgi alanımız olan globus pallidus'un (GP) illüstrasyonu. ( b ) GPe'deki demir konsantrasyonunun post-hoc karşılaştırması, CUD hastalarında QSM düzeyleri … Olası önceden var olan anormallikler. ( a ) İlgilendiğimiz bölgemiz olan putaemin illüstrasyonu. ( b ) Gri cevher hacminin grup karşılaştırmaları, CUD hastalarında kontrollerle karşılaştırıldığında belirgin bir artış gösterdi. [ c ) KSÇ Seviyeleri Ölçülebilir Değil … Korelasyon analizi ayrı olarak gerçekleştirildi Beyin yapısı, yaşı ve kokain kullanım süresi ile beyin ve çevresindeki demir konsantrasyonu arasındaki ilişkileri incelemek için her bir grupta değerlendirildi. GP'de demir konsantrasyonunun öngörücüleri, DSM-IV uyuşturucu bağımlılığı durumuna, sigara içme durumuna, serum ferritin ve transferrin saturasyonuna sahip SPSS'deki çoklu regresyon modeli, prediktör değişkenleri olarak dahil edilmiştir.

Sonuçlar Demografik veriler ve periferik demir işaretleyicileri İki grup yaş, cinsiyet, el koyma, vücut kütlesi ve alkol tüketimi açısından eşleştirildi (). Gruplar yaşamsal bulgular bakımından farklı değildi, bu da CUD hastalarının şiddetli sarhoş olmadığını gösterdi.

Devamını Oku »

Microsoft güncellemesi Windows 10 çökertiyor

Windows Windows XP 'den after gelmiş geçmiş en popüler işletim sistemlerinden birisi olmak yolunda emin adımlarla ilerlerken kullanıcılara ara sıra bazı terslikler yaşatabiliyor . Bunun en yeni örneği canınızı biraz sıkabilir. Microsoft'un 'un yanlışlıkla belirttiği bir güncelleme Windows 10 ' u çökertebilir. Microsoft çalışanlarından da sosyal medya kullanıcılarının uyarmasına yol açan güncelleştirme özellikle 32-bit Windows 10 'ları etkiliyor. #WindowsInsiders: Pls, …

Devamını Oku »

10 Katmanlı Bob Saç Stilleri – Yeni Blonde Tonlarda Fab'e Bakın!

Katmanlı bob saç modelleri her şeyden önce bakımlı, şık, modern ve şık görünüme sahipler. Bu sezon yeni bej sarışınları ve çift / üçlü balayage ve ombré renk tasarımlarında bobin kesme saçları her zamankinden daha iyi görünüyor. İşte en son, katmanlı bob saç modellerinin muhteşem vitrini, bakımlı kadınların sevdiği kolay tarzda görünüyor! Uzun saçlar özel günlerde iyi görünebilir, ancak kaç tane …

Devamını Oku »

ARM tabanlı Windows 10 PC üreticileri belli oldu!

Microsoft Computex 2017 etkinliğinde ARM tabanlı windows 10 PC iş dünyası ortaklığı resmi olarak açıklandı . İşte, gücünü Qualcomm Snapdragon 835 platformundan alacak Windows 10 mobil PC'lerin üreticileri. ASUS, HP ve Lenovo ARM tabanlı Windows 10 PC üretecek Microsoft, geçtiğimiz yıl Windows masaüstü uygulamalarını mobil ARM işlemcilere getirmek konusundaki planlarından bahsetmişti. ARM destekleyen Windows 10 sürümü yıl pazara gelecek cihazların …

Devamını Oku »

Aynı sınıfta 10 TEOG birincisi!

                     2017-05-31 20:20:00                                                                      Batman Milli Eğitim Müdürü Mahmut Kurtaran, Batman genelinde 60 öğrencinin TEOG sınavında 120 sorunun tamamını doğru yaptığını, bunlardan 16'sının İMKB Belde Ortaokulu'nda eğitim gördüğünü, okuldaki bir sınıftanın da 10 birinci çıktığını söyledi. Mahmut Kurtaran'ın verdiği bilgiye göre İMKB Belde Ortaokulu 8'inci Sınıf öğrencileri, TEOG-2'de büyük başarıya imza attı. 10'u Okulun 8 / C …

Devamını Oku »

Kadınlar İçin Kısa Kısa 10 Saç Kesimi – Shocking Yeni Bir Kesim ve Renk Deneyin!

Günümüzün kısa, keskin saç kesimlerinin galerisi son ​​kesim teknikleriyle bazı çok cesur renkleri sergilemek için seçildi! Bu heyecan verici yeni görünüm, pembe ve kırmızı çizgili ve parlak sarı çığlık atarak, göz kamaştıran kırmızı renkli serin serin sarışın serinletici bir "yakalama" imkanı sunuyor! Dolayısıyla, modayı seviyorsanız ve en son trendleri tanıtan sevgiyi seçerseniz, bu şok edici yeni kesme ve renk fikirlerinden …

Devamını Oku »

10 Şirin, Soğuk, Pis ve Zarif Saç Modelleri, Mezuniyet Balolarına Bakarsınız Seveceksiniz!

mükemmel balo saç stiliniz son eğilimleri sıradan zarafet ile birleştirmeliyse, bu muhteşem "stand-out" stillerine bir göz atın! Doğru izlenimi yaratmak, sarışınlar için modaya uygun bir kül toneri veya esmerler için zengin, mor renk yıkaması ile görünümünüzü jazz-up yapmak anlamına gelebilir. Tabii ki, kraliçe tarzı veya koyu kılı üzerinde beyaz yüzlü, beyaz bir örgü ile 'ölüleri' vurmayı tercih edebilirsiniz. Sadece serin, …

Devamını Oku »

Samsung DeX platformuna Lumia 950 takılarak Windows 10 Mobil Continuum çalıştırıldı!

Bilindiği üzere Samsung, yeni amiral gemisi Galaxy S8 Laptop Akıllı Telefon Bir masaüstü bilgisayar gibi kullanmamıza imkan tanıyan, devrim niteliğindeki DeX Platformunu da tanıtmıştı. YouTuber tarafından DeX Platformu aracılığıyla, windows 10 Mobile Continuum işletim sistemi çalıştırıldı. DeX platformunda Windows 10 çalıştırıldı! UDU platformu aracılığıyla 'un ' un Lumia 950 Cihazın kullanılması, DeX platformu aracılığıyla Windows 10 Mobile Continuum işletim sistemi …

Devamını Oku »

HTC Desire 10 Lifestyle Özellikleri

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/05/htc-desire-10-lifestyle-ozellikleri.orgtr/ajax/specs/showcomments', { PostBody: 'spec_id = 4179', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev expand_comment (id) { Var disp = $ ('comment_content _' + id) .style.display; If (disp == 'none') { $ ( 'COMMENT_CONTENT _' + id) .style.display = "http://turkcebilgisi.com/wp-content/uploads/2017/05/htc-desire-10-lifestyle-ozellikleri.org"; $ ( 'C_e_i _' + id) .src = comment_close.src; $ ( 'C_h …

Devamını Oku »

HTC Desire 10 Pro Özellikleri

'; Yeni Ajax ('http://turkcebilgisi.com/wp-content/uploads/2017/05/htc-desire-10-pro-ozellikleri.orgtr/ajax/specs/showcomments', { PostBody: 'spec_id = 4180', OnComplete: işlev (yanıt) { $ ('Comments_container'). InnerHTML = yanıt; } }).istek(); } Işlev expand_comment (id) { Var disp = $ ('comment_content _' + id) .style.display; If (disp == 'none') { $ ( 'COMMENT_CONTENT _' + id) .style.display = "http://turkcebilgisi.com/wp-content/uploads/2017/05/htc-desire-10-pro-ozellikleri.org"; $ ( 'C_e_i _' + id) .src = comment_close.src; $ ( 'C_h …

Devamını Oku »