24 Haziran 2017,Cumartesi
Anasayfa » Bilgiler

Bilgiler

Bilgiler

CD2'nin herpesvirüs ortologları …

J Gen Virol. 2016 Ocak; 97 (Pt 1): 179-184. Sir William Dunn Patoloji Okulu, Oxford Üniversitesi, Oxford, Birleşik Krallık İlgili yazar † Şu adresi: Oxford Biomedica, Oxford Science Park, Oxfordshire OX4 4GA, Birleşik Krallık. ‡ Şu adres: NIH / NIAID, 12441 Parklawn Drive, Twinbrook 2 Building Room 213, Rockville, MD 20852, ABD § Sunum adresi: Radcliffe Tıp Fakültesi Oxford Üniversitesi, …

Devamını Oku »

Uganda'da herhangi bir staj yaşandı …

Fertil Res Pract. 2015; 1: 14 1 tablo .111194.3c0000000406200548 Nüfus Araştırmaları Bölümü, İstatistik Okulu ve Planlama, İşletme Fakültesi ve Yönetim Bilimleri, Makerere Üniversitesi, PO Box 7062, Kampala, Uganda 2 grid.11194.3c0000000406200548 Nüfus ve Uygulamalı İstatistik için Merkezi, İşletme ve Yönetim Bilimleri Fakültesi, Makale Üniversitesi, P.O. Kutusu 7062, Kampala, Kampala Uganda 3 ızgara5335.00000000121885934Comment of Coğrafya, Cambridge Üniversitesi, Downing Place, Cambridge, CB2 3EN …

Devamını Oku »

Zekice robotlar uzay araştırması için 'hayati' … •

                                  NASA bilim insanlarına göre, özerk uzay robotları yeni keşifler yapmak ve Güneş Sistemimizin ve ötesinin en uzak noktalarını keşfetmek için anahtar olacak.                  NASA Jet Propulsion Laboratuarında çalışan AI araştırmacıları Steve Chien ve Kiri Wagstaff, "Kendi keşif kararlarını vererek, robotik uzay araçları geleneksel bilim araştırmalarını daha etkin bir şekilde gerçekleştirebilir ve hatta imkansız gözlemlere ulaşabilir", Science Robotics'e yazdı. …

Devamını Oku »

XRCC1 Mutasyonu ilişkilendirildi …

Doğu Hint kökenli ve akraba olmayan ebeveynlerden kırk yedi yaşında bir kadın, kırk bir yaşında serebellar atrofi, yürüyüş ve ekstremite ataksisi, oküler Motor apraksi ve periferal nöropati (). Doğum öncesi ve erken gelişimsel geçmişim tamamen normaldi, denge ve yürüme ile ilgili zorluklar ilk kez yirmi sekiz yılda fark edildi, ancak bu, kırk yaşına kadar tam olarak araştırılmadı. Manyetik rezonans görüntüleme …

Devamını Oku »

Patojenik mikobakteriler başarıya ulaşıyor …

Özet Geçmişi. Tüberküloz önemli bir küresel sağlık kaygısı olmaya devam etmektedir. Fagosome-lizozom füzyonunu önleme yeteneği, hücre içi mikobakterilerin aşağıdakileri içeren kilit bir mekanizmasıdır: Mycobacterium tuberculosis konukçu hücrelerde uzun süreli kalıcılık sağlamaktadır. Bu önemli intraselüler sağkalım öncesi stratejiyi destekleyen mekanizmalar tam olarak anlaşılamamıştır. Kalıcı mikobakterilerle enfekte konakçı makrofajlar, niemann Pick Disease Type C (NPC) hastalarından alınmış hücrelerle fenotipik benzerlikler gösterirler. Endositer …

Devamını Oku »

52 Genetik Lokum Benim Etkilemi …

a a Groningen Üniversitesi Tıp Fakültesi Kardiyoloji Bölümü, Groningen, Groningen, Hollanda B Groningen Üniversitesi Tıp Fakültesi, Genetik Bölümü, Groningen, Groningen, Hollanda Tıp Merkezi Groningen, Hollanda c Durrer Kalp ve Damar Araştırmaları Merkezi, Hollanda Kalp Enstitüsü, Utrecht, Hollanda d Üniversite Tıp Merkezi Utrecht, Utrecht, Hollanda e Üniversite Tıp Merkezi Kardiyoloji Bölümü Kalp ve Akciğerler Bölümü Utrecht, Utrecht, Hollanda f Sanford Burnham …

Devamını Oku »

PLATO yabancı yaşamı bulmak için görev misyonuna verildi …

                                  Avrupa Uzay Ajansı'nın PLATO misyonu, yaşanabilir dış gezegenler için avlanmak için, plandan taslağa geçiş için yeşil ışık yaktı.                  Daha önce 2014'te ESA'nın Kozmik Vizyon Programının bir parçası olarak seçildi, ancak başlatma tarihi 2024'ten 2026'ya iki yıl itti.                  Hedef, yaşanabilir bölgede yıldızlar çevresinde yörüngede dönen Dünya boyutunda gezegenleri veya süper-Toprakları tespit etmektir – bu bölge, sıvı su …

Devamını Oku »

LonDownS yetişkin bilişsel a …

Giriş: Zihinsel engelliliğin en yaygın genetik nedeni Down sendromu (DS), Alzheimer hastalığının gelişimi için son derece yüksek bir risk. Bununla birlikte, klinik demansın başlangıcında ve başlangıçtaki bilişsel yeteneklerin, özellikle hafıza, yönetici işlevsellik ve motor koordinasyonda azalmadan önce bireysel değişkenlik vardır. LonDownS Konsorsiyumu, bunamanın gelişimi için risk faktörlerini ve koruyucu faktörleri ve DS'li kişilerin bilişsel yetenekleri ile ilgili faktörleri belirlemeyi amaçlamaktadır. …

Devamını Oku »

Karanlık, Kuzey Amerika üzerinden toplamda düşüyor …

                                  Amerika, 99 yıl içinde ilk kez, 21 Ağustos'ta kıyı şeridinde uzanan toplam güneş tutulmasını tanık olacak.                  Güneş, Ay ve Dünya mükemmel bir şekilde oturacak. Ay güneşi bloke edecek, güneş korona, sıcak plazma taçını görünür hale getirecek. 70 kilometre uzunluğundaki (112 kilometrelik) bir alanda karanlık bir gölge yeryüzüne dökülür.                  Ondört eyalet – Oregon, Idaho, Wyoming, Montana, Nebraska, …

Devamını Oku »

Andrewes'in yılbaşı perisi …

1 1 American Philosophical Society, Philadelphia, PA (bugüne kadar APS), Peyton Rous kağıtları, Andrewes, Christopher H., klasör 1, 1929 -35, Rous'a Mektup, 6 Aralık 1935. Sözü edilen ders daha sonra P. Rous, 'Virüs tümörleri ve tümör sorunu' Harvey Lect olarak yayınlandı. 74-115 (1935/36). 2 2 APS, Andrewes, Rous'a Mektup, 6 Aralık 1935. Referans Richard Edwin Shope'a ( 1901-66), domuz kolera …

Devamını Oku »

Beklenmedik merkezi rol …

Önem Myelin, elektrik sinyallerinin hızlı bir biçimde iletilmesini sağlar ve aksonların metabolik desteği sağlar. Menteşe omurgalı omurgalılarda evrimi nispeten geç göründü ve birlikte androjen reseptörünün (AR) ortaya çıkmasıyla birlikte miyelinasyonda androjenler için belirli bir role ima etti. Burada, merkezi sinir sisteminin (CNS) demiyelinizasyonundan sonra, erkek gonad, testosteron ve AR, oligodendrositler tarafından astrosit alımını ve miyelin rejenerasyonunu desteklediğini göstermektedir. Yokluğunda astrositler …

Devamını Oku »

H200C H değişkeninin Enzim Yüzey Kompleksi

Mössbauer Araştırmaları ve Spin Hamilton Analizi sıfır alanda 4.2 K'de kaydedilen dinlenme H200C'nin Mössbauer spektrumunu gösterir ( B = 0). Spektrum, yüksek spinli Fe (19459009) Q = 3.28 (2) mm / s ve δ = 1.22 (1) mm / s olan bir dörtlü kutup çiftini görüntüler ] II ve WT HPCD ve H200N ve Y257F türevlerinin dinlenme halleri için bildirilen …

Devamını Oku »

Giriş …

Giriş Çocuklarda yıllık yeni HIV enfeksiyonu sayısı, 2000 yılında 520.000 iken 2014 yılında 220.000'e düştüğü için, % 58'lik bir düşüşü temsil etmektedir [1]. Bu önemli ilerleme, anneden çocuğa bulaşmayı önleme ve HIV pozitif erişkinlerin tedavisini öngören antiretroviral tedavi (ART) programlarının kapsamı ve kalitesindeki iyileşmelerle uyumludur Anne / babadan Çocuğunuz gebelik, doğum ve emzirme döneminde ortaya çıkabilir [4]. Anne sütü ile …

Devamını Oku »

Melbourne Uni küçük teleskobu kaldırmak istiyor …

                                  İlk düşünülenden birkaç yıl sonra Melbourne Üniversitesi liderliğindeki SkyHopper adlı kızılötesi astronomi küp önerisi ivme kazanıyor.                  Akbabe Güney, projenin kurucularından olan astrofizikçi Dr Katie Mack'e bir kübet ile ne gibi faydalı astronomi elde edebileceğinizi basit bir soru ile ilgisini çekti:                  Sonuçta, ünlü uzay teleskoplarıyla (Kepler, Hubble, Chandra X-Ray vb.) Kıyasla – 12U'luk kübaşım küçücük                  Doğru …

Devamını Oku »

Hayır, gerçekten. Sürükleyiciler kullanarak duvarları görebilirsiniz …

                                  Video Drones, ilk defa gösterilen bir araştırmacı ekibi olan Wi-Fi'yi kullanarak duvarlarla nesnelerin üç boyutlu görüntülemesini gerçekleştirebilir.                  Doktora öğrencisi olan Chitra Karanam ve California, Santa Barbara'daki elektrik ve bilgisayar mühendisliği bölümünde profesör olan Yasamin Mostofi, sonuçlarını [PDF] Computing Machinery / Institute of Electrical and Elektronik Mühendisleri Uluslararası Sensör Ağlarındaki Bilgi İşleme Konferansı.                  "Önerilen yaklaşımımız insansız hava …

Devamını Oku »

Körleştirilmiş randomize plasebo-k …

Bu, morfin sülfatın uygulanıp kullanılıp atılmadığının belirlenmesi için kör, plasebo kontrollü, paralel grup randomize, faz II, bir klinik araştırmanın protokolüdür Oral yoldan prematüre retinopatisi (ROP) taraması ve topuklanma öyküsünden önce etkin analjezi sağlar. 34 ve 42 haftalık düzeltilmiş gebelik haftaları arasında klinik topuk mızrağı ve aynı test vesilesiyle ROP taraması gerektiren toplam 156 yenidoğan denemeye alınacak. Bebekler, tek doz morfin …

Devamını Oku »

Nicelik ve determinant …

Eğri altındaki alanın hesaplanması Her bir bölüm için, eğri altındaki alanın hesaplanması, farklı log viral yoğunluklarının bir zaman konsantrasyon eğrisinin Bölüm dökülme süresi ( ). Örnekleme aralıklarından kaynaklanan belirsizliği hesaba katarak, hesaplamaların aşağıda tanımlandığı minimum, orta ve maksimum AUC'yi tahmin eden üç senaryo araştırıldı; . Her senaryo için iki örnek açıklanmıştır: Birincisi bir pozitif gözlem ile ikincisi üç pozitif gözlem …

Devamını Oku »

ER-Golg'da protein sıralama …

ER ihracatında kargo reseptörleri ER'yi çözünür proteinler olarak dolaşan kargo proteinleri arasında büyük çeşitlilik vardır ve muhtemelen kargoya dayanır Reseptörleri COPII katıyla () etkileşime girer. Bilinen ER ihraç reseptörlerinin yakın tarihli kapsamlı incelemeleri, bu önemli kaçakçılık faktörlerinin çeşitliliğini tanımlamaktadır (Dancourt ve Barlowe, 2010; Geva ve Schuldiner, 2014; Barlowe ve Helenius, 2016). Reseptör aracılı ER ihracatının bir özelliği, veziküller içine seçici …

Devamını Oku »

Traneksamik asitin etkileri …

Özet Arka Plan . Postpartum kanama (PPH) maternal ölümün önde gelen nedenidir. Traneksamik asit (TXA) kanamayı azaltma potansiyeline sahiptir ve PPH'li kadınlarda etkisinin büyük randomize, plasebo kontrollu denenmesi sürmektedir (The WOMAN trial). TXA pıhtılaşma faktörlerini ve trombositleri de etkileyebilir. Amacı . PPH'li kadınlarda TXA'nın trombin üretimi, trombosit fonksiyonu, fibrinojen, D-dimer ve koagülasyon faktörleri üzerine etkisini araştırmak. Yöntem . WOMAN davasında …

Devamını Oku »

Medicxi 300 milyon dolarlık Avrupa geç evre ömrü başlattı …

                                  Girişim sermayesi grubu Medicxi, Google'ın holding şirketi Alphabet'ın sağlık bölümü olan Avrupa Yatırım Fonu (EIF) ve Verily Life Sciences'ın desteklediği 300 milyon dolarlık geç dönem hayat bilimleri fonu duyurdu.                  Medicxi Büyüme 1 (MG1) fonu, "heyecan verici fırsatları daha olgun şirketlere yaymak" için deneysel ilaç denemeleri yapmak isteyen Avrupa biyoteknoloji gruplarına yatırım yapacak. Medicxi, Avrupalı ​​yaşam bilimi girişimcilerinin …

Devamını Oku »

Bağımsız, simgesel bir alan …

"Yön duygusu", kafa yönü (HD) hücreleri 1 tarafından hesaplanır ve hayvan belirli bir yönde . Baş yön sinyali, öğrenilmiş çevresel işaretlerden (19459003) [2] türetilir, ancak beynin onları yönsel belirteçler olarak kullanmadan önce mekansal olarak stabil olduğunu bilmeleri gerekiyor 3 . Dolayısıyla, bu dairesel problem, mevcut yönsel gösterim ile yeni karşılaşılan yer işaretleri arasında bir etkileşim gerektirir. Simülasyon istikrarını işleyen bir …

Devamını Oku »

NASA'nın Kepler uzay teleskobu orijinini bitirdi …

                                  NASA'nın Kepler uzay teleskopu, olası gezegenleri Kuğu takımyıldızı istikametinde kataloglamayı bitirdi.                  NASA astrobuffs, bugün bir basın toplantısında, teleskopun 219 yeni gezegen adayı belirlediğini açıkladı. Ten, Dünya'nın büyüklüğündedir ve "Goldilocks bölgesi" ndedir – güneşten gelen sihirli mesafededir, böylece sıvı su teorik olarak var olurdu (ve belki gerçekten de çok şanslıysak hayat ).                  Hızlı bir tarih dersi: Kepler, …

Devamını Oku »

Cdc14 fosfataz yüze yönlendirir …

Özet Arka plan : Oyastalar, mayooz adı verilen ve yarısı azaltılan özel bir hücre bölünmesi yoluyla üretilir, çünkü iki ardışık kromozom ayrımı, mayozlaşma I ve mayozlaşma II, müdahale eden DNA replikasyonu olmadan gerçekleşir. Bu, DNA replikasyonu ve kromozom ayrışmasının aynı ploidi korumak için dönüşümlü olduğu mitotik hücre döngüsüyle ters düşer. Mitozun sonunda, siklin bağımlı kinazlar (CDK'lar) etkisiz hale getirilir. Geç …

Devamını Oku »

Dağılımını eşlemek Bir …

Özet Geçmişi. Sıtma, Benin'de önemli bir halk sağlığı sorunu olmayı sürdürüyor; Anopheles gambiae s.l. ve Anopheles funestus s.s baskın vektörlerdir. Bu çalışma, An. Funestus dağılım, moleküler türleşme, Plasmodium Benin çapında enfeksiyon oranı ve böcek öldürücü duyarlılık durumu. yöntemler. Sınaî örnekler Aralık 2014'ten Ocak 2016'ya kadar Benin'teki 46 yerleşimde toplandı. Bu örnekler haritalandırıldı ve An. Funestus toplandı moleküler seviyeye özgüdür. Plasmodium …

Devamını Oku »

Araştırmanız ısınmış mı, değil mi? ABD gözlemcileri 'Ti'yi yaratıyor …

                                  Boffins, kullanıcıların akademik ön baskılarını derecelendirmesini ve benzer akademik beğenilere sahip kişileri bulmasını sağlayan bir uygulama oluşturdu ve sonuçları akademik yayıncılığındaki eğilimleri belirlemek için kullanmayı umuyor.                  Jeff Leak, John Hopkins Üniversitesi'nden biyostatik profesör ve kurumun veri bilim laboratuvarının bir üyesi, Papr'ın "ön baskıların Kontağı" olduğunu söylüyor.                  Papr, BioRxiv biyoloji araştırması ön baskı veritabanından, ön incelemeleri – …

Devamını Oku »

Aktin bağlayıcı protein cor …

Dinamik, düzgün şekilde organize edilmiş bir aktin sitoskeletonu trombositlerin üretimi ve hemostatik fonksiyonu için kritik öneme sahiptir. Wiskott Aldrich Sendromu proteini (WASp) ve Aktinle İlgili Proteinler 2 ve 3 Kompleksi (Arp2 / 3 kompleksi), birçok hücre tipinde aktin polimerizasyonunun ve organizasyonunun kritik aracılarıdır. Trombositlerde ve megakaryositlerde, bu proteinlerin uygun trombosit üretimi ve işlevi için önemli olduğu gösterilmiştir. Proteinlerin (Cttn ve …

Devamını Oku »

Elon Musk, Mars koloni roketini ortaya çıkarıyor …

                                                   'İnsanları Çok Gezegenli Türler Yapma' planı, 1 milyon insanın Mars'a nasıl götürüleceğini ayrıntılarıyla anlatıyor                                               Elon Musk'un Mars planı"                                                                                                        Elon Musk, Mars'ta kendi kendine yeten bir şehir kurarak "İnsanları Çok Gezegensel Türler Hale Getirmek" konusundaki planını yayınladı.                  Musk, insanlığın yok oluş olayı başlamadan önce yeryüzünden çıkması gerektiğini ve …

Devamını Oku »

Myeloid 12/15-LOX, B'yi düzenler …

Lauder tarafından yapılan çalışma ve diğerleri . 12/15-LOX eksikliği olan farelerde kullanıldı ve splenik B1 ve MZ hücre popülasyonlarında, serum ve barsak lavajında ​​(GL) ve bronkoalveoler lavajda (BAL) IgM'de bir artış olduğunu gösterdi. BAL IgG ve IgA da artmıştır. Lipid oksidasyonuna aracılık eden enzimlerin B hücresi alt gruplarını ve antikor üretimini düzenleyebileceği bulgusu ilgi çekicidir ve kağıt iyi yazılmıştır. Ana …

Devamını Oku »

Bağımlılığın Devreye Alınması …

J Natl Cancer Inst. 2017 Ocak; 109 (1): djw199. Eileen E. Parkes, Steven M. Walker, Laura E. Taggart, Nuala McCabe , Laura A. Knight, Richard Wilkinson, Karen D. McCloskey, Niamh E. Buckley, Kienan I. Savage, Manuel Salto-Tellez, Stephen McQuaid, Mary T. Harte, Paul B. Mullan, D. Paul Harkin, ve Richard D. Kennedy Yazarların üyeleri: Kuzey İrlanda Moleküler Patoloji Laboratuvarı (MST, …

Devamını Oku »

SMCHD1 mutasyonları ile ilişkili olan SMCHD1 mutasyonları …

1 Harvard Üreme Endokrin Bilimleri Merkezi ve Narkotik Direnç ve İnfertilitede Translasyonel Araştırma Merkezi, Tıp Bölümü Üreme Endokrin Ünitesi, Massachusetts Genel Hastanesi, Boston, Massachusetts, ABD 2 Ulusal Çevre Sağlık Bilimleri Enstitüsü, Araştırma Üçgeni Parkı, Kuzey Carolina, ABD 3 Massachusetts Genel Hastanesi ve Harvard Tıp Fakültesi, Nöroloji Anabilim Dalı, Massachusetts, Boston, Massachusetts, Massachusetts Genel Hastanesi, Moleküler Nörogenetik Ünite ve Psikiyatrik ve …

Devamını Oku »

Sonunda yapılan müdahaleler …

Açıklanan yaklaşım kullanılarak, analizimiz 10 kategoride yaşam sonu müdahalesi üretti. Her kategori için iki özel özellik oluşturduk: 'odaklanma' ve 'yer değiştirme'. Müdahale kategorileri, "çerçeve" ve "enstrümanlar" olmak üzere iki genel tipte toplandı: Müdahale kategorileri 10 müdahale kategorisi geniş bir eylem yelpazesini ele geçirdi ve Yaşam sonları ile ilgili faaliyet konuları. Yaşamın sonu müdahaleleri birçok biçimde olabilir. Sosyal bilim analizinin köklü …

Devamını Oku »

Glisolilasyon ve Lipidler …

Membran Proteinler ve reseptörler Örneğin, dahil olmak üzere çeşitli hücresel işlevleri yönetmek Hücresel tanımada ve hücresel ile bağlantılı sinyaller üretirken iletişim. Bu moleküllerin membranlara bağlanmış olması Ve hücresel arayüzlerde etkileşimde bulunmanın bazı önemli sonuçları vardır. 1 Bunların başında zar tethering Reseptörlerin birbirleriyle karşılaşma yetilerini sınırlar ve bu Karşı yüzeylerin yeterince yakınına gelmesini gerektirir Yanal difüzyonla yönlendirilen bağlanma partnerlerinin angajmanına izin …

Devamını Oku »

Değiştirmek için taahhüt * E çağrısı …

Sürüm 1. Wellcome Open Res. 2016; 1: 21 1 Öz-Harm Araştırma Grubu, Psikoloji Bölümü, University of Nottingham, Nottingham, Birleşik Krallık 2 Sosyal ve Toplum Tıbbı Okulu, Bristol Üniversitesi, Bristol, İngiltere Eğitim anlayışı: DK; Çalışma tasarımı: EN & DK; Verilerin edinilmesi: tüm yazarlar; Analiz: DK; Verilerin yorumlanması: tüm yazarlar; Makalenin taslak hazırlanması: EN; Kritik düzeltme: tüm yazarlar. Rekabet konusu çıkarlar: Kabul …

Devamını Oku »

Regülasyonda De Novo'nun Silinmesi …

Kompleman faktörü H ( CFH ) ve tamamlayıcı faktör H ile alakalı ( CFHR1-CFHR5 ) genler Kromozom 1q32 () üzerindeki kompleman aktivasyon (RCA) kümesinin düzenleyicilerinde 360-kb bir bölgede bulunur. 1 Bu genomun birkaç büyük genomik kopyasından kaynaklanan bir alandır 3 ve bu düşük kopyalı tekrarlar bu bölgede genetik istikrarsızlığa neden olabilir. ] RCA kümesindeki 6.3 kb'lik bir silinme, yeni bir …

Devamını Oku »

'

Sürüm 1. Wellcome Open Res. 2017; 2: 5. 1 Glasgow Üniversitesi, Glasgow, İskoçya, İngiltere Rekabet Hakları: Rekabet konusu olmayan herhangi bir çıkar bildirilmedi. Bu açık erişim amaçlı bir dergidir; Creative Commons Attribution License lisansıyla sınırsız kullanım, dağıtım Özet 1916'da, dünyanın her yerinde İskoçya'daki Clyde Nehri kıyısındaki Prenses Louise İskoç Hastanesi'nin (bugün Erskine olarak varlığını sürdüren) Limbless Sailors and Soldiers'ın kuruluşu, …

Devamını Oku »

Translasyonel sonlandırma ile …

Bakterilerde mRNA transkriptlerinin% 2-4'ünde, hatalı transkripsiyon veya nükleolitik bölünme nedeniyle bir çerçeve içi durdurma kodonu yoktur (1). Tercüme edildiğinde serbest bırakma faktörlerini toplama yeteneği, ribozomların bu kesintisiz transkriptlerin 3 'ucunda durmasına neden olur. Ribozomları çevirmek, bir durdurma kodonu ya translasyonel çerçeve kaydırma (2, 3) ile okunur ya da geçilirse, bozulmamış transkriptlerin 3 'ucunda durur. Durmuş ribozomların birikimi potansiyel olarak ölümcül …

Devamını Oku »

HIV servisinde boşlukların belirlenmesi …

J Int AIDS Soc. 2017; Kathryn Kilisesi, bir * Kazuyo Machiyama, bir Jim Todd, bir Brian Njamwea, b Mary Mwangome, c Vicky Hosegood, d Janet Michel, e Samuel Oti, b Constance Nyamukapa, f Amelia Crampin, g Nyaguara Amek, h Gertrude Nakigozi, ben Denna Michael, j F Xavier Gómez-Olivé, k Jessica Nakiyingi-Miiro, l Basia Zaba, bir ve Alison Wringe bir

Devamını Oku »

Tüm yıldızların ikizleri vardır, astroboffinler diyelim • Regis …

                                  Güneşi de içeren neredeyse tüm yıldızlar, sıcak, yoğun moleküler bulutlardan doğar ve Royal Astronomical Society'nin Aylık Bildirimleri'nde yayınlanacak bir makaleye göre çiftleşirler.                  İkili yıldız sistemleri uzayda yaygın. Büyük, parlak O-tipi ve B-tipi yıldızların yüzde 80'inin çoklu yıldız sistemlerine kilitlendiği ve güneş benzeri yıldızların yaklaşık yüzde 50'sinin eşlik ettiği tahmin edilmektedir.                  Kaliforniya Üniversitesi, Berkeley ve Smithsonian Astrofizik …

Devamını Oku »

Perivasküler kök hücreler (PSC), mezenşimal kök hücrelerin (MSC'lerin) doğal atalarıdır ve [1945900] Kök hücreler homeostazdan sorumludur ve in vivo onarımı. Prospektif olarak tanımlanmış ve izole edilmiş PSC'lerin plastisite ve osteojenik potansiyeli arttığını göstermiştir. İnfrapatellar yağ yastığından (IFP) gelen hücreler, subkütan yağla karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir. Bu araştırma, IFP PSC'lerin kondrojenik potansiyelini, IFP ve kemik iliği kaynaklı MSC'lerle karşılaştırdı. İmmünhistokimya, endotelyal belirteçler (CD31, CD34, CD34, nevral / glial antijen 2 [NG2]trombosit kökenli büyüme faktörü reseptör-β [PDGFRβ] ve α-düz kas aktini [α‐SMA]) perivasküler belirteçlerinin yerini göstermiştir , CD144, von Willebrand faktörü [vWF]). Stomatolojik vasküler fraksiyondan perisit ve adventisyel hücreler izole edildi (sırasıyla% 3.8 ve% 21.2), canlı sitometri kullanılarak% 88 canlılık elde edildi. İzole edilen perisit ve adventisyal hücrelerin ortalama sayısı sırasıyla 7.9 ± 4.4 x 10 3'e eşit olan 4.6 ± 2.2 x 10 4 ve 16.2 ± 3.2 x 10 4 ve hasat edilen doku gramı başına 20.8 ± 4.3 x 10 3 hücre. Flüoresanla aktive hücre ayırma kültürlenmiş PSC'lerin CD44 + CD90 + CD105 +; Polimeraz zincir reaksiyonu ve immünositokimya, perisitlerin CD146 + fenotipini koruduğunu ve perisit belirteçleri PDGFRβ ve NG2'yi ifade ettiğini gösterdi. Farklılaşma, histokimyasal boyalar ve genetik ifade kullanılarak teyit edildi. Bir pellet modeli kullanan IFP PSC'leri ve MSC'ler, kemik iliği MSC'lerinden çok daha fazla hücre dışı matris oluşturdu (sırasıyla p <.001 ve p = .011). IFP PSC'leri IFP MSC'lerden çok daha fazla hücre dışı matris oluşturdu ( p = .002). Mikrokrom kültürü, farklılaşmış PSC'lerin 4.8 ± 1.3, 4.3 ± 0.9 ve 7.0 faktörlerine göre COL2A1 ACAN ve SOX9 ekspresyonu için MSC'lerle karşılaştırıldığında yukarı doğru düzenlendiğini ortaya koymuştur ± 1.7 idi. IFP, kemik iliği ile karşılaştırıldığında kondrojenik kök hücrelerin önemli ölçüde daha iyi bir kaynağıydı. PSC'ler kültürden türetilmiş MSC'lere göre çok daha fazla hücre dışı matriks oluşturdu. S tem C ells T ranselasyonel M edicine 2017; 6: 77-87 Anahtar kelimeler: Perisit, CD34 +, Kondrojenez, Yetişkin kök hücreleri, Adipoz Giriş Perivasküler kök hücreler (PSC), kültür kökenli mezenşimal kök hücrelerin (MSC'ler) doğal ataları olarak tanımlanmıştır ve in vivo homeostazdan ve rejenerasyondan sorumludur . PSC'ler, tipik olarak kılcal damarlar, venüller ve arterioller gibi daha küçük damarların etrafında bulunan perisitleri ve daha geniş damarların ve damarların çevresinde bulunan adventisyel hücreleri içerir . Adventisyal hücrelerin perisit oluşturabileceği gösterilmiştir; Bu hücre popülasyonlarından herhangi biri kültür içine yerleştirildiğinde yaygın olarak MSC olarak adlandırılanlardan belirgin olmayan hücre popülasyonlarına yol açarlar PSC'ler osteojenik, kondrojenik, adipojenik ve miyojenik Potansiyel, ancak bu sadece osteojenez için nicelendirilmiştir 4 5 6 . Periksit benzeri öncüllerin MSC'ler 2 7 ile karşılaştırıldığında daha iyi olgunlaşmamış ve engraftment potansiyeli olan daha plastik olduğunu gösterdiler, daha iyi olacağını önermekte Doku yenilenmesi ve mühendisliği için kök hücre kaynağı. Kondrojenez Farrington-Rock ve ark. Tarafından gösterilmiştir. Sığır retinal perisitleri kullanılarak 1 3 8 . İnsanlarda, perisitlerin kondrojenik potansiyelinin gösterilmesi pelet kültürlerinde Alc mavi boyama ile sınırlandırılmıştır 1 3 ; Perisitlerin kondrojenik potansiyelini kültürden türetilmiş MSC'lerinkine kıyaslayan veya karşılaştıran herhangi bir veri yoktur. Kondroprojenitor hücrelerin in vivo yerleşimi hala tartışılmıştır; bazıları eklem içindeki dokulardan ve diğerlerinin içinden geldiğine inanmaktadır. Subkondral kemikten geldiğini savunarak. İnfrapatellar yağ bandı (IFP) artiküler kıkırdağa bitişik olan (19459007) 9 bir intra-artiküler ancak ekstrasynoviyal yapıdadır (Şekil. CD146 eklem kıkırdağı içindeki kondroprojenitör hücrelerde bulunan bir belirteç olarak bildirilmiştir 10 . Khan ve diğ. IFP'nin doku kesitleri üzerinde 3G5-pozitif perivasküler kök hücreleri belirledi ancak IFP'den kültürlenen hücrelerin yalnızca küçük bir bölümünün bu fenotipi koruduğunu buldu 11 . İnfrapatellar yağın yakınlığı, kondroprojenitör hücrelerin kökeni için bir aday olmasını sağlar. IFP'den türetilen kök hücreler, bu nedenle, kıkırdak rejenerasyonu için daha büyük bir afiniteye sahip olabilir. Infrapatellar yağ pedi konumu ve numuneleri. (A): Eklem kıkırdağına (siyah) infrapatellar yağ pedinin (IFP) ilişkisini gösteren dizin sagital manyetik rezonans görüntüleme taraması. PSC'lere yönelik daha önceki araştırmalar, cilt altı Çünkü bu, seçmeli prosedürler uygulanan hastalardan atık madde olarak kolaylıkla elde edilebilir. Yağ dokusunun yapısı ve içeriği hasat edilen MSC'lerin rejeneratif potansiyeli gibi 12 konumuna 14 bağlı olarak değişir. IFP eşleştirilen hasta örneklerinden alınan subkutanöz abdominal yağ ile karşılaştırıldığında artmış kondrojenik potansiyel göstermiştir 15 . IFP, eklem içerisinden de sinovyal membranı da içine alan hasattan farklıdır. Yazarlar, IFP'nin doku mühendisliğinde kullanılmak üzere PSC'lerin hasat edilmesi için uygun bir kaynak olduğunu gösteren yayınlanmış verilerin farkında değildirler . Bildiğimiz kadarıyla, PSC'lerin kondrojenik potansiyelini MSC'lerinkiyle ölçen ve karşılaştıran herhangi bir veri yoktur. Araştırma tipik olarak diz artroplastisine giren ve genellikle altmış ve yedinci yıllarında olan hastalardaki IFP örneklerini kullandı. Osteoartrit tedavisi gerektiren bu yaşlı hastalardan elde edilen veriler, fokal kıkırdak kusurlarına sahip olanlar için geçerli olmayabilir – bu, kıkırdak rejenerasyon prosedürleri için uygun olan ve tipik olarak üçüncü ve dördüncü on yıllarında olan gruptur Eklem kıkırdak hasarı, Gelişim koşulları, travma ve erken dejenerasyon. Genellikle genç hastalarda görülür ve son aşama artriti gibi benzer seviyelerde ağrı ve morbiditeye neden olabilir . Bu, hastanın, sosyal faaliyetlerde bulunma, egzersiz yapma ve üstlenme kabiliyeti üzerinde önemli bir etkiye sahiptir. Eklem kıkırdak kusurları kendi kendine tamir edilemez ve kritik bir boyuta ulaştıklarında, son aşama artritine dejenere olurlar 17 . Bu sorunların tedavisinde maliyetin sadece ABD'de yılda 40 milyar dolar olduğu tahmin edilmektedir. Kıkırdak tamir cerrahisinin amacı, ağrıyı hafifletmek, eklemin işlevini en üst düzeye çıkarmak ve son aşamada osteoartirit için progresyonu önlemektir. Genç yetişkinlerde bu hayati öneme sahiptir, çünkü kaçınılmaz dejenerasyon şu anda cerrahi eklem replasmanı ile yönetilmektedir, fonksiyonel talepleri yüksek olan ve implantın daha uzun süre dayanması nedeniyle genç hastalarda çirkin bir seçenektir. Bu hastaların ideal tedavisi, hiyalin kıkırdağın yenilenmesi olacaktır. Bu çalışmanın temel amacı, IFP'yi, özellikle kıkırdak rejenerasyonu için doku mühendisliği için PSC'lerin prospektif olarak izole edilmesi için bir kaynak olarak değerlendirmekti. Ek amaçlar, IFP ve kemik iliği arasında ve PSÖ'ler ile IFP'den gelen MSC'ler arasında kondrojenik potansiyel açısından farklılıklar olup olmadığını saptamaktı. Ayrıca, örneklerin artroskopik olarak genç hastalardan hasat edilip edilemediğini ve bu örneklerin artroplasti yaşlı hastalardan farklı olup olmadığını araştırdık, çünkü ortopedik cerrahlar dizindeki kıkırdak rejenerasyonu için kendi numunelerini toplayan doğrudan etkilere sahipti. Doku numunelerinin toplanması, depolanması ve kullanımı, Güney Doğu İskoçya Araştırma Etik Komitesi tarafından onaylandı (19459035). Malzemeler ve Yöntemler Doku Hasat ve Hücre İzolasyonu Referans numarası 10 / S1103 / 45). Total diz replasmanı (TKR; Şekil) veya artroskopik anterior çapraz bağ rekonstrüksiyonu (ACL; Şek.) Bir parçası olarak çıkarılan infrapatellar yağ pedi toplandı ve% 10 fetal sığır ile takviye edilmiş steril Dulbecco Modifiye Kartal Ortamında (DMEM) laboratuara nakledildi. Doku örnekleri, 1 mm'den (19459007) 3 (Şekil.) 'Den az olmamasını sağlamak için mekanik olarak bozuldu ve sindirimle kaplandı (ör., Spermatozis, Orta (% 10 FBS,% 1 PS ve% 1 kollajenaz II takviyeli DMEM [Thermo Fisher Scientific Life Sciences, Waltham, MA, http://www.thermofisher.com]). Numuneler çalkalayıcı bir su banyosunda 37 ° C'de ve 150 rpm'de 40 dakika boyunca sindirildi. Digestler eşit hacimde bir DMEM ile karıştırılmış ve daha sonra 1800 rpm'de 10 dakika boyunca santrifüje tabi tutulmuştur. Adipositler ve yağlı yağ içeren süpernatant aspire edildi ve atıldı. Topaklar, 25 ml% 2 FBS / PBS (5 mM EDTA) içinde yeniden süspanse edildi. Doku süspansiyonları, 200 um'lik bir naylon örgü ve daha sonra 100, 70 ve 40 um'lik hücre süzücüler aracılığıyla birbiri ardına filtrelenmiştir. Gerilmiş süspansiyonlar 1.500 rpm'de 10 dakika boyunca santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve peletler, PSC'leri izole etmek için akış sitometrisi için yeniden süspande edildi. IFP kültüründen türetilen MSC'lerin elde edilmesi için, bu hücre süspansiyonu bir T75 şişesi içerisinde 10 ml kültür ortamı içine yerleştirildi. Diz replasman ameliyatı geçiren hastaların distal femurundan toplanan kemik iliği, MSC'leri elde etmek için doğrudan bir T75 şişesi içinde 10 ml kültür ortamına yerleştirildi. MSC kültürleri 24 saat içinde değiştirildi ve tüm yapışık hücreler prolifere kalmaya bırakıldı. Histoloji ve İmmünohistokimya Doku numuneleri, 2 cm 3 ,% 4 formalinde hızlı ve tam fiksasyon sağlamak için. Sabit doku Tissue-Tek kasetlerine yerleştirildi (Sakura Finetek, Torrance, CA, Http://www.sakura-americas.com) ve bir Leica ASP işlemci (Leico Biosystems, Nussloch, Almanya, Http://www.leicabiosystems.com) sıralı alkol, ksilen ve parafin mumu adımlarını kullanarak. Doku daha sonra erimiş balmumu içine gömüldü, soğuk bir tabla üzerinde katılaşmaya bırakıldı ve 7 um kalınlıktaki kesitlere kesildi. Kesitler 55 ° C'de gece boyunca kuluçkaya yatırılmış, her iki dakikada 2 dakika boyunca% 95 etanol, 3 kez, daha sonra% 95,% 80 ve% 50 etanol olmak üzere yeniden kıvamlandırılmış (5 dakika için ksilen, 3 kez) Sonra akan su altında yıkanır). Slaytlar bir sonraki paragrafta tarif edildiği gibi boyandıktan sonra dehidre edildi (her biri 30 saniye boyunca% 50,% 80 ve% 95 etanol ve 2 dakika süreyle% 100 etanol, 3 kez) ve ksilen kullanılarak monte edildi. Bölümler, Harris hematoksilen (Sigma-Aldrich, St. Louis, MO, Http://www.sigmaaldrich.com) ile 5 dakika süreyle yıkanmış ve akan su altında yıkanmıştır. Etanol içindeki% 1 hidroklorik asit içinde farklılaştılar ve doku kesitleri maviye dönüşene kadar 2 dakika boyunca Scott'un musluk suyu ikamesi çanağına aktarıldı. Slaytlar eozin içinde 2 dakika boyunca kontrast madde ile lekelenmiş ve kısa bir süre akan su altında yıkanmıştır. Picrosirius red (PSR) solüsyonu, doymuş sulu pikrik asit içerisinde sirius red F3B (% 0.1) kullanılarak yapıldı. Kesitler PSR solüsyonuna 2 saat süreyle yerleştirildi, çıkarıldı ve akan suda 30 saniye yıkandı. Tyramide sinyal amplifikasyonu, bir Leica BOND-MAX boyama robotu (Leica Biosystems) kullanılarak yapıldı. Slaytlar başlangıçta hidrojen peroksidaz (BOND yıkamada 1:10, [BW] ile 10 dakika bloke edildi ve sonra serumda 10 dakika süreyle bloke edildi (tipli ikincil antikor konakçı türe bağımlı). Kesitler birincil antikor ile 30 dakika boyunca boyandı (CD31 [catalog no. ab28364]CD34 [catalog no. ab8536]CD146 [catalog no. ab134065]hepsi Abcam, Cambridge, MA, http://www.abcam.com; Nöral / glial antigen 2 [NG2; catalog no. 554275]BD, Franklin Lakes, NJ, http://www.bd.com; Von Willebrand faktörü [vWF; catalog no. V2700‐01C]US Biological, Salem, MA, Https://www.usbio.net) ve 30 dakika boyunca sekonder bir horseradish peroksidaz (serumda 1: 50 seyreltme, keçi anti-tavşan [catalog no. ab7171; Abcam] ve keçi anti-fare [catalog no. ab6823; Abcam]) izledi. Tyramide amplifikasyonu, gerekli antikor sayısına (katalog no. NEL741B001KT, NEL744B001KT ve NEL745B001KT'ye) bağlı olarak fluorescein izotiosiyanat (FITC), siyanin (Cy) 3 ve Cy5 tiramid kitleri kullanılarak 10 dakika boyunca (kendi seyrelticisinde 1:50) gerçekleştirildi Sırasıyla Perkin Elmer, Waltham, MA, 10 dakika (BW'de 1: 1,000) boyanarak 4 ', 6-diamidino-2-fenilindol (DAPI) boyanmıştır. Histokimyasal boyama bir parlak alanı kullanarak görüntülendi (http://www.perkinelmer.com) Ayarı ve bir Zeiss Gözlemci mikroskoplu renkli kamera (Zeiss International, Jena, Almanya, http://www.zeiss.com). Olympus BX61 floresan mikroskopu (Olympus, Tokyo, Japonya, Http://www.olympus-global.com), immünohistokimya için kullanılan tek tek fluoroforlardan gelen emisyonu sıralı olarak kaydetmek için kullanıldı; Bunlar daha sonra birleşik bir görüntü oluşturmak üzere birleştirildi. İzotipleri kullanan kontroller aynı koşullar altında görüntülendi. Akış Sitometrisi PBS içinde% 10 fare serumu içinde hücreler bloke edildi ve oda sıcaklığında (RT) 20 ° C'de bırakıldı (20 ° C) Analiz için dakika-100 μl ve hücre ayırma için 500 μl. Aksi belirtilmedikçe karanlıkta hücre süspansiyonuna 1: 100 oranında bir seyreltme ile antikorlar eklenmiştir. CD31-PE (BD340297), CD34-FITC (BD555821), CD45-PE-Cy7 (BD557748) ve CD146-AF647 (BD562230) olmak üzere BD'den aşağıdaki antikorlar hücre ayrıştırması için kullanılmıştır. Kültürlenmiş hücrelerin değerlendirilmesinde kullanılan ek antikorlar arasında CD34-PE (katalog No. R1725; Agilent Technologies; Santa Clara, CA, http://www.agilent.com); Ve BD: CD44-AF700 (BD561289), CD56-PE-Cy7 (BD560916), CD90-FITC (BD555595), CD105-PE-Cf594 (BD562380) ve CD144-PerCP-Cy5.5 (BD561566). Hücreler karanlıkta buz üzerinde 20 dakika inkübe edildi. Hücreler, 2 ml PBS içerisinde yıkandı ve 5 dakika için 1,000 rpm'de santrifüje tabi tutuldu. Süpernatan aspire edildi ve atıldı ve pellet, analiz için 300 ul ve hücre çeşitleri için 500 ul ile birlikte% 2 FBS / PBS içinde yeniden süspansiyon haline getirildi. Her bir antikor için bir kompenzasyon tüpü, tekli 70 μl% 2 FBS / PBS ile seyreltilmiş pozitif telafi boncuklarının damlası ve hücrelere özdeş bir şekilde boyandı. Bunlar, 270 ul'lik nihai bir hacimde yeniden askıya alındı ​​ve bir damla negatif kontrol boncukları, floresanla aktive edilmiş hücre ayırma (FACS) analizi veya sınıflandırmadan hemen önce eklendi. Geçitler, gerçek-pozitif boyanmayı belirlemek için negatif kontroller kullanılarak belirlendi. Hücre Kültürü FACS'ye göre sıralanmış hücreler, 300 | il endotel hücresi büyüme ortamı ( EGM-2; Lonza, Basel, İsviçre, Percyitler (CD31-CD34-CD45-CD146 +) ve adventisyal hücreler (CD31-CD34 + CD45-CD146-) olarak adlandırılmıştır. Kuyulara ve şişelere% 0.2 (hacim başına ağırlık) jelatin (EMD Millipore, Billerica, MA, Http://www.emdmillipore.com) 10 dakika boyunca 4 ° C'de inkübe edin. Hücreler, EGM-2'de cm başına 4 cm 2 yoğunluğunda kaplandı ve 37 ° C,% 5 CO 2 'de kültürlendi. EGM-2 aracığı, hücreler% 90-100'lük konfluansa ulaşana kadar 7 gün sonra ve daha sonra her 4 günde değiştirildi. Geçiş 1'den itibaren tüm hücreler, DMEM /% 20 FBS /% 1 PS içinde kültürlendi. Hücreler PBS içinde iki kez yıkandı ve daha sonra hücrelerin>% 90'ı mobil hale getirilene kadar 3-5 dakika 37 ° C,% 5 CO 2'de % 0.05 tripsin-EDTA içinde inkübe edildi. Komple ortam plakaya veya şişeye ilave edildi ve hücre süspansiyonu 15 ml'lik bir santrifüj tüpüne aktarıldı. Hücreler, 5 dakika boyunca 1.000 rpm'de santrifüjle topaklaştırıldı. Süpernatan aspire edildi ve atıldı ve pellet daha fazla kültür genişletme, farklılaşma veya akış sitometrisi için yeniden askıya alındı. Mezenkimal Farklılaşma Tek katman farklılaşması, 20 oyuk kullanılarak yapıldı 24 oyuklu bir plakadan: 10 göz, büyütme ortamı (DMEM /% 10 FBS /% 1 PS) için ve 10 farklılaşma ortamı için (HyClone AdvanceSTEM osteojenik ve adipojenik ortam; GE Healthcare Biosciences, Pittsburgh, PA, http://www.gelifesciences.com). Her bir 10 kuyucuk kümesi, ribonükleik asit (RNA) ekstraksiyonu için 5 ve histokimyasal boyama için 5'e bölündü. Hücreler, ml başına 2 x 10 4 konsantrasyona kadar seyreltildi ve her göze 1 ml ilave edildi. Plakalar,% 50-70 konfluent olana kadar 37 ° C,% 5 CO 2 de inkübe edildi, bu noktada farklılaşma seyrinin 0 inci günde olduğu kabul edildi. Plakalar kontroller olarak 0 günde alınmıştır. Ortam, farklılaşmaya giren plakalardan çıkarıldı ve 1 mi büyüme (DMEM /% 10 FBS /% 1 PS) veya farklılaşma ortamı ile değiştirildi. Ortam, haftada iki kez 21 gün boyunca değiştirildi. Üç boyutlu pelet kültürü kondrojenik farklılaşma için kullanıldı. Hücre sayımı yaptıktan sonra, hücreler, ml başına 6 x 10 5 hücre yoğunluğunda, ya kondrojenik ortamda (HyClone AdvanceSTEM; GE Healthcare Biosciences) ya da DMEM /% 10 FBS /% 1 PS'de yeniden süspanse edildi ve 500 Ml, 96 oyuklu bir V taban plakasının bir bireysel oyuğuna pipetle yerleştirildi. Hücreler 800 rpm'de 5 dakika süreyle santrifüje tabi tutulduktan sonra 37 ° C'de% 5 CO 2 inkübe edildi. Büyüme ortamı kontrolleri için altı pelet ve farklılaşma ortamı için altı adet pelet kullanıldı. Altı, üçü RNA ekstraksiyonu için, üçü de histokimyasal boyama için kullanıldı. Ortam plakaları 800 rpm'de 5 dakika santrifüj ederek haftada iki kez değiştirildi ve daha sonra ortam aspire edildi, atıldı ve taze ortam ile değiştirildi. Orta derecede değişiklikler yapıldıktan sonra peletler, yapışkan olmadıklarından emin olmak için hafifçe çalkalandı. Mikrokrom kültürleri Zhu ve ark. 18 . Mikromasterler 5 x 10 5 hücrenin Kafienah ve diğerleri tarafından tarif edilen 30 ul kondrojenik ortam içinde yeniden süspanse edilmesiyle oluşturuldu. 19 . Hücre süspansiyonu, 24 oyuklu bir plakanın tek bir kuyusunun ortasına nazikçe pipetle gönderildi. Hücreler, ilave 1 ml kondrojenik ortam ilave edilmeden önce gece boyunca 37 ° C,% 5 CO 2 kalmıştır. Ortam, 21 günde bir 2-3 günde bir değiştirildi. Histokimya İmmunositokimya için, PBS çıkarıldı ve hücreler% 0.05 Triton-PBS ile permeabilize edildi. Oda sıcaklığında 3 dakika; Hücreler üç kez PBS ile yıkandı ve daha sonra RT'de 1 saat boyunca Protein Bloğu (Agilent Technologies) ile bloke edildi. Hücreler PBS'de yıkandı ve daha sonra birincil antikor ile gece boyunca 4 ° C'de inkübe edildi. Ertesi sabah, çukurlar 5 kez 3 kez yıkandı – bir kez PBS-Tween ve iki kez PBS ile yıkandı. Hücreler, karanlıkta oda sıcaklığında 1 saat boyunca ikincil antikor ile inkübe edildi. Daha üç yıkamadan sonra, lamelleri çıkarıldı ve herhangi bir fazla sıvı çıkarıldı. Lamelleri, DAPI floromount kullanarak slaytlar üzerine monte edildi ve bir yapıştırıcıyla yerine sabitlenmeden önce karanlıkta 1 saat hava kurumasına izin verildi. Beş farklı hastadan kültürlenen perisitler, üç farklı anti-CD146 antikoru (klon OJ79c [catalog no. MCA2141F]BioRad Laboratories, Hercules, CA, http://www.bio-rad.com; Klon 541-10B2 [catalog no. 130‐092‐851]Miltenyi Biotec, San Diego, CA, http://www.miltenyibiotec.com; Klon P1H12 [catalog no. 563186]BD Biosciences). Osteojenik farklılaşma, Alizarin red kullanılarak, kalsiyum birikintileri ile çift difraksiyonlu bir kompleks oluşturmak üzere belirlendi. Alizarin kırmızı çözelti, 100 mL damıtılmış su (dH 2 ) ile 2 g Alizarin kırmızı S (CI 58005) ilave edilerek hazırlandı. Bu iyice karıştırıldı ve pH,% 10 amonyum hidroksit ile 4.1-4.3'e değiştirildi. Kuyucuklar, kalsiyum ile kırmızı-turuncu boyama oluşturmak üzere oda sıcaklığında yaklaşık 30 dakika 1 ml Alizarin kırmızı çözeltisi ile boyandı. Fazla leke, dH ile dört kez yıkanarak çıkarıldı. Adipojenik farklılaşma, Yağlı Kırmızı O kullanılarak değerlendirildi. Bir stok çözeltisi, 0.7 g Yağ Kırmızı O'nun (katalog no. Sigma O-062; Sigma-Aldrich) ile 200 ml izopropanol ilave edildi. Bu, gece boyunca karıştırıldı ve sonra bir 0.2-um filtreden geçirildi. Stok solüsyonu 4 ° C'de saklandı. Çalışma solüsyonu dört bölüm dH'ye 2 6 parçalık stok solüsyonu eklenerek yapıldı. Bu karıştırıldı ve 0,2 um'lik bir filtreden geçirilmeden önce oda sıcaklığında 20 dakika bırakıldı. Çukurlar iki kez dH ile yıkandı ve daha sonra oda sıcaklığında 5 dakika boyunca% 60 izopropanol ile dehidre edildi. İzopropanol çıkarıldı ve çukurlar yıkamadan kurutuldu. Hücreler, oda sıcaklığında 10 dakika boyunca 1 ml Yağ Kırmızı O solüsyonuyla boyandılar. Fazla leke, dH 2 ile dört kez yıkanarak çıkarıldı. Kondrojenik farklılaşma, proteoglikanlar için Alcian mavisi boyaması ile gösterildi. Slaytlar veya oyuklar oda sıcaklığında 3 dakika boyunca asetik asit ile inkübe edilmiş, bunu takiben 30 dakika boyunca RT'de Alcian mavisi uygulanmıştır. Fazla leke, asetik asit kullanılarak çıkarıldı ve slaytlar üç kez dH ile yıkandı. Picrosirius redi ayrıca kollajen depozisyonunu belirlemek için kullanıldı. RNA, TriZol (Thermo Fisher Scientific Life Sciences) kullanılarak özütlendi ve faz ayrımı ve bunu takiben bir RNeasy Micro (RNeasy Micro) kullanıldı. RNA Ekstraksiyonu RNA, Kit (Qiagen, Hilden, Almanya, https://www.qiagen.com). Örnekler, TriZol'de -80 ° C'de saklandığından özdeş koşullar altında analiz edilebilirler. Numuneler buz üzerinde çözüldü ve 1 ml TRIzol başına 200 ul kloroform eklendi; Bunlar 20 saniye boyunca elle çalkalandı, oda sıcaklığında 2-3 dakika bekletildi ve 12,000 rpm'de ve 4 ° C'de 20 dakika santrifüj edildi. RNA ihtiva eden üst, berrak tabaka (yaklaşık 200 ul) bir RNaz içermeyen 2 ml'lik Eppendorf tüpüne aktarıldı ve daha sonra RNeasy Micro Kit kullanılarak işlendi. RNA miktarı ve kalitesi NanoDrop (Thermo Fisher Scientific Life Sciences) kullanılarak, RNA / protein oranı 1.8-2.0 olan iyi kalitede RNA'ya eşittir. Superscript III ters transkriptaz, RNA'yı tamamlayıcı hale getirmek için kullanılır Deoksiribonükleik asit (cDNA). Toplam 500 ng ila 5 ug RNAse içermeyen su ile toplam 12 ul hacme seyreltildi. Daha sonra 1 ul rastgele primerler ve 1 ul 10 mM deoksinükleotit karışımı ilave edildi. Karışım 65 ° C'de 5 dakika boyunca denatüre edildi ve buz üzerinde en az 1 dakika soğutuldu. 4 ul birinci iplikçik tamponu (5 x konsantrasyon; Thermo Fisher Scientific Life Sciences), 1 μl 0.1M dithiothreitol ve 1 μl Superscript III ters transkriptaz enzimi (Thermo Fisher Scientific Life Sciences) içeren bir cDNA sentez karışımı. CDNA, 25 ° C'de 10 dakika, 60 ° C'de 60 dakika inkübe edilerek ve 15 dakika boyunca 70 ° C'ye ısıtılarak reaksiyonun durdurulmasıyla sentezlendi. CDNA, 4 ° C'ye soğutuldu ve kısa süreli kullanım için buzdolabında ve daha uzun süreli depolamalarda -20 ° C'de tutuldu. Polimeraz Zincir Reaksiyonu PCR Primerler, Bioline'den (London, UK, Http://www.bioline.com) bir liyofilize toz halinde eklendi ve 100 uM'lik bir stok konsantrasyonuna getirildi. 90 μl RNaz içermeyen suya 5 μl sol ve 5 μl sağ primer eklenerek 10 μM'lik bir çalışma konsantrasyonu yapılmıştır. PCR MyTaq DNA polimeraz (Bioline) kullanılarak gerçekleştirildi. Tepkime karışımı 5 ul MyTaq Reaksiyon Tamponu (5x konsantrasyon), 2 ul cDNA, 1 ul primer (10 uM, nihai konsantrasyon, 0.4 uM), 0.25 ul MyTaq DNA polimeraz ve 16.75 ul RNase- Serbest su Aşağıdaki primerler hücre kimliği için kullanıldı: CD31 (19459010) (F: GAAGTACGGATCTATGACTCA, R: GTGAGTCACTTGAATGGTGCA); CD34 (F: CATCACTGGCTATTTCCTGAT, R: AGCCGAATGTGTAAAGGACAG); CD45 (F: CATGTACTGCTCCTGATAAGA, R: GCCTACACTTGACATGCATAC); CD146 (F: AAGCAACCTCAGCCATGTCG, R: CTCGACTCCACAGTCTGGGAC); NG2 (F: GCTTTGACCCTGACTATGTTG, R: TCCAGAGTAGAGCTGCAGCA); Trombosit türevi büyüme faktörü β ( PDGFRβ ; F: CAGTAAGGAGGACTTCCTGGA, R: CCTGAGAGATCTGTGGTTCCA); Ve β-aktin ( ACTB ; F: CCTCGCCTTTGCCGATCC, R: GGAATCCTTCTGACCCATGC). Farklılaşma için kullanılan ilave primerler aşağıdaki gibidir: kolajen II ( COL2A1 ; F: GGAAACTTTGCTGCCCAGATG, R: TCACCAGGTTCACCAGGATTGC); SOX9 (F: ACATCTCCCCCAACGCCATC, R: TCGCTTCAGGTCAGCCTTGC); Aggrecan ( ACAN ; F: TGCGGGTCAACAGTGCCTATC, R: CACGATGCCTTTCACCACGAC), hiyalüronan ve proteoglikan bağlantı proteini 1 ( HAPLN1 ; F: CAACCAGTGCCTGTGTTGG, R: TATTGGTCCCTGTGGGTCT); Yüzeysel bölge proteini ( SZP ; F: CTCCTTTTTACAGCAAGGGCG, R: ATTATCCAGCCCGCTTCCAG); Runt ile ilgili kopyalama faktörü 2 ( RUNX2 ; F: ACTGGGCCCTTTTTCAGA, R: GCGGAAGCATTCTGGAA); Alkalin fosfataz canlı / kemik / böbrek ( ALPL ; F: TCAGAAGCTCAACACCAACG, R: GTCAGGGACCTGGGCATT); Osteokalsin ( BGLAP ; F: GCCTTTGTGTCCAAGC, R: GGACCCCACATCCATAG); Ve peroksizom proliferatör-aktive reseptör γ'yı içeren bir PCR reaksiyonu gerçekleştirildi. PCR ürünleri, bir moleküler ile çalıştırmak için 100 ml'lik bir alikot% 2 agaroz jeli kullanıldı ( PPARG ; F: TGAATGTGAAGCCCATTGAA, R: CTGCAGTAGCTGCACGTGTT) 1 kb'den az ağırlık (MW). Jeller, 2 g agarozun 100 ml 1 x TAE tamponunda (Tris baz, asetik asit ve EDTA; 1 saat 10 dakika dH'de seyreltilmiş, 10 x konsantrasyonda TAE, dH 2'de çözündürülerek hazırlandı: Thermo Fisher Bilimsel Yaşam Bilimleri) mikrodalga fırında tüm agaroz çözünene kadar ısıtılarak ısıtılmıştır. Daha sonra 10 ul Jel Kırmızı eklendi (10,000 x konsantrasyon [catalog no. 41003; Biotium, Freemont, CA, https://biotium.com]). Jel bir jel-döküm tepsisine yüklenmiştir; Örnek tarağı yerleştirildi ve oda sıcaklığında katılaşmasına izin verildi. Tepsi 1X TAE ile kaplanmış bir elektroforez tankına yerleştirildi ve taraklar çıkarıldı. CDNA örnekleri RNaz içermeyen su ile 10 ul'ye seyreltildi, yükleme boyası (2 ul, 6 x konsantrasyon) ile karıştırıldı ve bir numuneye pipetle yerleştirildi. Bant boyutlarının tanımlanabilmesi için düşük MW'lık bir DNA merdiveni çalıştırıldı. Elektroforez 110 V'de 1 saat çalıştırıldı. Kantitatif Gerçek Zamanlı PCR Kantitatif Gerçek Zamanlı PCR Nicel gerçek zamanlı PCR, bir Lightcycler 480 (Roche Life Sciences, Indianapolis, IN, https://lifescience.roche.com). CDNA, 384 oyuklu bir plakaya üç kopya halinde (oyuk başına 2 ul) yerleştirildi. Aşağıdakileri içeren tüm numuneler için primer spesifik karışımlar oluşturuldu: 5 ul SYBR yeşil master karışımı (2x konsantrasyon; Roche Life Sciences), 2 ul primerler (sağ ve sol, 5uM, nihai konsantrasyon 1uM olacak şekilde seyreltildi) , Ve 1 ul RNaz içermeyen su. Kantitatif gerçek zamanlı PCR (qPCR) için kullanılan hedef gen primerleri aşağıdaki gibidir: kollajen I ( COL1A1 ; F: GGAACACCTCGCTCTCCA, R: GGGATTCCCTGGACCTAAAG); COL2A1 (F: CAGAGGGCAATAGCAGGTTC, R: AGTCTTGCCCCACTTACCG); SOX9 (F: GTACCCGCACTTGCACAAC, R: TCTCGCTCTCGTTCAGAAGTC); Ve ACAN (F: CCTCCCCTTCACGTGTAAAA, R: GCTCCGCTTCTGTAGTCTGC). En istikrarlı olanı belirlemek için üç referans geni test edildi: gliseraldehit 3-fosfat dehidrojenaz ( GAPDH ; F: AGCCACATCGCTCAGACAC, R: GCCCAATACGACCAAATCC); Hipoksantin-guanin fosforibosil transferaz ( HPRT 1; F: GTAGCCCTCTGTGTGCTCAA, R: TCACTATTTCTATTCATGCTTTGATG) ve ACTB (F: ATTGGCAATGAGCGGTTC, R: CGTGGATGCCACAGGACT). Daha sonra 8 ul primer karışımı oyukların her birine eklenmiştir. Plaka bir sızdırmazlık folyosu kullanılarak kapatılmış ve analizden önce (2 saatten az) 4 ° C'de saklanmıştır. QPCR çalışma protokolü, 5 dakika boyunca 95 ° C'lik bir başlangıç ​​ön inhubasyondan sonra 45 amplifikasyon çevriminden (10 saniye için 95 ° C; 10 saniye için 60 ° C; tek bir tespit ile 5 saniye boyunca 72 ° C) oluşmaktadır. Erime eğrisi analizi derece santigrat derece başına 5 kazanımla 65 ° C'den 97 ° C'ye ısıtılarak gerçekleştirildi. İstatistiki Analizler Tüm istatistiksel analizler İstatistiksel Paket Sosyal Bilimler için (sürüm 21; IBM, Armonk, NY, http://www.ibm.com).

Sonuçlar Histoloji ve İmmünohistokimya Toplam diz replasmanı geçiren bir hastadan alınan doku kesitlerinde, adipositler, içerdikleri lipid doku işlemi sırasında çözündüğünden soluk çıktı. Geride kalan hücre membranları, ağ benzeri bir görünüme sahipti. Küçük kılcal damarlar, bu hücre membranları arasında, daha büyük damarlarla, duvarların düz kas içerdiği, adipositlerin her tarafında dağılmış haliyle koştular. Sinovyal membran dokunun sağ tarafında bulunur (Şek.). Sinovyum villöz …

Devamını Oku »

Polisakkarit Spesifik Bellek …

Gerekçe: Deneysel pnömokok taşıyıcılığının bağışıklığı arttırdığını ve sağlıklı olmasını daha önce gösterdik (19459009) Hedefler: Bir heterolog kullanarak nakliye kazanımına karşı korunmada doğal olarak edinilmiş pnömokok protein ve polisakkarit (PS) özgül bağışıklığın rolünü araştırmak Yöntemler: Doğal olarak pnömokok ile kolonize edilmiş sağlıklı gönüllüleri tespit ettik ve doğal taşıyıcı ataklarının temizlenmesinden sonra, onlara heterolog bir 6B suşu ile meydan okuduk. Başka bir …

Devamını Oku »

Li-ion batts ile uzaya giderken, yapma …

                                  Sony, 1991'de dünyanın ilk ticari lityum iyon pilini piyasaya sundu … ve o zamandan beri tasarım o kadar da değişmedi.                  Yeni araştırma, sıvılaştırılmış gazın dahil edilmesinin, lityum-iyon pillerin daha önce mümkün olmadığından daha düşük sıcaklıklarda çalışmasına izin verebileceğini önermektedir.                  Lityum iyon piller ucuz, oldukça güvenilir ve yüksek bir enerji yoğunluğuna sahip. Uzaydaki nesneleri güçlendirmek için ideal …

Devamını Oku »

Buenos Aires Stratejileri Wai …

Avrupa PMC Javascript'in etkin bir şekilde çalışmasını gerektiriyor. Ya web tarayıcınız Javascript'i desteklemiyor veya şu anda kapalı. İkinci durumda, lütfen Web tarayıcınızda Javascript desteğini açın ve bu sayfayı yeniden yükleyin. "'); exportDisplaySection (); // $ (". Results_pagination_range"). FadeOut (hız – 100) $ ( '# ExportPanel') odak ().; } Else { $ ( "# ExportPanel") slideUp (hız).; SetTimeout (işlev () { …

Devamını Oku »

Bir Ön Soruşturma …

Avrupa PMC Javascript'in etkin bir şekilde çalışmasını gerektiriyor. Ya web tarayıcınız Javascript'i desteklemiyor veya şu anda kapalı. İkinci durumda, lütfen Web tarayıcınızda Javascript desteğini açın ve bu sayfayı yeniden yükleyin. "'); exportDisplaySection (); // $ (". Results_pagination_range"). FadeOut (hız – 100) $ ( '# ExportPanel') odak ().; } Else { $ ( "# ExportPanel") slideUp (hız).; SetTimeout (işlev () { …

Devamını Oku »

Sarılmış fotonlar rekor dağılımda dolaşıyor …

                                  Yörüngedeki bir uyduda oluşturulan dolaşmış fotonların çiftleri uzaydan yer istasyonlarına kadar uzun ve tehlikeli yolculuktan kurtuldu. Kritik olarak, daha önce görülmüş en uzun bağlantı olan 1.200 km'den (745 mil) uzaktaki alıcılar tarafından alınıyor olsalar bile hala birbirine bağlı.                  Araştırmaya dahil olmayan Avusturyalı Viyana'daki Kuantum Optiği ve Kuantum Enstitüsü'nde kuantum fizikçisi olan Rupert Ursin, "Bu bilimsel bir gelişmedir" …

Devamını Oku »

Endükleyen veya Ove Etkileyen Faktörler …

Avrupa PMC Javascript'in etkin bir şekilde çalışmasını gerektiriyor. Ya web tarayıcınız Javascript'i desteklemiyor veya şu anda kapalı. İkinci durumda, lütfen Web tarayıcınızda Javascript desteğini açın ve bu sayfayı yeniden yükleyin. "'); exportDisplaySection (); // $ (". Results_pagination_range"). FadeOut (hız – 100) $ ( '# ExportPanel') odak ().; } Else { $ ( "# ExportPanel") slideUp (hız).; SetTimeout (işlev () { …

Devamını Oku »

Hepitopes: Etkileşimli bir interaktif …

Kataloglama çabaları HBV'deki tüm yayınlanmış sınıf I epitoplarının (Hepitopes) sitelerin ve dizilerin bu retrospektif harmanlama ve katalog çalışması, bu alandaki bilgi tabanına yararlı bir katkıdır. Bu sistematik literatür incelemesi, bilgi çok dağınık olduğundan açıkça manuel bir çaba olmuştur. Hedefli araştırmalar yapmak için seçilen iki çevrimiçi bibliyografik veri tabanı olan Medline ve Embase,% 100 kapsama alanı sunamayabilir ve diğer dillerdeki diğer …

Devamını Oku »

0013848 derialtı ödem 64 MP:

MP … Highly değişken penetrans : 0004613 vertebra kemerleri füzyonu MP: 0010418 perimembranöz ventriküler septal MP: 0000783 anormal önbeyin morfolojisi 47 MP: 0003686 anormal göz kas morfolojisi 45 MP: 0.001.015 küçük üstün servikal gangliyon Kas ventriküler septal kusur 41 MP: 0013835 MP: 0003826 anormal Muller Kanalı morfolojisi 33 MP: 0.014.021 heterochrony 33 [Anormalvertebralartertopolojisi MP: 0014001 32 MP: 0013836 anormal hipoglossal …

Devamını Oku »

Foto -…'ın termal yok edilmesi Hiperpolarize 13 C manyetik rezonans görüntüleme (MRI) son yıllarda biyokimyasal değişiklikleri saptamak için önerilen birkaç moleküler görüntüleme tekniği arasında yer alır In vivo 1 2 . Manyetik rezonans görüntüleme, bilgisayarlı tomografi, pozitron emisyon tomografisi, tek foton emisyonlu bilgisayarlı tomografi, ultrason ve çeşitli optik görüntüleme yöntemleri de dahil olmak üzere çoğu görüntüleme modalitesi, hücresel işlevle ilgili görüşleri ortaya çıkarmak için uyarlanabilir . MR, nümerik manyetik rezonansın (NMR) spektroskopik boyutu vasıtasıyla doğrudan biyokimyasal bilgi sağlayarak, bir substrattan ve metabolik ürünlerinden eşzamanlı sinyal alımını mümkün kılar ve dolayısıyla gerçek metabolik görüntüleme sağlar. NMR'nin nispeten düşük duyarlılığı, gazlar için spin-exchange optik pompalama ve çözülme dinamik nükleer polarizasyon (DNP), parahidrojen ile indüklenen kutuplaşma gibi hiperpolarizasyon teknikleriyle ve sıvıların "kaba kuvvet" yöntemi olarak adlandırılan yöntemi kullanarak önlenebilir. 4 5 6 . Metabolik görüntüleme bağlamında, 13 C, biyomoleküllerin büyük çoğunluğunda her yerde bulunması, çeşitli kimyasal türlerin kolaylıkla ayırt edilmesine izin veren büyük kimyasal kayma dağılımı, düşük doğal bolluğu ve Bir karboksil grubunda olduğu gibi 1 7 8 9 gibi spesifik moleküler konumlarda nispeten uzun boyuna gevşeme zamanı 10 11 . Parahidrojen ile indüklenen polarizasyon, in vivo 13 C MRI 12 12 için önerilen ilk hiperpolarizasyon tekniğidir, ancak çözünme DNP, biyomedikal uygulamalarındaki çok yönlülüğü nedeniyle daha popüler hale gelmiştir 14 . NMR sinyalinin kaynağı, bir radyo frekansı (RF) bobininin içine çekilen çekirdek dönmelerinin manyetik momenti tarafından üretilen elektromotor kuvvettir , NMR'nin düşük duyarlılığının ardındaki başlıca fiziksel neden, nükleer spinli manyetik momentlerin küçük kutuplaşmasıyla birlikte 15 küçüklüğündendir. Elektromotor kuvvetin kuvveti, 13 C gibi bir spin-½ çekirdek için

Son deney seti Elde edilebilir maksimum 13 C polarizasyonunu () değerlendirmek için DNP'yi takiben aynı protokolü 4.2 K yerine 1 K'de tekrar ederek. 3 saat mikrodalga ışınlamadan sonra, katı hal 13 kutuplanması% 12.0 ±% 0.5'e ulaştı. Termalleştirme, ekstraksiyon, enjeksiyon pompasına ex situ eritme ve aktarma işleminden sonra 9.4 T'de ölçülen iyileşme, bir 13 C sıvıya dönüştürücü sıvıya karşılık gelen 10.400 …

Devamını Oku »

Avrupa'nın Pozisyon Belgesi …

1 Yaşlanma üzerine Kardiyoloji ve Mükemmellik Merkezi Enstitüsü 'G. D'Annunzio 'University – Chieti, Chieti, İtalya 2 Texas Kalp Enstitüsü, Houston, ABD 3 Hubrecht Enstitüsü, Üniversite Tıp Merkezi 4 4 Hatter Kardiyovasküler Enstitüsü, Kardiyovasküler Bilimler Enstitüsü, Londra Üniversitesi, Londra, İngiltere 5 Deneysel 6 Duke-National Kardiyovasküler ve Metabolik Bozukluklar Programı, Renal ve Kardiyovasküler Araştırma, Nefropatoloji Anabilim Dalı, Patoloji Enstitüsü, Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU) …

Devamını Oku »

Vektörel biyoloji resea ilerliyor …

Toplam 211 yanıt elde edildi (bkz. S2 Tablosu). Ankete katılanların yaklaşık% 88'i Avrupa, Fransa ve daha sonra Birleşik Krallık en çok yanıt veren ülkelerdendi. Bu bulgular, sonuçların Avrupa vektör biyolojisi ve vektör araştırma alanlarındaki mevcut önceliklerin iyi bir genel görünümünü yansıttığını göstermektedir. Araştırma alanları: Araştırmacı katılımcılarla ilgili artropodlar ve patojenler Amacımız, araştırma alanlarına ve çalışma alanlarına genel bir bakış sağlamaktı. …

Devamını Oku »

Theophanes Chryso'nun revizyonları …

1 Her şeyden önce bu yayına götüren araştırmamda bana destek olan herkesi kabul etmek isterim. Bu makale için el yazması çalışma Wellcome Trust University Award (091648 / Z / 10 / Z) sırasında gerçekleştirildi. Dionysios Stathakopoulos ve Petros Bouras-Vallianatos, bu yazının sunulduğu Belgrad'daki Bizans Araştırmaları konferansında bir sunum yapmaya davet edildiler. Ayrıca, el yazmalarının taranmasını sağlayan kütüphanelere ve özellikle de …

Devamını Oku »

Faj indüklenebilir adalar …

Bu elementte aşağıdaki temel yaşam döngüsü genlerini test ettik: int / xis (entegrasyon / eksizyon), rep / ori [19459003(Çoğaltmabaşlatıcısıreplikasyonorijini)ve rpr (bastırıcı) işlevselliği için tesadüfen bulundu ve tesadüfen elementin teriminin S SaPI'lerde ve SaPI'lerde SaPI'ye spesifik transfer için gerekli olan bir gen (Ubeda ve ark. 2007b). Ayrıca, EfCIV583 indüksiyonundan sorumlu olan p1 genini tespit ettik. Faj p1 kodlu EfCIV583 indükleyicisinin tanımlanması …

Devamını Oku »